ID: 1007055273

View in Genome Browser
Species Human (GRCh38)
Location 6:38876924-38876946
Sequence TTGGCCTTTCTGGTTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007055273_1007055277 21 Left 1007055273 6:38876924-38876946 CCATCTTTAACCAGAAAGGCCAA 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1007055277 6:38876968-38876990 ATGCTGCTAAAGGTTTGAGATGG 0: 1
1: 0
2: 0
3: 16
4: 141
1007055273_1007055278 28 Left 1007055273 6:38876924-38876946 CCATCTTTAACCAGAAAGGCCAA 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1007055278 6:38876975-38876997 TAAAGGTTTGAGATGGCAAAAGG 0: 1
1: 0
2: 0
3: 32
4: 226
1007055273_1007055276 11 Left 1007055273 6:38876924-38876946 CCATCTTTAACCAGAAAGGCCAA 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1007055276 6:38876958-38876980 CATGTGTTAGATGCTGCTAAAGG No data
1007055273_1007055279 29 Left 1007055273 6:38876924-38876946 CCATCTTTAACCAGAAAGGCCAA 0: 1
1: 0
2: 2
3: 25
4: 223
Right 1007055279 6:38876976-38876998 AAAGGTTTGAGATGGCAAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007055273 Original CRISPR TTGGCCTTTCTGGTTAAAGA TGG (reversed) Intronic
905989890 1:42327349-42327371 TTGGCCTTTCTGAATGAGGATGG - Intronic
907505012 1:54911772-54911794 TTGGGTTTTCCTGTTAAAGAGGG - Intergenic
907758538 1:57334893-57334915 TTGTCCTTCCTGTTTAAATAAGG + Intronic
908135932 1:61132561-61132583 TTGGCATGGCTGGTGAAAGAAGG + Intronic
908181943 1:61614444-61614466 TTCCCCCTTCTGGTTAAATAAGG - Intergenic
909086113 1:71171967-71171989 TTGGACTTTTGGGTTAAAGCAGG - Intergenic
910119008 1:83763456-83763478 TTGGCTTTTGTTGTTGAAGACGG + Intergenic
911632249 1:100196393-100196415 TTCTCCTTTCTGGTTAAATCGGG + Exonic
915041755 1:152973663-152973685 TTGGCTTTCCTGGTTAATGTCGG - Intergenic
916670489 1:167014262-167014284 CTGGGGTTTCTGGTTCAAGATGG - Intronic
916790424 1:168120477-168120499 TTGGACTTTTTGGTTAATGCTGG + Intronic
916821621 1:168404293-168404315 GAGGCTTTTCTTGTTAAAGAGGG + Intergenic
919273832 1:195385819-195385841 TTGGACTTTTGGGTTAATGATGG + Intergenic
919277393 1:195439092-195439114 TTGGACTTTCAGGTTAATGCTGG - Intergenic
920594435 1:207254987-207255009 TTGGACTTTTGGGTTAATGATGG - Intergenic
922670932 1:227508305-227508327 CTGCCCTTTCTGGTTAAAGGGGG + Intergenic
922852026 1:228740851-228740873 TTGGCTTTTCTTGTTAGGGAGGG + Intronic
1063575896 10:7261784-7261806 CTGGCCTTTCTGGTTATAAATGG + Intronic
1063611090 10:7562721-7562743 TAAGCCTTTCTGGTGAAGGAAGG - Exonic
1063920993 10:10932814-10932836 TTGCCCTTTCTGGTTGCAGAAGG - Intergenic
1064353950 10:14601389-14601411 TTTTCCTTTCTAGTTCAAGAAGG - Intronic
1064628260 10:17283325-17283347 TTGGACTTTCGGGTTAATGCTGG + Intergenic
1065234393 10:23633794-23633816 TTGGCCATTGTGGATAAACATGG + Intergenic
1067573097 10:47385942-47385964 TTGGACTTTTGGGTTAATGATGG - Intergenic
1068793680 10:61054291-61054313 TTGTCATTTGTGGTTGAAGATGG - Intergenic
1070330475 10:75413130-75413152 GTGGTATTTCTTGTTAAAGAAGG - Intergenic
1072643205 10:97230013-97230035 TTGGCCTCTCTTGTATAAGATGG - Intronic
1072808310 10:98439668-98439690 TTGGACTTTTTGGTTAATGCTGG + Intronic
1075283605 10:121163106-121163128 CTGGCCTTTCTAGTTTAAGAGGG + Intergenic
1075368429 10:121913991-121914013 CTGAGATTTCTGGTTAAAGATGG + Intronic
1075946187 10:126435348-126435370 TAGGGCTTCCTGGTTAAGGAAGG + Intronic
1076574795 10:131457390-131457412 TTAGAGTTTCTAGTTAAAGATGG + Intergenic
1077716338 11:4584579-4584601 TTAGGCTTTCTTATTAAAGATGG + Intergenic
1079401931 11:20112794-20112816 TTGGCCCATCTGGTAAATGAGGG + Intronic
1079718989 11:23787086-23787108 TTGGACTTTTTGGTTAATGCTGG - Intergenic
1079804413 11:24911242-24911264 TTGGACTTTTGGGTTAAAGCTGG + Intronic
1081160681 11:39744174-39744196 TTGGACTTTTTAGTTAATGATGG + Intergenic
1081797047 11:45827778-45827800 TTGGACTTTCTGGTTAATCTGGG + Intergenic
1083146451 11:60763385-60763407 TTGCCCTTTCTGGGAAAAGAAGG + Intronic
1083274814 11:61590888-61590910 TTTGTCTTTCTGGTCAAACAAGG + Intergenic
1087660916 11:100986920-100986942 TTGGCTTCTCTTGTTAAGGATGG + Intronic
1088557641 11:111079203-111079225 TTGGTCATTCTAGTTAAGGAAGG + Intergenic
1089276057 11:117336709-117336731 TGGGCCTTTCTGCTTGAAGAGGG + Intronic
1095765075 12:45886037-45886059 TTGGACTTTTTGGTTAATGATGG - Intronic
1096332457 12:50726194-50726216 TTTGGCTTTCTGGATCAAGAAGG - Intronic
1097358052 12:58624274-58624296 TTGAGCATTCTGGTTAAACAAGG + Intronic
1098013136 12:66075787-66075809 TTGTCCATTTTGGTTAAAGTTGG + Intergenic
1098144861 12:67487974-67487996 TTGGACTTTTTGGTTAATGTTGG - Intergenic
1100686308 12:96990111-96990133 GTGGCCTTTCTGTGCAAAGAAGG - Intergenic
1101718880 12:107334198-107334220 TTGGCAGGTCTGGTTGAAGATGG + Intronic
1104546456 12:129717187-129717209 ATGGCCTTCCTGGATTAAGACGG - Intronic
1104672896 12:130692585-130692607 TTGGCATTCCTGGGGAAAGAGGG - Intronic
1104834202 12:131776842-131776864 GTGAGCTTTCTGGGTAAAGAGGG + Intronic
1105733834 13:23247175-23247197 GTGCCTTTTCTGTTTAAAGATGG - Intronic
1106574888 13:30965467-30965489 TTTGTCTTTCTGAATAAAGATGG + Intronic
1107359157 13:39601213-39601235 TTGCCCTATCTGGTGAAAGATGG - Exonic
1108309616 13:49174891-49174913 TTGGCCTTTCTATTTAAATTGGG - Intronic
1108930022 13:55806752-55806774 TTGGACTTTTGGGTTAAAGTTGG - Intergenic
1110410274 13:75197132-75197154 TTTGCCTTTCTTGTAAAACAAGG - Intergenic
1111060388 13:83011501-83011523 ATGTGCTTTCTGGTCAAAGATGG - Intergenic
1114008215 14:18335911-18335933 TTAGCTTTCCTGGTTAGAGAAGG + Intergenic
1114147347 14:19993274-19993296 TTGGCCTTTCTAGTTAATGCTGG - Intergenic
1114920066 14:27314906-27314928 TTTCCCTATCTAGTTAAAGAAGG + Intergenic
1115727496 14:36233129-36233151 TTGGCCTTTCTGGGTCAAGTTGG + Intergenic
1117814798 14:59586156-59586178 TTGACCTTTGTGGTTAAAGACGG - Intergenic
1117913462 14:60655293-60655315 CTGGCATCTCAGGTTAAAGAAGG - Intronic
1119028142 14:71169930-71169952 GCTGCCTCTCTGGTTAAAGATGG - Intergenic
1126004570 15:44243927-44243949 TTGGCCATTGTGTTTACAGATGG - Intergenic
1126831691 15:52613785-52613807 TTGGCCTTGCTGATAACAGAAGG - Exonic
1127477475 15:59348293-59348315 TTGGCGTTTTTGGTTAGGGAGGG - Intronic
1128587471 15:68862322-68862344 ATGCCCTTTCTGTGTAAAGAAGG + Intronic
1129795688 15:78374477-78374499 TTGGCCCTCGTGGGTAAAGATGG - Intergenic
1129836361 15:78709756-78709778 TTGGCCTTGTTGGTTTAAGCTGG - Intronic
1130777187 15:86996727-86996749 TTAGGCTTTCAGGTAAAAGATGG - Intronic
1130890300 15:88127828-88127850 CTGGCCTTGCTGGGTAAAGGTGG - Intronic
1131613621 15:93990302-93990324 TTGGTTGTTTTGGTTAAAGAAGG + Intergenic
1133427725 16:5707224-5707246 TTCCTCTTTCTGTTTAAAGAGGG - Intergenic
1135636011 16:24076314-24076336 TTGGCTTTTCTGGTTAAAAGAGG + Intronic
1135940378 16:26817097-26817119 TGGGCCTTTCAGGTTCAAGGAGG + Intergenic
1140156124 16:72428575-72428597 TTGTCCTTTCTTTTTGAAGAGGG + Intergenic
1140589661 16:76336796-76336818 TTTGCTTTTTTGCTTAAAGAAGG + Intronic
1141831874 16:86513729-86513751 TTTGACTTTCTGTTTAAAGACGG - Exonic
1141894343 16:86948997-86949019 TAGGCGTACCTGGTTAAAGAAGG - Intergenic
1147031728 17:37643417-37643439 TGGCGCTTTCTGGGTAAAGATGG - Exonic
1148337931 17:46853810-46853832 TTGGTTTTTATGGTTAGAGATGG + Intronic
1157077361 18:44480095-44480117 TTGGACTTTCTGGTTAATGCTGG + Intergenic
1157733405 18:50024482-50024504 ATGTCCTTTTTGGTTAAAAAGGG - Intronic
1157848820 18:51029234-51029256 AGGGGCTTTCTGGTCAAAGAGGG + Intronic
1158684766 18:59603425-59603447 TTGGCCTTTAAAGATAAAGATGG + Intronic
1159017147 18:63110561-63110583 CTGGCGCTTCTGGTTCAAGATGG + Intergenic
1161592945 19:5136888-5136910 TTGGCCTTTCTGGACATAGCAGG + Intronic
1163093324 19:15036336-15036358 CTGGCCTTTCAGGTTCTAGAAGG + Intergenic
1167067216 19:47195574-47195596 CTGGCCCTTCTGGCTAAAGCAGG + Intronic
926410422 2:12596844-12596866 TTTGTCTTTGTAGTTAAAGAAGG + Intergenic
926453369 2:13035030-13035052 TTGGCCTTTATGGCTAAAAAAGG + Intergenic
936162077 2:110091523-110091545 TTGGCCTTTCTGGGCAGGGAGGG - Intronic
936182585 2:110279831-110279853 TTGGCCTTTCTGGGCAGGGAGGG + Intergenic
936540790 2:113349302-113349324 TTGTCCTCTCTGGTTACAAAAGG - Intergenic
936977337 2:118232863-118232885 TTGGCCGCTCTGGTAAAAGGGGG - Intergenic
937070282 2:119057896-119057918 TTGTCCTTTCTGGAGCAAGAAGG - Intergenic
937391044 2:121486809-121486831 TTTGCCTCTCTAGCTAAAGAGGG - Intronic
937841246 2:126526724-126526746 CTGGCCACTCTGGTTTAAGATGG - Intergenic
939037495 2:137149874-137149896 TTGGACTTTCGGGTTAATGCTGG + Intronic
939558067 2:143701114-143701136 TAGGCCTTTGTGGTTTTAGAAGG + Intronic
940231810 2:151462419-151462441 TTTGGTTTTCTGGTTAAAGTAGG - Exonic
941023427 2:160434900-160434922 TTTGACTTCCTGGTCAAAGATGG + Intronic
941281084 2:163551616-163551638 TTGGTCTTTCTTGAAAAAGAGGG + Intergenic
942880624 2:180857107-180857129 TTGGACTTTTGGGTTAATGATGG - Intergenic
943023239 2:182599759-182599781 TTGGCTTGTCTGATAAAAGATGG - Intergenic
945555843 2:211274834-211274856 TTGTCCTTTCTGGTATAAGAGGG - Intergenic
946534031 2:220607335-220607357 TTGGACTTTCAGGTTAATGCTGG - Intergenic
946845602 2:223856310-223856332 TTTTCCTTTCTGATAAAAGAGGG - Intronic
947011408 2:225570819-225570841 TTGGCCTTTTGGGTTAATGCTGG - Intronic
947046750 2:225995844-225995866 TTGTTCTTTTTGTTTAAAGAAGG - Intergenic
947333560 2:229056014-229056036 TTGCCTTTTCTGGTTAATGAAGG - Intronic
947396794 2:229694810-229694832 TTGGACTTTTGGGTTAAAGCTGG + Intronic
947995479 2:234523773-234523795 TTTCCCTTTCTGTCTAAAGATGG + Intergenic
1169238773 20:3956223-3956245 TTGTACTTTCTGGTAATAGACGG - Intronic
1169554610 20:6736086-6736108 TCTGCTTCTCTGGTTAAAGACGG + Intergenic
1170030242 20:11936637-11936659 TTTTCCTTTCTGGTTAACAATGG + Intergenic
1170178036 20:13494841-13494863 TAGGACTTTCTGGTTAAAATTGG - Intronic
1171091447 20:22289158-22289180 TAGGCAGTTCTGGGTAAAGATGG - Intergenic
1174991986 20:55521607-55521629 TTGGCCTTTCTTGTTACATTGGG + Intergenic
1175349444 20:58308581-58308603 TTCGCATTTCTGGTGAAGGAAGG - Intergenic
1175769730 20:61616190-61616212 ACGGCCTTTCTGGTCAGAGACGG - Intronic
1178617131 21:34144318-34144340 TTGCCCTCTCAGGTTAAACAAGG + Intergenic
1178794157 21:35728138-35728160 TTGGCCTTGCTGTCTCAAGAGGG - Intronic
1180432720 22:15266728-15266750 TTAGCTTTCCTGGTTAGAGAAGG + Intergenic
1181727512 22:24821650-24821672 TTGGCCTGTCTGCTGAAAGTCGG + Intronic
1182252071 22:29008754-29008776 TTAGTCCTTCTGGTTAAAGCTGG - Intronic
949156166 3:829787-829809 TTGGACTTTTTGGTTAATGCTGG - Intergenic
949501809 3:4687211-4687233 TTGGGCTTTGTGGGTAGAGAGGG - Intronic
950830135 3:15865532-15865554 TTGTCCTTTCTCTTGAAAGATGG - Intergenic
951900154 3:27649345-27649367 TTGTCCTTTCTGGAGAAAAATGG + Intergenic
953266686 3:41396656-41396678 TTGGACTTTCTGGTTATTCAAGG - Intronic
955334899 3:58077229-58077251 TTGCCAGTTCTGGTTAAAGTTGG - Exonic
955337161 3:58096317-58096339 TTTTCCTTTCTGATTATAGAAGG + Intronic
957557421 3:81780183-81780205 TTGGACTTTTTGGTTAATGCTGG - Intergenic
957982381 3:87526193-87526215 TTGGACTTTTTGGTTAATGCTGG + Intergenic
959119101 3:102211772-102211794 TTGGACTTTTTGGTTAATGCTGG - Intronic
959228580 3:103618493-103618515 TTGGCCTTTTGGGTTAATGATGG - Intergenic
959437369 3:106333116-106333138 CTGGGCTTTCTGGGAAAAGAAGG + Intergenic
959497669 3:107070423-107070445 TTGCCCTTTCTTCTTAAATATGG + Intergenic
960235756 3:115280200-115280222 TTGGCCTTACTGATTAAACTTGG + Intergenic
963922452 3:150918906-150918928 TTCTCCTTTTTGGTTATAGAAGG + Intronic
964923521 3:161927093-161927115 TTGGCCTTTTGGGTTAATGCTGG + Intergenic
966519624 3:180858930-180858952 CTGGCCTTTCTGCTTAATGTAGG - Intronic
966549070 3:181183931-181183953 TTGACATTTCTGTTGAAAGATGG - Intergenic
966899195 3:184468099-184468121 GTGGCCTTTATGGTTACAGAGGG + Intronic
970040219 4:11788085-11788107 TTGGCATTTCTGCTTTAAGATGG + Intergenic
972626747 4:40806817-40806839 TTGGCATAGTTGGTTAAAGATGG + Intronic
972875708 4:43357087-43357109 GTTGACTTTCTGGTTATAGAAGG + Intergenic
973175864 4:47204066-47204088 TTGGCCTTGATGTTTAAAGGAGG + Intronic
973871412 4:55170251-55170273 TTGGCTTTTCTAGGTATAGATGG + Intergenic
974877678 4:67717926-67717948 TTGACATTTCCAGTTAAAGAAGG + Intergenic
975224782 4:71858948-71858970 TTGCCTTTTCTGGTGAAAAAGGG + Intergenic
975885959 4:78965021-78965043 TTAGGTTTTATGGTTAAAGATGG - Intergenic
976062251 4:81142068-81142090 GTGGCCTTACTGGGTACAGATGG - Intronic
976926857 4:90509558-90509580 TTACACTTTCAGGTTAAAGATGG - Intronic
977467100 4:97396424-97396446 GTGGTCTCTCTGATTAAAGAGGG + Intronic
979738716 4:124122493-124122515 TTTTCCTTTCTGCTTAGAGAAGG + Intergenic
981746251 4:148055237-148055259 ATGTCCTTTCTTGTTAAAGGAGG + Intronic
982104310 4:151998309-151998331 TGGGCCTTTCTGCTAAGAGAGGG - Intergenic
982413955 4:155110388-155110410 TTGGCCTTACTGTTTAAGGCTGG - Intergenic
982764601 4:159330708-159330730 TTGGCCTTTGTGTTTAAAGAAGG - Intronic
982817251 4:159901690-159901712 TTGGCATTTATGGTTGATGATGG - Intergenic
983366514 4:166797539-166797561 TTGGCCTTTCAAATGAAAGAAGG - Intronic
983803705 4:171967282-171967304 TTGGGCTTTGTGGTAAACGATGG + Intronic
986557761 5:9028083-9028105 TTGGACTTTCTGGTTAATGCTGG + Intergenic
986754425 5:10822487-10822509 TTGGCCTCTCTGGCTAAATTGGG + Intergenic
987197015 5:15536732-15536754 TTGGACTTTTGGGTTAATGATGG + Intronic
988162968 5:27544592-27544614 TTGGACTTTTGGGTTAATGATGG + Intergenic
989218207 5:38926806-38926828 TTGGACTTTTGGGTTAAAGCTGG - Intronic
989768007 5:45109255-45109277 TTGGCCCGTCTGGTAAGAGATGG + Intergenic
990484355 5:56243231-56243253 TTGGACTTTCGGGTTAATGATGG + Intergenic
990680466 5:58237592-58237614 TTTGCCTTTATGGTTTAAGATGG + Intergenic
991548058 5:67805624-67805646 TCTGCCTTTCTGATTAAAAACGG - Intergenic
994513030 5:100731979-100732001 TTGCACTTTCTGTTTAAACACGG - Intergenic
995334419 5:110983339-110983361 ATGGTCTTTTTGGTGAAAGAAGG - Intergenic
995656985 5:114437538-114437560 TTAACCTTTCAGATTAAAGATGG + Intronic
996911488 5:128661289-128661311 TTGGACTTTTGGGTTAAAGCTGG + Intronic
996954935 5:129171534-129171556 TTGGCTTTACAAGTTAAAGATGG + Intergenic
998759494 5:145416849-145416871 TTGGACTTTTGGGTTAAAGCTGG - Intergenic
999101326 5:149028299-149028321 TTGGCTTTTCTGGATCATGAGGG - Exonic
999373263 5:151069009-151069031 TGGGCCTTTCTGGTTCCAGCGGG - Intronic
1000572406 5:162931127-162931149 GTGGCATTTGTGGTTAAGGATGG - Intergenic
1001217695 5:169871241-169871263 TTGATTTTTCTGCTTAAAGAAGG + Intronic
1001428517 5:171641344-171641366 TTTGCCATTCTGGCTACAGAAGG - Intergenic
1004051720 6:12088080-12088102 TTGGCCTTTCTGGCAAGATAGGG + Intronic
1004337517 6:14777688-14777710 TTGCCTTTTCTCTTTAAAGACGG + Intergenic
1005567824 6:27114258-27114280 TTGACCTTTCTGGGTAAACCAGG - Intergenic
1005693227 6:28327545-28327567 TAGGCATATTTGGTTAAAGAGGG + Intronic
1007055273 6:38876924-38876946 TTGGCCTTTCTGGTTAAAGATGG - Intronic
1007440691 6:41857121-41857143 TTAGCCTTTGTAGTTGAAGATGG - Intronic
1008871068 6:56272475-56272497 TTGGACTTTCAGGTTAATGCTGG + Intronic
1009769053 6:68121427-68121449 TTGGACTTTTTGGTTAATGCTGG - Intergenic
1010162520 6:72874143-72874165 TTGTCCTTTCAGGTTTGAGAAGG - Intronic
1011016698 6:82764216-82764238 TTGGCTCTTTTGGTTAATGAAGG + Intergenic
1012449771 6:99342933-99342955 ATCTCCTTTCTGTTTAAAGATGG - Exonic
1012498723 6:99864596-99864618 TTAGACTTTCTAGTTTAAGATGG + Intergenic
1013246441 6:108291478-108291500 TTGACCTCTCTGGCTTAAGAGGG - Intergenic
1013563307 6:111328935-111328957 TTTGCATTTTTGGTTAGAGATGG + Intronic
1013771423 6:113632222-113632244 GTGGCCTTTCTGCTGACAGAGGG - Intergenic
1014190855 6:118495180-118495202 TTGGACTTTCGGGTTAATGCTGG + Intronic
1014822600 6:126008608-126008630 TTGGCCTTGATGTTTCAAGAGGG - Intronic
1015053151 6:128866414-128866436 TTAGTCTTTCTGATTGAAGATGG - Intergenic
1022149939 7:27591961-27591983 TTGGCATTTCTGGTTGTAAATGG - Intronic
1022261306 7:28707500-28707522 TTGGATTTCCTGGTTAAGGATGG + Intronic
1022842618 7:34179240-34179262 TTGTCTGTTCTGGCTAAAGATGG + Intergenic
1023188421 7:37554597-37554619 TTGGACTTTTTGGTTAATGCTGG - Intergenic
1023974765 7:45020070-45020092 TTGGCCTGACAGGTTAAAGGAGG - Intronic
1025820380 7:64957026-64957048 ATTTCCTTTCTGGTTAAAGAGGG + Intergenic
1026287512 7:68976209-68976231 TTGTCTTTTCAGGTTAAGGATGG - Intergenic
1027465787 7:78513385-78513407 CTGGCCTTTCTTTTTGAAGAGGG - Intronic
1028666701 7:93351946-93351968 TTAACCTTTATGCTTAAAGAAGG - Intronic
1030415584 7:109238866-109238888 TTGGACTTTTTGGTTAAGGCTGG + Intergenic
1031165796 7:118225314-118225336 TTTGCATTTTTGGTTAGAGACGG - Intronic
1031398929 7:121308223-121308245 ATGGAATTTCTGGTTAAAGGTGG + Intergenic
1032830084 7:135614406-135614428 TTGTAATTTCTGCTTAAAGAAGG + Intronic
1032920090 7:136535398-136535420 TTGGCCTTTCTTGCTAAATTGGG - Intergenic
1033262703 7:139857417-139857439 TTGGTTTTTCTGGTGAAAGGTGG + Intronic
1033714527 7:143985969-143985991 TTGGCCTTTCTCAGTAATGATGG + Intergenic
1033876595 7:145826971-145826993 TTGGCCATTCTGGTTAACTGAGG - Intergenic
1039255792 8:35717745-35717767 TTTGCAGTTCTTGTTAAAGATGG + Intronic
1041136653 8:54766202-54766224 TTTCCCTTTCTGGGAAAAGAGGG + Intergenic
1041578212 8:59424141-59424163 TTAGCCTGTCTGGTTAATGGAGG + Intergenic
1042621968 8:70716796-70716818 TTGGACTTTTAGGTTAAAGCTGG - Intronic
1044023915 8:87144205-87144227 TTGCCCTTTCTGGTTTTAGAAGG - Intronic
1046311149 8:112440042-112440064 TTGGCCTTTTGGGTTAATGCTGG - Intronic
1048635626 8:136292142-136292164 TTGGACTTTTTGGTTAATGCTGG - Intergenic
1051436105 9:17033913-17033935 TTGGCCTTTGTGGATCCAGAGGG + Intergenic
1057973217 9:99577018-99577040 TTTGCCTTTGGGGATAAAGATGG - Intergenic
1059479882 9:114581039-114581061 TTGGCCTTTGTTATTAAACAGGG - Intergenic
1059593816 9:115694087-115694109 TTACCTTTTCTAGTTAAAGAAGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1061640339 9:131949295-131949317 TTGGCCTTTCTGCTAGAGGAGGG + Intronic
1061650824 9:132048629-132048651 TTGGCCTTTCATGTTAAGCATGG - Intronic
1062253814 9:135611531-135611553 TGGGCGGTGCTGGTTAAAGATGG + Intergenic
1188106706 X:26155781-26155803 TTGGACTTTCAGGTTAATGCTGG - Intergenic
1188443914 X:30236983-30237005 TTGCATTTTGTGGTTAAAGAGGG + Exonic
1189757566 X:44286237-44286259 GTGCCTTTTCTGTTTAAAGATGG - Intronic
1190690468 X:52909317-52909339 TAGGCCTTTGTGTTTCAAGAAGG - Intergenic
1190695515 X:52946475-52946497 TAGGCCTTTGTGTTTCAAGAAGG + Intronic
1191044819 X:56124684-56124706 ATGGTCATTCTGGGTAAAGAAGG + Intergenic
1191680107 X:63831823-63831845 TTGGTCTTTTTGGTTAATGCTGG + Intergenic
1191689866 X:63928353-63928375 TTGGACTTTTAGGTTAATGATGG + Intergenic
1192478664 X:71466132-71466154 TTGGCATTTGTGGGTAGAGAAGG + Intronic
1193008227 X:76644588-76644610 TTGGACTTTTTGGTTAATGGTGG + Intergenic
1194911660 X:99652604-99652626 TTGGCCTATCTGTATAAAGACGG - Intergenic
1194920696 X:99760637-99760659 TTGGACTTTTGGGTTAATGATGG + Intergenic
1198448520 X:136742629-136742651 TTGCCCTTTATTGTTTAAGAAGG - Intronic