ID: 1007052311

View in Genome Browser
Species Human (GRCh38)
Location 6:38844684-38844706
Sequence CTGAGCAACTAGATGTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007052311_1007052316 24 Left 1007052311 6:38844684-38844706 CCCAGATACATCTAGTTGCTCAG 0: 1
1: 0
2: 1
3: 9
4: 89
Right 1007052316 6:38844731-38844753 AATTAGATTCCTGCTGTTACTGG 0: 1
1: 1
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007052311 Original CRISPR CTGAGCAACTAGATGTATCT GGG (reversed) Intronic
903970457 1:27115441-27115463 CTGAGCATCTAGTTGTATGTTGG + Intronic
911154003 1:94621729-94621751 CTGAGAAACTGGGTGTCTCTGGG + Intergenic
912770381 1:112458579-112458601 CGAAGCAACTAGATGTGGCTGGG + Exonic
913066045 1:115255987-115256009 CTGAGCCACTCGATCAATCTTGG - Intergenic
916433767 1:164758052-164758074 CTGGGCAAGTAGATGGTTCTGGG - Intronic
918664085 1:187126822-187126844 CTTAGCAACAATATTTATCTTGG + Intergenic
918763291 1:188444006-188444028 CTGAGTAACTCGATGTATGGTGG + Intergenic
919803283 1:201366213-201366235 CTGGGCAAATAAATGGATCTGGG + Intronic
1065082716 10:22143207-22143229 CTGACCATCTCGCTGTATCTGGG - Intergenic
1068959871 10:62855774-62855796 CTGAGCATCAAGATGGATATTGG + Intronic
1073213337 10:101822214-101822236 CTGAGCAACTAGATGGATGTTGG + Intergenic
1074532706 10:114307858-114307880 CTGAGCAACCTAATGAATCTGGG - Exonic
1079177030 11:18151846-18151868 CTGAGCACCTAGAAGCATTTTGG - Intronic
1079461209 11:20679775-20679797 CTGAGGATCTAGGAGTATCTAGG - Intronic
1080731229 11:34956115-34956137 CTAAGCAACTAGATTTTTCTTGG + Intronic
1080815009 11:35747076-35747098 CTCAGCTGCTAGATGCATCTTGG + Intronic
1081539957 11:44027130-44027152 CTGAGAAACTTATTGTATCTAGG - Intergenic
1083488390 11:62997523-62997545 CTGAGCATCAAGATTTTTCTAGG - Intronic
1089534463 11:119152235-119152257 GTGAGTCACTAGATGTCTCTGGG + Intronic
1089580162 11:119476711-119476733 GTGAGCACCTAGCTGTGTCTAGG + Intergenic
1089853038 11:121516669-121516691 CTGAGCATCAAAATGTATCATGG - Intronic
1091559032 12:1596387-1596409 CTGTGCACCTAGATGTGTTTGGG + Intronic
1091855528 12:3736296-3736318 CTGAGCTGGTAGAGGTATCTAGG + Intronic
1097214270 12:57397738-57397760 CTTAAAAATTAGATGTATCTGGG - Intronic
1097501868 12:60413166-60413188 CTATGCAACTATATGTATCTAGG + Intergenic
1102920347 12:116787167-116787189 CTGAGCAACTGGGTGTTTTTTGG - Intronic
1108989467 13:56637045-56637067 GTCAACAACTAGATGTTTCTAGG - Intergenic
1110605933 13:77432565-77432587 CTGAGCCACCAGATGTATAAGGG - Intergenic
1110667085 13:78129630-78129652 CTGAGTAACTAGACTAATCTAGG + Intergenic
1112682697 13:101785481-101785503 CTGGGCAACTTGATGTATGTAGG + Intronic
1114788639 14:25629952-25629974 CTGAGCAAGGAGTAGTATCTTGG - Intergenic
1124348077 15:28935522-28935544 CAGAGGAAGTAGAGGTATCTGGG + Intronic
1125058742 15:35393172-35393194 CTGAGCAGCTGGAGGAATCTAGG + Intronic
1133744965 16:8679375-8679397 CTGAGCACCTAGAGGGATCCTGG + Intronic
1134098266 16:11434003-11434025 CTGACCAACTGGCTGTAACTTGG - Intronic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1142012469 16:87722868-87722890 CTGAGCAAGTAGAGGTGGCTTGG - Intronic
1158903542 18:61988410-61988432 ATGAACCACTAGAAGTATCTGGG + Intergenic
1158903549 18:61988471-61988493 GTGAACCACTAGAAGTATCTGGG + Intergenic
1159001672 18:62980455-62980477 CTCAGCAGCCAGATGTTTCTTGG + Intergenic
1159593596 18:70361181-70361203 CTGAGGAACTGGATATAACTAGG + Intergenic
1164019456 19:21286131-21286153 CTGAGAAGCTGGATGTATCCAGG + Intronic
1167078993 19:47266528-47266550 CTGAGCAAGTGGATGTGCCTCGG + Intronic
927385522 2:22529059-22529081 TGGAGCAACTACATGGATCTAGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
931623111 2:64230788-64230810 CTGAGTGATTAGATGAATCTTGG + Intergenic
932875252 2:75444471-75444493 CTCAGCAACTACATCTATGTAGG - Intergenic
939887930 2:147701530-147701552 CTTAGCATGTAGCTGTATCTTGG - Intergenic
947769813 2:232661968-232661990 CTGAGCAACAAGGGGTCTCTGGG + Intronic
1170173483 20:13441324-13441346 CTGCTCAACTAGATGTATGCAGG - Intronic
1170522632 20:17203417-17203439 CTGTGCAACTAGCTGTATTTAGG + Intergenic
1171016868 20:21549814-21549836 CTCAGCTACTGGATGTACCTGGG - Intergenic
1172193945 20:33079341-33079363 GTTAGAAACTAGATGCATCTGGG + Intergenic
1181310366 22:21941427-21941449 CTGAGCAACTAGAAGGCTCGTGG + Intronic
1182240598 22:28913005-28913027 CTGAGCGGCTTGATTTATCTTGG + Intronic
1182540297 22:31036495-31036517 CTGAGAAGCTGGATGTAGCTTGG - Intergenic
949589332 3:5476971-5476993 ATGAGCAACTAATTGTATCCCGG - Intergenic
951114054 3:18838995-18839017 CTGAGCACCTGGGTGCATCTGGG - Intergenic
952379749 3:32795539-32795561 CTGAGCACCTGGATGTATGATGG - Intergenic
953066931 3:39482148-39482170 TTGAGCAACTAGATGGGTGTTGG - Intronic
956636426 3:71369800-71369822 CTGAGAAAGTAGCTGTTTCTTGG - Intronic
964366227 3:155953472-155953494 ATGAGCCAGTTGATGTATCTGGG + Intergenic
964424370 3:156535670-156535692 CTGAGTAACTAGAAGTATATTGG - Intronic
964913143 3:161806510-161806532 CTGAGCACCTAGATTAAACTAGG + Intergenic
966531059 3:180980751-180980773 CTTAGCAACAAGATATATATAGG - Exonic
967870781 3:194227213-194227235 CTGAGTAACTAGGTGGATGTTGG - Intergenic
969378715 4:6780490-6780512 CTGGGCATCTAGATGTCTCTGGG + Intergenic
972172157 4:36359421-36359443 CTGATCATCAAGATGTATTTAGG - Intergenic
975078123 4:70238833-70238855 CTGAGCCACTAGTAGTATCATGG + Intergenic
981646338 4:147003169-147003191 CTGAGAATCTAGATGTATTGGGG - Intergenic
983593264 4:169438570-169438592 CAGAGCAATTAGAAGTAACTAGG - Intronic
985613000 5:900625-900647 CTGAGCAACTTGATGCAGATGGG + Intronic
989319366 5:40117188-40117210 CTGAGGAACAGGATGTACCTGGG - Intergenic
991338031 5:65572704-65572726 TTGAGCAACTAGATGGATACTGG - Intronic
993507741 5:88732116-88732138 CTGAGCAAGTTGATGTATATTGG - Intronic
997757724 5:136415472-136415494 CTGATCAACTATATTTATGTTGG + Intergenic
1007052311 6:38844684-38844706 CTGAGCAACTAGATGTATCTGGG - Intronic
1008130073 6:47711224-47711246 TTAATCAACTAAATGTATCTAGG + Intronic
1008152380 6:47970029-47970051 CTGAGCATATGGATGTAGCTGGG + Intronic
1010555775 6:77277483-77277505 CTGAGCTACTAGATCTTTCTTGG - Intergenic
1012467367 6:99530550-99530572 CTGACCAACTAGCTGTAAATCGG + Intergenic
1016051423 6:139534394-139534416 CTGAGCAAGCAGATGCAGCTTGG - Intergenic
1016753271 6:147654877-147654899 CTGAGTCACTAGAAGCATCTGGG + Intronic
1016918867 6:149271618-149271640 CTGAGCAGCTAGCTGTAGATAGG - Intronic
1018376963 6:163222054-163222076 CTGAACAACTTGATTTATTTAGG - Intronic
1045573370 8:103392956-103392978 CAGAGCAACTAACTGTATTTTGG - Intergenic
1048667817 8:136683780-136683802 CTGGGCTGCTAGATGTCTCTAGG + Intergenic
1049966440 9:784536-784558 CTGACCAACTAGCTGTAAATTGG + Intergenic
1057929386 9:99180434-99180456 TTGAGCAAACAGATCTATCTAGG + Intergenic
1058167651 9:101638136-101638158 CTGAGCCTCTGGATGTACCTCGG + Intronic
1059472859 9:114519852-114519874 CTGACCAACCAGCTGTATATCGG - Intergenic
1060393100 9:123294764-123294786 ATTAGCACTTAGATGTATCTTGG + Intergenic
1186763581 X:12748130-12748152 ATGAGCAACTCAATGTAGCTTGG + Intergenic
1189366328 X:40391678-40391700 CTCAGCCACTAGGTGAATCTGGG + Intergenic
1190123821 X:47685913-47685935 CTGAGGTAATAGAAGTATCTTGG - Intergenic
1193523154 X:82555546-82555568 ATGACCAACTAGATGCAGCTAGG + Intergenic
1193888715 X:87016837-87016859 ATGACCAACTAGATGCAGCTGGG + Intergenic
1194746272 X:97631824-97631846 CTGAGAAAGTATATGTATATCGG - Intergenic
1198559879 X:137838061-137838083 CTGAGAAACTAGGTGTCCCTAGG - Intergenic
1199844575 X:151681429-151681451 CTGAGCAGCGAGATGTGCCTTGG - Intergenic