ID: 1007053500

View in Genome Browser
Species Human (GRCh38)
Location 6:38857969-38857991
Sequence GGTTTAATGGAACAATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007053500_1007053506 22 Left 1007053500 6:38857969-38857991 CCAGCTAATTGTTCCATTAAACC 0: 1
1: 0
2: 0
3: 4
4: 158
Right 1007053506 6:38858014-38858036 ATTTAGGTCATAAGCTATGCTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1007053500_1007053507 23 Left 1007053500 6:38857969-38857991 CCAGCTAATTGTTCCATTAAACC 0: 1
1: 0
2: 0
3: 4
4: 158
Right 1007053507 6:38858015-38858037 TTTAGGTCATAAGCTATGCTGGG No data
1007053500_1007053505 6 Left 1007053500 6:38857969-38857991 CCAGCTAATTGTTCCATTAAACC 0: 1
1: 0
2: 0
3: 4
4: 158
Right 1007053505 6:38857998-38858020 CCAGGAACATGATATAATTTAGG 0: 1
1: 0
2: 1
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007053500 Original CRISPR GGTTTAATGGAACAATTAGC TGG (reversed) Intronic
900498118 1:2985755-2985777 GGATCAATGGATCAATGAGCTGG - Intergenic
904988936 1:34576070-34576092 GGTTCAATGGAAAAGTTGGCAGG - Intergenic
906866608 1:49427830-49427852 TGTAAAATGGACCAATTAGCAGG - Intronic
907784780 1:57600766-57600788 GCTTTAATGGAAAAATGAGATGG + Intronic
907793470 1:57691383-57691405 TGTAAAATGGAACAATCAGCAGG + Intronic
909761055 1:79287893-79287915 GTTTTAATGGAAAAATTATATGG + Intergenic
917675913 1:177319589-177319611 TGTTAAATGGACCAATCAGCAGG + Intergenic
917840792 1:178975845-178975867 TGTATAATGGACCAATCAGCAGG + Intergenic
918842536 1:189560605-189560627 TGTAAAATGGACCAATTAGCAGG - Intergenic
921094279 1:211873767-211873789 TGTAAAATGGAACAATCAGCAGG - Intergenic
921978920 1:221233960-221233982 TGTAAAATGGACCAATTAGCAGG + Intergenic
922661954 1:227437779-227437801 GGTTTAATAGAACCATCAGATGG - Intergenic
923564873 1:235069131-235069153 GTTTTAATACAACAATTAGCTGG - Intergenic
1063320909 10:5052441-5052463 TGTACAATGGAACAATCAGCAGG - Intronic
1063322082 10:5060308-5060330 TGTAAAATGGAACAATCAGCAGG - Intronic
1064563080 10:16611660-16611682 GGTTTACTGTCACTATTAGCTGG - Intronic
1064590040 10:16880170-16880192 GGTTTTATGGCACAATTAACAGG - Intronic
1064995111 10:21289836-21289858 TCTTCAATGGAACAATAAGCAGG - Intergenic
1065381193 10:25092304-25092326 GGATCAATGGAACAAAAAGCTGG - Intergenic
1068792387 10:61041355-61041377 TGTAAAATGGAACAATCAGCAGG + Intergenic
1071035636 10:81240963-81240985 AGTTTAAAGAAACAAATAGCTGG + Intergenic
1071075565 10:81747274-81747296 GATGTAATGGAACAGATAGCTGG - Intergenic
1072152372 10:92692998-92693020 GGATTTATAAAACAATTAGCTGG - Intronic
1072374616 10:94802067-94802089 GGTAAAATGGACCAATCAGCAGG - Intronic
1075146017 10:119883822-119883844 TGTAAAATGGAACAATCAGCAGG + Intronic
1077784055 11:5363406-5363428 GGCTTAAAGGAACAATTAATTGG - Intronic
1086338002 11:85818520-85818542 GGTTTTATGTAAAAATCAGCAGG + Intergenic
1091256209 11:134188342-134188364 TGTAAAATGGACCAATTAGCAGG + Intronic
1092646594 12:10581127-10581149 TGTAAAATGGACCAATTAGCAGG + Intergenic
1093386085 12:18556203-18556225 TGTTTAATGGCAGCATTAGCAGG - Intronic
1095454576 12:42369468-42369490 GGTTTAATGGAAGTAATACCAGG + Intronic
1096235090 12:49921028-49921050 TGATTAATGAAACAATTAGGAGG - Intergenic
1097664079 12:62460868-62460890 TGTAAAATGGAACAATCAGCAGG - Intergenic
1098466547 12:70793662-70793684 CGTTTGATGGAAGAATGAGCAGG - Intronic
1098882367 12:75929582-75929604 GGTTTACTGCAGCAATCAGCTGG + Intergenic
1100422846 12:94454530-94454552 TGTAAAATGGACCAATTAGCAGG + Intronic
1105665687 13:22553093-22553115 TGTAAAATGGACCAATTAGCAGG - Intergenic
1108817844 13:54313603-54313625 TGTAAAATGGAACAATCAGCAGG + Intergenic
1108855431 13:54787359-54787381 TGTAAAATGGAACAATCAGCAGG - Intergenic
1110906443 13:80896611-80896633 TGTAAAATGGACCAATTAGCAGG + Intergenic
1110999724 13:82164590-82164612 TGTAAAATGGAACAATCAGCAGG - Intergenic
1111178711 13:84634566-84634588 GTTTTAATGAAACAATCTGCAGG - Intergenic
1113770800 13:112907265-112907287 GGTTTGCAGAAACAATTAGCTGG + Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1120198462 14:81513195-81513217 CGTAAAATGGACCAATTAGCAGG + Intronic
1127829750 15:62739901-62739923 GGTTTAATGGACCATTCAGATGG + Intronic
1130625010 15:85505279-85505301 GTTTTAATGGACCAAATAGGTGG + Intronic
1131908811 15:97173357-97173379 TGTAAAATGGAACAATCAGCAGG + Intergenic
1133908273 16:10041211-10041233 GGGTTGTTGGAAGAATTAGCTGG - Intronic
1134397507 16:13878554-13878576 GGTTTATTGGAAGAATTACAGGG - Intergenic
1138168967 16:54830716-54830738 TGTATAATGGACCAATCAGCAGG + Intergenic
1138877725 16:60973412-60973434 GGTAAAATGGACCAATCAGCAGG + Intergenic
1144008641 17:11124469-11124491 GGTTTAAAGGAAAAATTATTTGG + Intergenic
1149342623 17:55702230-55702252 TGTAAAATGGAACAATCAGCAGG + Intergenic
1152711864 17:81875259-81875281 GGTTTATTACAAAAATTAGCTGG + Intergenic
1155602684 18:27567967-27567989 ATTTAAATGGGACAATTAGCTGG + Intergenic
1158282205 18:55840366-55840388 TGTATAATGGACCAATCAGCAGG - Intergenic
1158328969 18:56340515-56340537 GGTTTAATGGTAGATTCAGCAGG + Intergenic
1168701591 19:58442975-58442997 TGTATAATGGACCAATCAGCAGG - Intergenic
928595958 2:32858928-32858950 TGTAAAATGGACCAATTAGCAGG - Intergenic
929397901 2:41544511-41544533 GGTTTAAAGTGACAATTACCAGG - Intergenic
930420752 2:51151032-51151054 TGTAAAATGGACCAATTAGCAGG - Intergenic
933261841 2:80140072-80140094 GGATTATTGGAACAATAGGCAGG + Intronic
935483001 2:103616733-103616755 TGTTAAATGGACCAATCAGCAGG + Intergenic
942044669 2:172093207-172093229 GTTTTGATGGAAGAATTAGCTGG + Intergenic
943520504 2:188943964-188943986 TGTATAATGGACCAATCAGCAGG - Intergenic
943577716 2:189650927-189650949 TGTAAAATGGACCAATTAGCAGG + Intergenic
944999921 2:205337990-205338012 GTTTTAATACAAAAATTAGCCGG + Intronic
945069746 2:205977937-205977959 TGTAAAATGGACCAATTAGCAGG + Intergenic
946718411 2:222577990-222578012 GATTTAAAGTTACAATTAGCTGG - Intronic
1171090918 20:22285200-22285222 AGTTAAATGGAATTATTAGCAGG - Intergenic
1173945876 20:46950576-46950598 GGAGTAATGGAACATTAAGCAGG + Intronic
1174849051 20:53974148-53974170 TGTAAAATGGACCAATTAGCAGG + Intronic
1177796000 21:25779056-25779078 TGTAAAATGGACCAATTAGCAGG + Intergenic
1180040140 21:45273085-45273107 AGTTAAATGAAACAATAAGCTGG + Intronic
1183048364 22:35240469-35240491 GGTAAAATGGACCAATCAGCAGG + Intergenic
956508656 3:69971211-69971233 TGTTCTTTGGAACAATTAGCAGG - Intergenic
957262040 3:77914360-77914382 GGTTTTATGGAAAAAATATCTGG + Intergenic
958163077 3:89842502-89842524 TGTTTAATGGAATAATAACCTGG + Intergenic
959564284 3:107818605-107818627 TGTAAAATGGACCAATTAGCAGG + Intergenic
960020805 3:112950238-112950260 AGTTTAATACAAAAATTAGCCGG + Intronic
960104819 3:113784167-113784189 GGTTTAAAGACACAATTAACAGG - Intronic
961191477 3:124965968-124965990 GGTTAAATGAAGCATTTAGCTGG - Exonic
961584861 3:127914149-127914171 GGTAAAATGGACCAATCAGCAGG + Intergenic
966519672 3:180859404-180859426 GGATTAATGAAACAAAAAGCTGG + Intronic
967951020 3:194840756-194840778 TGTAAAATGGACCAATTAGCAGG + Intergenic
971468536 4:26992610-26992632 GGTTTAATGAAACAAAAAGGTGG + Intronic
971564093 4:28116841-28116863 TGTAAAATGGAACAATCAGCAGG - Intergenic
971807724 4:31382124-31382146 TGTTTAAATAAACAATTAGCTGG - Intergenic
973837707 4:54826964-54826986 GGTTAAATGGCACAATTAAAAGG + Intergenic
975944789 4:79692938-79692960 GGATAAATGAAACAAATAGCTGG - Intergenic
976285810 4:83370204-83370226 AGTTCTATGGAACAATTAGATGG + Intergenic
980732074 4:136836537-136836559 GGTTTCATGGAACAAATTGTAGG - Intergenic
980793279 4:137647692-137647714 GGTTTAATGCAAAAATTTGGGGG - Intergenic
981280709 4:142954962-142954984 TGTAAAATGGAACAATCAGCAGG + Intergenic
983351172 4:166590752-166590774 GGTTTCTTGGAACAATCACCAGG - Intergenic
984275611 4:177606566-177606588 TGTAAAATGGACCAATTAGCAGG - Intergenic
984664524 4:182411352-182411374 CATTTAATGCAACAATCAGCTGG - Intronic
986871116 5:12047991-12048013 TGTAAAATGGAACAATCAGCAGG - Intergenic
990116394 5:52397474-52397496 TGTAAAATGGACCAATTAGCAGG + Intergenic
990117205 5:52403450-52403472 TGTAAAATGGACCAATTAGCAGG + Intergenic
993385340 5:87255748-87255770 GGTTAAATGGAATGATTGGCAGG - Intergenic
995408206 5:111826265-111826287 TGTATAATGGACCAATCAGCAGG + Intronic
995649883 5:114358574-114358596 GCTTTAATGGAACAAAAAGAAGG + Intergenic
995928594 5:117407419-117407441 TGTTTAATGGACCAATCAGCAGG - Intergenic
996077901 5:119219002-119219024 TGTTTAATGGATCAATTAAATGG - Intronic
996567326 5:124893171-124893193 TGTTAAATGGACCAATCAGCAGG + Intergenic
998452228 5:142243965-142243987 ATATTAATGGAACATTTAGCCGG - Intergenic
1000998736 5:167984994-167985016 GTTATAATGAAACATTTAGCTGG - Intronic
1001497263 5:172197868-172197890 TGTTAAATGGACCAATCAGCAGG - Intronic
1001497526 5:172200031-172200053 GGTTCAATAGATCAAGTAGCTGG + Intronic
1003213862 6:4090989-4091011 TGTAAAATGGACCAATTAGCAGG + Intronic
1003531489 6:6940809-6940831 TGTATAATGGACCAATCAGCAGG + Intergenic
1004483134 6:16039990-16040012 TGTAAAATGGACCAATTAGCAGG - Intergenic
1004508503 6:16265720-16265742 TGTTAAATGGACCAATCAGCAGG + Intronic
1004883808 6:20033052-20033074 GGTAAAATGGACCAATCAGCAGG + Intergenic
1004914730 6:20321052-20321074 GGTAAAATGGACCAATCAGCAGG + Intergenic
1007053500 6:38857969-38857991 GGTTTAATGGAACAATTAGCTGG - Intronic
1008161875 6:48087865-48087887 GTCTTAATGGAACAATTATATGG + Intergenic
1008478046 6:51954010-51954032 GGATTACTGAAAGAATTAGCTGG - Intronic
1010330697 6:74620529-74620551 GGTTTAAAGGAACAGTTATAGGG + Intergenic
1012038448 6:94173083-94173105 TGTATAATGGACCAATCAGCAGG + Intergenic
1012559543 6:100563426-100563448 GGTTTAATTCAACAAGTAGGAGG - Intronic
1013126945 6:107193075-107193097 GGACAAATGGAACATTTAGCAGG - Intronic
1013960199 6:115889813-115889835 GGTAAAATGGACCAATCAGCAGG + Intergenic
1014143067 6:117966068-117966090 TGTAAAATGGACCAATTAGCAGG + Intronic
1018467662 6:164065930-164065952 GGTATAATGGAAAAAGTAGTAGG + Intergenic
1020679077 7:11214617-11214639 GTGTTCATGGACCAATTAGCAGG - Intergenic
1024421064 7:49167250-49167272 GGTTTAATTTAAAAATTAGAAGG - Intergenic
1025156184 7:56607754-56607776 GGTTTCATGGGAAAAGTAGCTGG + Intergenic
1025760687 7:64387990-64388012 GGTTTCATGGGAAAAGTAGCTGG - Intergenic
1026541545 7:71283976-71283998 TGTATAATGGACCAATCAGCAGG + Intronic
1028151860 7:87383211-87383233 GGTATAATGGTACAGTTAGATGG - Intronic
1031490701 7:122384151-122384173 GGTTTAATGGAGTGATTAGTGGG - Intronic
1031811453 7:126374639-126374661 GATTTAAAGGAATAATTAGGAGG + Intergenic
1033801197 7:144904503-144904525 TGATTTATGCAACAATTAGCAGG - Intergenic
1036378369 8:8219615-8219637 TGTAAAATGGAACAATCAGCAGG + Intergenic
1037177034 8:15959694-15959716 GTTATAAGGGAACAATGAGCAGG + Intergenic
1038352720 8:26794157-26794179 GGAATAATGGAATAATTAACAGG + Intronic
1039345144 8:36695235-36695257 GTCTTAATGGCACAATTGGCAGG + Intergenic
1040559018 8:48507381-48507403 GGTAAAATGGACCAATCAGCAGG + Intergenic
1040952991 8:52954607-52954629 GGTAAAATGGACCAATCAGCAGG + Intergenic
1042474755 8:69234625-69234647 TGTTTAATGAAACACTCAGCTGG + Intergenic
1042785602 8:72543521-72543543 GGATTAATGAATCAATTAACAGG + Intronic
1043057135 8:75453436-75453458 TGTTAAATGGACCAATCAGCAGG + Intronic
1043256719 8:78147982-78148004 GGTAAAATGGACCAATCAGCAGG + Intergenic
1043731831 8:83693565-83693587 TGTAAAATGGACCAATTAGCAGG - Intergenic
1050610975 9:7353276-7353298 GCTAAAATGGAACAATTGGCTGG + Intergenic
1052014958 9:23452770-23452792 TGTTAAATGGACCAATCAGCAGG + Intergenic
1059587497 9:115621701-115621723 GGTTTAATTGACCACTTGGCTGG + Intergenic
1060467007 9:123915513-123915535 GGGTTAATGGAACAATAAAGAGG + Intronic
1186950467 X:14619082-14619104 TGTTTGATGGAATAACTAGCAGG + Intronic
1188097349 X:26041597-26041619 TGTAAAATGGACCAATTAGCAGG + Intergenic
1194066635 X:89269537-89269559 TGTAAAATGGAACAATCAGCAGG - Intergenic
1195288029 X:103404569-103404591 GGTTTGATGGAACAATGTCCCGG - Intergenic
1196289213 X:113918712-113918734 GGTTTTATGAAACACTTAGTAGG - Intergenic
1196988860 X:121305500-121305522 GCTTGAATGGAACAATGAGTAGG - Intergenic
1197386030 X:125803229-125803251 GACTTAATGGTAAAATTAGCTGG + Intergenic
1198977352 X:142351791-142351813 GGTAAAATGGACCAATCAGCAGG + Intergenic
1199628241 X:149759453-149759475 TGTAAAATGGACCAATTAGCAGG + Intergenic
1201907491 Y:19100590-19100612 TGTTAAATGGACCAATCAGCAGG - Intergenic
1202342697 Y:23886498-23886520 TGTAAAATGGAACAATCAGCAGG - Intergenic
1202528072 Y:25783587-25783609 TGTAAAATGGAACAATCAGCAGG + Intergenic