ID: 1007055125

View in Genome Browser
Species Human (GRCh38)
Location 6:38875399-38875421
Sequence CCATGCTGCCTGTCTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007055123_1007055125 -10 Left 1007055123 6:38875386-38875408 CCTTTCTGCTAGACCATGCTGCC 0: 1
1: 0
2: 1
3: 27
4: 179
Right 1007055125 6:38875399-38875421 CCATGCTGCCTGTCTAAAACAGG 0: 1
1: 0
2: 3
3: 11
4: 126
1007055122_1007055125 18 Left 1007055122 6:38875358-38875380 CCACAGGAGCAGATTTTCAGTTC 0: 1
1: 0
2: 1
3: 17
4: 141
Right 1007055125 6:38875399-38875421 CCATGCTGCCTGTCTAAAACAGG 0: 1
1: 0
2: 3
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007055125 Original CRISPR CCATGCTGCCTGTCTAAAAC AGG Intronic
901312346 1:8279062-8279084 ACATGCTCCCTCCCTAAAACTGG + Intergenic
902587835 1:17451930-17451952 TGATGCTGTCTGTCCAAAACAGG + Intergenic
906049124 1:42856137-42856159 ACATGCTGTCTGTGTAAACCAGG + Intergenic
906634489 1:47399653-47399675 CCATGCTGTCTATCTAAAGAAGG - Intergenic
907644763 1:56231312-56231334 CCATGCTGCCTGCCAAAATGTGG - Intergenic
908148318 1:61271625-61271647 CCTTGCTCCCTGTCTGAATCAGG + Intronic
914952329 1:152127258-152127280 GCATGCTGCCTGTCTGAAAAAGG - Intergenic
916790095 1:168117380-168117402 TCATGCTGCCTCTTTAAAAAGGG - Intronic
921482670 1:215680735-215680757 CCAAGCTGCATGTCTGAGACTGG + Intronic
921918694 1:220642297-220642319 CCATGCAGCCTCCCTAACACTGG - Intronic
922571084 1:226635018-226635040 CTCTGCTGCCTGTCTGAAAATGG - Intronic
1064611461 10:17106830-17106852 GCATGCTGCCAGTTTTAAACAGG + Intronic
1066404113 10:35102975-35102997 CAATGCTGCCTGTCTATTATGGG + Intergenic
1068038391 10:51790151-51790173 CTTTGCAGCCTGTCTAAATCTGG + Intronic
1070354162 10:75623242-75623264 CCAGGCTGCCTGTGTTAAATTGG - Intronic
1070664130 10:78331696-78331718 CAATCCTGCCTGTCTGAAATGGG - Intergenic
1071549858 10:86558306-86558328 CCATGCTGCCTGACAAAAATGGG + Intergenic
1072203748 10:93183859-93183881 CCATGCTTCATTTCTAAAAGGGG - Intergenic
1073071354 10:100795670-100795692 CCATCCTGCCTGTCAGAAAAGGG - Intronic
1073565989 10:104536154-104536176 CCATGCTGTGTGCCCAAAACTGG - Intergenic
1073821814 10:107272876-107272898 CCATGCAGCCTCTTAAAAACAGG - Intergenic
1074784652 10:116828349-116828371 CCTTCCTGCCTGTCTACCACAGG - Intergenic
1083977772 11:66137748-66137770 TCATGCTGCATTTCTAAAATAGG - Intronic
1084803442 11:71562696-71562718 CCTTGCTGCCTGTCTGTAACTGG - Intronic
1085249736 11:75135073-75135095 CCAGTCTGCCTGTGGAAAACTGG - Intronic
1088860933 11:113799092-113799114 CCATGCTGCATGTGTAAAGAAGG - Exonic
1089018069 11:115183279-115183301 CCATGCTGCCTGTATTAAACAGG + Intronic
1091246582 11:134101070-134101092 CCATGCTGGCTGTTTAGAATGGG - Intronic
1093839470 12:23879540-23879562 CCATGCTGCTTAACTAATACAGG - Intronic
1097778886 12:63681095-63681117 CCATGCTGCCTTTTTCAAAGAGG - Intergenic
1100170962 12:91974706-91974728 CTATGCTGCCTCTCTAAATAGGG + Intergenic
1103278917 12:119738192-119738214 CCATACTGCCTGTCTAAAATAGG + Intronic
1107431099 13:40341143-40341165 ACATTTTGCCTGTCTAAAGCAGG - Intergenic
1109928764 13:69184569-69184591 CCAACCTGGCTGTCTAAAAATGG - Intergenic
1110264706 13:73524149-73524171 CCATGCTCCCTGCCCAAAAGTGG - Intergenic
1110539238 13:76689242-76689264 CCATGCTGGCACCCTAAAACTGG - Intergenic
1114804644 14:25820833-25820855 CCATGCTGCTTGTCCAAGACTGG - Intergenic
1120351519 14:83366256-83366278 CCATGTTGACTTTATAAAACTGG - Intergenic
1120613350 14:86670577-86670599 CCATGCTGCCTGTTGACAGCTGG + Intergenic
1121045592 14:90785407-90785429 CCATGCTGCCTGTCTTCCCCAGG - Intronic
1121714135 14:96060666-96060688 CCATGCTGCATGCCTGAAAGAGG + Intronic
1123142651 14:106095724-106095746 CCATGCTCCCTGTCCATAAAGGG - Intergenic
1126112881 15:45186016-45186038 CCATGTTGCCTGTGCCAAACAGG + Intronic
1126542630 15:49839651-49839673 TAATGCTGCCTGCCTAAGACAGG - Intergenic
1129419389 15:75411458-75411480 CCATTCAGCCTGTCTTAACCAGG - Intronic
1132388963 15:101424886-101424908 ACATGCTGCATGTATAATACTGG + Intronic
1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG + Exonic
1135933777 16:26761767-26761789 CCACTCTGCCTCTATAAAACAGG + Intergenic
1140644893 16:77018699-77018721 CCAGGCTGCCTTTCTAAGTCTGG - Intergenic
1143562046 17:7702207-7702229 CCATGCTGTCTGTCACAAGCAGG - Intronic
1144733252 17:17540654-17540676 CCATGCTGCCCCTCTCCAACAGG + Intronic
1144736652 17:17559403-17559425 CCAGGCAGCCTGTTTAAAGCGGG + Intronic
1147472470 17:40675847-40675869 CCCTGCCACCTGTCTAAAACAGG - Intergenic
1150459023 17:65331611-65331633 CCATACTGCTTTTCTAAAAGAGG + Intergenic
1153142889 18:1995163-1995185 CCCAGCTGCCTGGCTAAATCAGG - Intergenic
1157820731 18:50766573-50766595 CCATTCTCCCTTTCTCAAACTGG - Intergenic
1158507485 18:58059496-58059518 CCATGCTGCCTGGCTAAGAAGGG + Intronic
1158558991 18:58498245-58498267 CCATGGTCCCTGCCTAAAGCTGG - Intronic
1158769277 18:60495102-60495124 CCAGGCCCCCTCTCTAAAACTGG + Intergenic
1161130469 19:2585561-2585583 CCAGGCTGCCTGTTTCTAACTGG - Intronic
1164140108 19:22452209-22452231 TCCTGCTGCCTTTCTAAAGCTGG + Intronic
1164183831 19:22844099-22844121 TCCTGCTGCCTTTCTAAAGCTGG + Intergenic
1168713822 19:58515986-58516008 CCTTGCTGCCAGCCTATAACGGG + Intronic
926878109 2:17508302-17508324 CCATGCAGCCTTTCCAAACCTGG + Intergenic
928307036 2:30178735-30178757 CCATGCTGGCTGCCTGAAACGGG + Intergenic
932488772 2:72105110-72105132 CCATGCTGCCTGCCTGTCACTGG + Intergenic
932886471 2:75553733-75553755 CCCTGCTGCATGTCAAAAGCAGG - Intronic
935710746 2:105896177-105896199 CCATCGTGCCTGGCTTAAACAGG - Intergenic
937770346 2:125713583-125713605 CCAAGCTGCCTGTGTGACACTGG + Intergenic
941924957 2:170885415-170885437 AAATGCTGCCATTCTAAAACGGG - Intergenic
942730758 2:179058212-179058234 TCATGCTGACTGTCCAAAGCTGG - Intergenic
945825551 2:214716710-214716732 CATTCCTGCCTGGCTAAAACAGG + Intergenic
1170141517 20:13129287-13129309 CCACTGTGCCTGTCTTAAACAGG + Intronic
1170388411 20:15845971-15845993 CCATGTGGCCTGTCTAAAACAGG + Intronic
1170549961 20:17468353-17468375 GTAGGCTGCCTGTCTACAACAGG - Intronic
1170549972 20:17468406-17468428 GTAGGCTGCCTGTCTACAACAGG - Intronic
952643714 3:35630095-35630117 TCATGCTGCCTGACAAAAATAGG - Intergenic
953327079 3:42021527-42021549 CGAAGCTGCCTGTCATAAACAGG - Intronic
953664662 3:44917322-44917344 CCATGCTGCCTGCCGAAATTAGG - Intronic
955076290 3:55616880-55616902 CCAAGCTGACTGTGAAAAACAGG + Intronic
955577240 3:60378993-60379015 TCATGTGCCCTGTCTAAAACTGG + Intronic
955942225 3:64157493-64157515 CCCTGCTGCCTGTGTAAAGCAGG - Intronic
956335692 3:68160859-68160881 CCATGCTGCCTTGCCACAACTGG + Intronic
958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG + Intergenic
960338785 3:116449710-116449732 ACATACTGCCTTTCTAAAAGAGG + Intronic
961424253 3:126832581-126832603 CCATTCTTCCTTTGTAAAACAGG - Intronic
961762534 3:129182529-129182551 CCATTATGCCATTCTAAAACAGG + Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963055290 3:141181662-141181684 CCATGTTGTCTGTTTAAAATGGG + Intergenic
963406013 3:144864918-144864940 CAATAGTGCCTGTATAAAACTGG + Intergenic
966311324 3:178597114-178597136 CCATGATGCCTGTTTAAGTCAGG - Intronic
966766365 3:183465986-183466008 CCAGGTTGGCTCTCTAAAACTGG - Intergenic
967471190 3:189864106-189864128 GCATGCTGCCTGTTTACTACTGG - Intronic
967691004 3:192473632-192473654 TCATGTTTCCTCTCTAAAACAGG + Intronic
971689529 4:29815001-29815023 CTATGTTGCTTGTCTCAAACAGG - Intergenic
975065323 4:70055684-70055706 CCATGCTACATTTCTTAAACTGG - Exonic
975588566 4:75977234-75977256 CCATACTGGCTGGCTAAATCAGG - Intronic
982859877 4:160435088-160435110 CCATCCTGCCTGGCTGACACTGG + Intergenic
983257148 4:165412642-165412664 CAATGCTGCCTGCCTGAGACAGG - Intronic
984181767 4:176491722-176491744 CCAGGCTGCCTTTCAAAAACTGG + Intergenic
986120264 5:4828791-4828813 CCATGTTTCCAGTCTAACACAGG - Intergenic
990812047 5:59737900-59737922 TAATGCTGCCTTTGTAAAACCGG - Intronic
991066181 5:62427421-62427443 TCATGCAGACTGTCAAAAACTGG - Intronic
991541339 5:67732663-67732685 CAATGCTGCCTGTTTAAAAGAGG - Intergenic
992146315 5:73852971-73852993 ACATGTTGTCTTTCTAAAACAGG - Intronic
998578783 5:143347886-143347908 CCAGTCTGCCTTTCCAAAACGGG + Intronic
1002669978 5:180858855-180858877 TCATGCTGCGTGTTGAAAACTGG - Intronic
1006654595 6:35580092-35580114 CCTTGCTGCCTTTCTGAACCTGG - Exonic
1006873863 6:37278499-37278521 TCATGCTACATGTCTAAAATGGG + Intronic
1006934636 6:37708828-37708850 ACATGCTGCTTGTAGAAAACTGG + Intergenic
1007055125 6:38875399-38875421 CCATGCTGCCTGTCTAAAACAGG + Intronic
1008713258 6:54255683-54255705 CCATTCTTCCTTTCTAATACAGG - Intronic
1013969138 6:115994986-115995008 ACATCTTGCCTCTCTAAAACAGG + Intronic
1017083743 6:150694060-150694082 CCATGCTGCCTGTCTTTGAATGG - Intronic
1021738496 7:23662213-23662235 CCATGGTGACAGTCTAAAGCGGG + Intergenic
1022937812 7:35198713-35198735 CCATGCTGCCTTTTTCAAAGAGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1027960874 7:84943232-84943254 CCTTTTGGCCTGTCTAAAACTGG + Intergenic
1029307568 7:99631713-99631735 CCATGCTGCCTAACAAGAACAGG - Exonic
1035945934 8:3962478-3962500 GCATGCTGGCTGTCATAAACAGG - Intronic
1036711998 8:11085729-11085751 CCATGCTGACGGTCTGAAATTGG - Intronic
1038738354 8:30192935-30192957 ACATGCTGCCTGTTTGGAACTGG + Intergenic
1040391429 8:46953995-46954017 CCATGCTGAATGTCTAAGTCAGG - Intergenic
1044533607 8:93335786-93335808 GCATGTTGCCTGTCTAAAGCCGG - Intergenic
1047391170 8:124452463-124452485 CCATGCTGCTTCTCCCAAACAGG - Exonic
1049186663 8:141258590-141258612 CCATGCTGTCTTTGAAAAACGGG - Intronic
1052756091 9:32543277-32543299 CCATGGTGCCTGACTAACAGTGG + Exonic
1054813516 9:69453666-69453688 CCCTGCTACCTTTCTAAAATTGG - Intronic
1056975130 9:91245889-91245911 CCATCCTTCTTGTCTAAAGCTGG + Intronic
1058767371 9:108194908-108194930 CCATTCTCCCTGTCTTAACCTGG + Intergenic
1058929781 9:109707744-109707766 CCTTGCTGACTGTATCAAACAGG - Intronic
1059876791 9:118644197-118644219 CAATTCTGCCTGCCTAACACAGG + Intergenic
1060218076 9:121750413-121750435 CCATGCAGCATGTCTTAAAGGGG + Intronic
1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG + Intronic
1061603791 9:131692906-131692928 ACAGGCTGCTTGGCTAAAACAGG + Intronic
1188085100 X:25894202-25894224 TCATGCTGCTTGCCTAAGACAGG - Intergenic
1190430391 X:50372952-50372974 CCTTGCTGGCTGTCACAAACGGG + Intronic
1190638868 X:52463728-52463750 CCATCCTGCCTCTCAAACACTGG + Intergenic
1190680115 X:52819310-52819332 CCATCCTGCCTCTCAAACACTGG + Intergenic
1195636740 X:107125569-107125591 CAATGCTGGCTGTCTATAAAAGG + Intronic
1197221042 X:123914312-123914334 CCTTGCTGCCTGCCTCAAAGGGG - Intergenic