ID: 1007063981

View in Genome Browser
Species Human (GRCh38)
Location 6:38970481-38970503
Sequence AATGAGAGCCTGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 1, 2: 2, 3: 50, 4: 525}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007063981 Original CRISPR AATGAGAGCCTGAAGGAGGA TGG (reversed) Intronic
901000270 1:6145579-6145601 AATCAGAGGCTGCAGGAGGCTGG - Intronic
901004006 1:6162952-6162974 AGGGAGAGCCGGAAGGAGGGAGG + Intronic
902112739 1:14096533-14096555 AGTCAGAGCATGAAGGAGAATGG + Intergenic
902868765 1:19299489-19299511 TATGAAAGACTGAAGGAGGAGGG - Intergenic
903015297 1:20357814-20357836 AATGAGAGCCTGAAAGCTCAGGG - Intergenic
903331732 1:22600124-22600146 AAGGAGAGAAGGAAGGAGGAGGG + Intronic
903546874 1:24129925-24129947 AATGAGGGCCTGAACCAGGATGG - Intronic
903645422 1:24892888-24892910 AATGATACCATGATGGAGGATGG + Intergenic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904586228 1:31582404-31582426 AACCAGAACTTGAAGGAGGAGGG + Intronic
904612475 1:31733035-31733057 AAAGAGGGCCTGGAAGAGGACGG + Exonic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905448365 1:38042247-38042269 AATGAGAGGCTGAGGCAGGGTGG + Intergenic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
907428976 1:54399901-54399923 AGTCAGAGCCTGTGGGAGGAGGG - Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907768684 1:57437962-57437984 AATGAGGGCCAGAACAAGGAAGG - Intronic
908471531 1:64448787-64448809 AATGATACACTGAAGGAGGCAGG - Intergenic
908784953 1:67726029-67726051 AATGAGAGCATGAAGTGGAATGG + Intronic
909017342 1:70394119-70394141 CATTAGAGTCTTAAGGAGGAGGG + Intergenic
909772185 1:79437704-79437726 AGAGAGAGAGTGAAGGAGGAAGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911215312 1:95186640-95186662 AATGAATGGCTGAAGGAGAAGGG + Intronic
911248168 1:95542960-95542982 AATGAGTGCTTGAAGGAGGGAGG - Intergenic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
912046075 1:105459583-105459605 AAAGAGACCTTGCAGGAGGAAGG + Intergenic
912179087 1:107195991-107196013 AATGTAAGCCTCATGGAGGATGG + Intronic
912510802 1:110188967-110188989 ACCCAGAGCCTGGAGGAGGAAGG - Intronic
913556486 1:119972172-119972194 AATCAGAGAGTGAAGGAGGGAGG + Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915230805 1:154444076-154444098 AATGCGAGGATGAGGGAGGAGGG - Intronic
915297238 1:154929894-154929916 ATTGAGAGCCTGAGGGGAGAAGG - Intronic
915543983 1:156585488-156585510 CATGAGAGCAGGAAGGAAGAGGG - Intronic
916045718 1:160998685-160998707 AGGGAGGGCATGAAGGAGGATGG + Exonic
916143732 1:161722317-161722339 AATGGGAGCCTGAAGATGGCGGG + Intronic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
916759475 1:167803572-167803594 AATCACAGCCAGATGGAGGAGGG + Intergenic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
917844797 1:179011565-179011587 ACTCAGAGGCTGAAGTAGGAGGG + Intergenic
918386679 1:184015046-184015068 AACTAGAGACTGCAGGAGGATGG + Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918857937 1:189782614-189782636 AAGGAGAGCCTGAAGGCAGACGG - Intergenic
919340745 1:196303240-196303262 AATGTGAACATCAAGGAGGAAGG + Intronic
919459755 1:197862776-197862798 AAATAGAGATTGAAGGAGGATGG - Intergenic
919534772 1:198773898-198773920 TTTGAGAGGCTGAAGCAGGAGGG - Intergenic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920475145 1:206268554-206268576 AATGGGAGCATAATGGAGGAAGG + Intronic
921541657 1:216423562-216423584 CATGAGAGCAAGAAAGAGGAGGG - Intergenic
921627522 1:217394093-217394115 AAAGAGAGCCTGAATAAAGAGGG - Intergenic
923109402 1:230879276-230879298 AATGAGAGGTGGATGGAGGAGGG + Intergenic
923256270 1:232224082-232224104 AGTGAGGACCTGAAGGAGGGAGG - Intergenic
923402970 1:233633122-233633144 AATGAGAGCCTGGAGAAACATGG + Intronic
924107118 1:240659951-240659973 AGTGAGAGTCTAGAGGAGGAAGG - Intergenic
924144394 1:241059060-241059082 AATGAGCGCTTTAAGGAAGAGGG - Intronic
924208917 1:241744600-241744622 AAGGAGAGCATGAAGCAGGCTGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063147878 10:3312892-3312914 AATCAGAGCTTGCAGAAGGAAGG - Intergenic
1065508410 10:26453499-26453521 AATGAGTGGATGGAGGAGGAAGG - Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069997209 10:72349780-72349802 AAAGAGAGCCCAAAGGAGAATGG + Intronic
1070290784 10:75111910-75111932 ACTGAGGGCCTGAAGGCTGAGGG + Intronic
1070522270 10:77264383-77264405 AGTGTGAGGCTGAAGGAGGAAGG - Intronic
1070606160 10:77899823-77899845 AAAGAGACCATGAAAGAGGAAGG + Intronic
1070613759 10:77952977-77952999 CATGGGAGGCTGAAGCAGGAGGG + Intergenic
1071393590 10:85199652-85199674 AGTGAGAGAGGGAAGGAGGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072231469 10:93417554-93417576 TATGGGAGCCTGGAGGAAGAAGG - Intronic
1073135110 10:101216011-101216033 AATCAGAGACTGAAGGAGGCGGG + Intergenic
1073190561 10:101647782-101647804 AATGAAAGCCTGAAGTAAGATGG - Intronic
1073447222 10:103588970-103588992 AGTGAGTGACGGAAGGAGGAAGG + Intronic
1074536729 10:114333287-114333309 CATCAGAGCCTGCAGAAGGAAGG + Exonic
1074547939 10:114416226-114416248 AATGAGGGAATGAAGGAGCAAGG + Intergenic
1074946774 10:118287616-118287638 AATGATAGCCTAAGGGAGAAAGG + Intergenic
1075806048 10:125189555-125189577 AATGAATGAGTGAAGGAGGAAGG - Intergenic
1076285349 10:129290204-129290226 AATGAGGACCCTAAGGAGGATGG + Intergenic
1076381917 10:130029241-130029263 GATGAGATCCTGCTGGAGGAGGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1077933522 11:6758574-6758596 ACTGAGAGCCTTTAGAAGGAAGG - Intergenic
1078420314 11:11206445-11206467 AATAAAAGCCTGAGGAAGGAAGG - Intergenic
1079083580 11:17430197-17430219 AATGAAAGCCTGAAGGTAGAAGG - Intronic
1079508850 11:21186220-21186242 ACTGAGACCCTGTAGTAGGAGGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080764213 11:35280727-35280749 AATGTGAGCGGGAAGGAGGAAGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081420689 11:42872876-42872898 AATAAGAGGCTGAAAGAGGTTGG - Intergenic
1081520210 11:43874109-43874131 GAAGAGACCCTGAAGGGGGAAGG - Intergenic
1081576983 11:44324965-44324987 AATGAAAGCCCGATGGAGGCTGG + Intergenic
1083193425 11:61068730-61068752 AATGAGGGCAGGAAGCAGGAAGG - Intergenic
1083464587 11:62836730-62836752 ACTGGGAGCCTGTAGGAGTATGG - Intronic
1084164733 11:67370312-67370334 AACATGAGCCTGAGGGAGGATGG - Intronic
1086325980 11:85699882-85699904 AATGAGACCCTGAGAGTGGAGGG + Intronic
1086342094 11:85857269-85857291 AATGAGGGTCTCAATGAGGATGG - Intronic
1086555330 11:88103817-88103839 AGTGAGATCCTGCAGGAGGGAGG + Intergenic
1086888697 11:92230812-92230834 AACAGGAGCCTCAAGGAGGAGGG + Intergenic
1087700942 11:101435711-101435733 AATGAGAGGATGAAGGAGGCAGG - Intergenic
1088202735 11:107357680-107357702 AATTTGAGGCTGCAGGAGGAGGG - Intronic
1088834207 11:113563960-113563982 AATGATAGCCTGAGGGAAGAAGG + Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089878506 11:121749930-121749952 AATGAGAGAATGAAGGAGGATGG + Intergenic
1091189087 11:133674938-133674960 AATGGAAGCCTCAAGAAGGAAGG - Intergenic
1091387235 12:103178-103200 ACTGAGAGCCTGAAAGGGAAGGG - Intronic
1092252192 12:6905759-6905781 AGTGAGAGCCTGGACAAGGAGGG + Exonic
1092518230 12:9238327-9238349 ATTGAGAGCCTGCAAGAGAAAGG + Intergenic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1093734592 12:22606239-22606261 AAGGAGAGAAGGAAGGAGGAAGG - Intergenic
1093781198 12:23139544-23139566 AATGAGAGCATGAAAGTGCAGGG - Intergenic
1094073129 12:26441545-26441567 AATGAAAGCCTGGAGAAGGGAGG + Intronic
1094222442 12:28008883-28008905 AATGTGATCCTGGAGGAAGAAGG + Intergenic
1094345488 12:29463816-29463838 TCTGTGAGCTTGAAGGAGGAGGG - Intronic
1094387274 12:29908926-29908948 AATGAGAGACAGAAAGAGAAAGG - Intergenic
1094465418 12:30749072-30749094 AATAAAAGGCTGAAGGAGGTTGG + Intronic
1095405892 12:41866818-41866840 ACTGTGAGCCTGGAGGAGGCTGG - Intergenic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096159023 12:49361086-49361108 AATTAGAGCCTGAAGGGAGATGG - Intergenic
1096838804 12:54369024-54369046 AAAGGGAGCGAGAAGGAGGAGGG - Intergenic
1097599579 12:61673999-61674021 AATGGAGGGCTGAAGGAGGAAGG + Intergenic
1097611348 12:61825202-61825224 AATGAGGGCCTGAACTAGGCTGG + Intronic
1098709942 12:73744202-73744224 ACTGAGAGTGTGAAGGAGCAAGG + Intergenic
1098817111 12:75181548-75181570 AATGAGAGGCTGTTGGAGGAAGG - Intronic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1101621725 12:106395401-106395423 CAAGAGAGCGTGAGGGAGGAGGG + Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102604889 12:114060820-114060842 AATGAGAGCCTCTAAGAGGTGGG - Intergenic
1103716424 12:122947874-122947896 AATAAGGGTCTGAAGGAGGCGGG - Intronic
1103832603 12:123791916-123791938 AATGACAGCAAGAATGAGGAAGG - Intronic
1103899388 12:124295460-124295482 GAGGACAGCCTGAAGGAGCAGGG + Intronic
1105661741 13:22503475-22503497 AATGAGTGTCTGAAGTTGGAGGG + Intergenic
1105914113 13:24896274-24896296 AATGAGTTCCTGAAGAGGGACGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1108185043 13:47880377-47880399 AAAGAGAGAGGGAAGGAGGATGG + Intergenic
1108595139 13:51943024-51943046 TATCAGACCCTGGAGGAGGAGGG + Intronic
1108967155 13:56322847-56322869 AATTAGAGCTTGAAAGTGGAGGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1111337045 13:86838563-86838585 AAGGAGTGCGTGAATGAGGATGG + Intergenic
1111465541 13:88603938-88603960 AATGAGGGCATGGAGCAGGAAGG + Intergenic
1112155445 13:96811967-96811989 AATCAGAGCCTGAGGGATGCCGG + Intronic
1112336593 13:98522000-98522022 AAGGAGAGAGTGGAGGAGGAGGG - Intronic
1112378849 13:98869502-98869524 ACTGAGAGCCTGAAGTAGGAAGG + Intronic
1112404571 13:99107762-99107784 AGTGAGAGTCTGAAGAAGGAAGG + Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113593299 13:111515301-111515323 TGTGAGAGTCTGAGGGAGGAGGG + Intergenic
1113593308 13:111515330-111515352 CATGAGGGTCTGAGGGAGGAGGG + Intergenic
1113593316 13:111515359-111515381 TGTGAGAGTCTGAGGGAGGAGGG + Intergenic
1113593323 13:111515388-111515410 TATGAGAGTCTGAGGGAGGAGGG + Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1113931979 13:113973529-113973551 AGGGACAGCCTGAAGCAGGAGGG - Intergenic
1114264034 14:21060742-21060764 ACTGAGAGGCTGCAGGAGAAGGG - Intronic
1114656568 14:24319283-24319305 AATGAGAGCCCAGAGGAGGATGG + Intronic
1116067426 14:40001820-40001842 AATTAGACCTTGAAGGAAGAGGG + Intergenic
1116727275 14:48576221-48576243 ACTGTGAGCCTGAAGCAGGTGGG - Intergenic
1117162790 14:53005700-53005722 TAAGTGAGCCTTAAGGAGGATGG - Intergenic
1117902829 14:60552872-60552894 GATGGGACTCTGAAGGAGGATGG + Intergenic
1118045033 14:61960170-61960192 AAAAAGAGCCTGAATGAAGAAGG - Intergenic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118971016 14:70637989-70638011 AAGGCGAGCATGAACGAGGAAGG - Intergenic
1119451000 14:74710785-74710807 AATGTGTGCCTGAAAGAGAAAGG + Intronic
1120055709 14:79921540-79921562 ACTGAGTGGGTGAAGGAGGAAGG + Intergenic
1120967959 14:90184293-90184315 CAGGAGAGCCTGAAGGATGCGGG + Exonic
1121843229 14:97151816-97151838 AATTGGGGCCTGAAGGAGAAAGG - Intergenic
1121847462 14:97185755-97185777 AAAAAGAACCTGAAGGAAGATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1123817997 15:23999079-23999101 ACTGAGAGCCTCAAGGGGGAGGG + Intergenic
1124213805 15:27789003-27789025 AATAATAGCATAAAGGAGGAGGG - Intronic
1124716554 15:32068293-32068315 AGTGAGACCCTGAGGAAGGAAGG + Intronic
1124913081 15:33942291-33942313 AATGGGAGCTTGAAGGGAGATGG - Intronic
1125306521 15:38322680-38322702 AATAAGAGCTTGAAGGAAGAGGG + Intronic
1125352328 15:38780941-38780963 AATCAGAAGCTGAAGGAGAAGGG - Intergenic
1125596961 15:40893569-40893591 ACTGAGAGCGTGAAGGAGCAGGG - Intergenic
1127534627 15:59878715-59878737 ATTTAGAGCTTAAAGGAGGATGG + Intergenic
1128235224 15:66062459-66062481 ACTGACAGCCTGCAGGAGGATGG + Intronic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1128938296 15:71766951-71766973 AATCAGTGCCTGCTGGAGGATGG + Intronic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1129652572 15:77501732-77501754 AGAGAAAGACTGAAGGAGGAAGG - Intergenic
1130725267 15:86432713-86432735 GATAAAAGCCTGAAGGAGGTAGG + Intronic
1130967083 15:88705510-88705532 AATGAGAGCCCGAGGGAGCCCGG - Intergenic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131338386 15:91572241-91572263 AATAAGAGGCTGGAGGAGGCAGG + Intergenic
1131675787 15:94668807-94668829 AAGAAGAGCCTTGAGGAGGATGG - Intergenic
1132012725 15:98290277-98290299 GATGAGAGACTGATGGAGAATGG + Intergenic
1132649963 16:1016163-1016185 AATAAGACCCTGAAGCAGGCAGG + Intergenic
1133237550 16:4394548-4394570 ATAGATGGCCTGAAGGAGGACGG - Intronic
1133619715 16:7514588-7514610 AAGGAAAGCCTGCTGGAGGAGGG + Intronic
1133728994 16:8562747-8562769 AATGAGTGAGTGAAGGAGGGAGG + Intergenic
1133729039 16:8563488-8563510 AATGAGTGACTGAGGGAGGGAGG + Intergenic
1133729044 16:8563552-8563574 AATGAGTGACTGAGGGAGGGAGG + Intergenic
1134252599 16:12584979-12585001 CATGAGAGACTGAAGGAGCAGGG - Intergenic
1134629080 16:15744026-15744048 TTTGGGAGCCTGAAGCAGGAGGG + Intronic
1134819920 16:17238714-17238736 ACTAAGAGCCAGAAGGCGGAAGG - Intronic
1136054565 16:27678787-27678809 AAGGTGAACCTGAAGGAGGGAGG + Intronic
1136315852 16:29454461-29454483 AATCAGAGCCTGAGGAAGGTGGG + Exonic
1136430429 16:30193803-30193825 AATCAGAGCCTGAGGAAGGTGGG + Exonic
1136654759 16:31703207-31703229 AGAAGGAGCCTGAAGGAGGAAGG + Intergenic
1136857946 16:33676351-33676373 AATGAAAGACTGGTGGAGGATGG + Intergenic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137806174 16:51307601-51307623 AATCAGAGACTGAAAGATGAAGG - Intergenic
1138086211 16:54135903-54135925 AATGAAAGCCTGCTGGAGAATGG - Intergenic
1138222946 16:55268580-55268602 AGGGTGATCCTGAAGGAGGAAGG - Intergenic
1138524117 16:57592044-57592066 GATGAGTGGATGAAGGAGGAAGG - Intergenic
1138526211 16:57608847-57608869 AATGAGAGCAGGAAGGGGGCAGG - Intergenic
1139228030 16:65252155-65252177 AATGAGAGCCTGCAGGAATGTGG - Intergenic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139649486 16:68355234-68355256 AATGGGAGCCGGCAGGAGAAGGG - Intronic
1140137700 16:72222391-72222413 AATAAGAGATAGAAGGAGGAAGG - Intergenic
1140487092 16:75302081-75302103 AAGCAGAGCATAAAGGAGGATGG + Intronic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1142325691 16:89413052-89413074 AACCAGAGCCTGGAGGGGGAGGG + Intronic
1142800694 17:2343624-2343646 AGTGAGTGACTGAAGGATGATGG + Intronic
1142943089 17:3399513-3399535 CATGAGAGAGTGGAGGAGGATGG - Intergenic
1143050513 17:4121696-4121718 AAAGACAACCTGAAGGAGAATGG + Intronic
1143505956 17:7365429-7365451 ACTGTGAGCCTGAAGGAACATGG + Intergenic
1143779495 17:9221887-9221909 TCTGGGAGCCTGCAGGAGGAGGG + Intronic
1144060937 17:11583096-11583118 AAGGAGGGCCTGAAGGCTGAGGG - Intergenic
1144403450 17:14929295-14929317 AAGGAGACCCTGAAGGGAGAGGG + Intergenic
1147323407 17:39659142-39659164 AATGGGTGCCTGGAGGAGGGCGG + Intronic
1147592881 17:41696330-41696352 AATGAGAGGCTTGAGCAGGAGGG - Intergenic
1147946815 17:44084989-44085011 GTTGAGAGCCAGAAGAAGGAGGG + Intronic
1148127189 17:45242932-45242954 ACAGGGAGCCTGGAGGAGGAGGG - Intronic
1148136578 17:45296415-45296437 CTTGGGAGCCTGAAGCAGGAGGG + Intronic
1148335448 17:46837901-46837923 AAAAAGTGCCTGGAGGAGGAGGG + Intronic
1149654353 17:58302452-58302474 AATGTGAGACAGAAGGAGCAAGG + Intronic
1149783557 17:59417166-59417188 AAAGAGTGACTGGAGGAGGAAGG - Intergenic
1150494301 17:65595397-65595419 AATGAGAGCCTGAGTGATGATGG + Intronic
1150630529 17:66877332-66877354 GATGAGTGCCTGCGGGAGGAAGG + Exonic
1153497781 18:5717539-5717561 AATTAGAGCATGAAGGATGGGGG + Intergenic
1153578792 18:6550371-6550393 AATGCAAGCCTGAAGGAGGCTGG - Intronic
1153823674 18:8855399-8855421 AATGAGAGCCTGGAGTAAGATGG + Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1155973980 18:32108338-32108360 AATGGTATCCTGAAGGAGGTGGG - Intronic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158012041 18:52740091-52740113 AATGTGAACCTCAAGGATGAAGG - Intronic
1158390206 18:57038861-57038883 AATGGGAGCACAAAGGAGGAGGG + Intergenic
1158631581 18:59119776-59119798 AATGGGAGCTTGACAGAGGAAGG + Intergenic
1159256413 18:65953226-65953248 AATGAGAGGCTCAAGAAGAATGG - Intergenic
1159341536 18:67140531-67140553 AATGAGGGAAGGAAGGAGGAAGG - Intergenic
1160016107 18:75141853-75141875 CAGGAGAGCCTGCAGCAGGAAGG - Intergenic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160341028 18:78088846-78088868 AATGAGAGCCTCCAGGAGGCAGG + Intergenic
1160378411 18:78430849-78430871 AGTGAGAGGCGGAGGGAGGAAGG - Intergenic
1161146789 19:2683725-2683747 AGAGAGACCCTGGAGGAGGAGGG + Intronic
1163216973 19:15886123-15886145 ATTGAGGGCCTCAGGGAGGATGG + Intronic
1163806843 19:19404989-19405011 AATGAAAGCCTGAAAGAGAATGG - Intronic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1165931639 19:39362924-39362946 AAGCAGAGCCTGAAAGTGGAGGG - Intronic
1167972215 19:53195215-53195237 TTTGAGAGCCTGAGGCAGGAGGG + Intergenic
1168472300 19:56649592-56649614 AGTGAGGACCTGAAGGAGGTGGG + Intronic
925260556 2:2524889-2524911 AATGAGACCCAGCAGGAGCAGGG - Intergenic
925415964 2:3670426-3670448 AAAGAGACCGTGAGGGAGGAAGG - Intronic
925591748 2:5516811-5516833 AATGGGAGTCTGAAGTGGGAGGG + Intergenic
925921433 2:8640699-8640721 ACTGAGAGCCTGCTGAAGGATGG - Intergenic
926169460 2:10542950-10542972 ACAGAGAGCCAGAAGGAAGAAGG - Intergenic
926204980 2:10829387-10829409 AATGAGAGTCTGGAGAAGCAGGG - Intronic
926692488 2:15747260-15747282 CACGAGAGCCTGAGGGAAGAGGG + Intergenic
926775956 2:16423536-16423558 ACTGAGAGCCTCATGGAGAAAGG - Intergenic
927475435 2:23410958-23410980 AATGAGGGGCTGGGGGAGGAAGG - Intronic
928406492 2:31018965-31018987 AATGACAGCGTGAAGGGGGCCGG + Intronic
928873618 2:36011316-36011338 AATGAGAGGCTGAGGAGGGATGG - Intergenic
929746840 2:44667864-44667886 AATGAGAACCTGAGGCAGGCAGG - Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
931819277 2:65935241-65935263 AAGGAGAGCCAGAAGGACAAAGG + Intergenic
931939285 2:67234360-67234382 ACTGAGACCTTGAAGGAGGCAGG - Intergenic
932509511 2:72271506-72271528 AGAGAGGGACTGAAGGAGGAAGG + Intronic
933141126 2:78793856-78793878 AGTGAGAGGCTGAAGCTGGATGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
934466791 2:94270585-94270607 CATGACAGCCCGAAGGAGGGGGG + Intergenic
934578671 2:95420405-95420427 AATGGGAGACTGGAGGAAGATGG - Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935217844 2:100988775-100988797 AATGGGGGCCTGGAGGAGCAGGG - Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935437097 2:103046539-103046561 AATGAGACCATGAAGGTGGGAGG - Intergenic
935438989 2:103069378-103069400 GATGAGAGAGGGAAGGAGGAAGG - Intergenic
936509117 2:113131350-113131372 AAAGAGAGCCTGGAGGATGAGGG - Intronic
936534146 2:113298442-113298464 AATGGGAGACTGGAGGAAGATGG + Intergenic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937970463 2:127545391-127545413 GATGGGAGCCTGAGGAAGGAGGG - Intronic
938669558 2:133573962-133573984 AACCAGAGCCTGGAGGAGGCAGG + Intergenic
939387721 2:141522397-141522419 AAGGAGAGCCTGAATGTGGCAGG + Intronic
939738487 2:145879248-145879270 AATGAAAGCCAAAGGGAGGATGG + Intergenic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
940599125 2:155835213-155835235 AAGGAGAGATTGAAGGAAGAAGG + Intergenic
941198289 2:162477395-162477417 AAAGAGAGCCCAAAGGAAGAAGG - Intronic
941404528 2:165071891-165071913 TGTGAGAGGCTGAAGCAGGAGGG - Intergenic
941695809 2:168550132-168550154 AGAGAGAGACTGAGGGAGGAAGG - Intronic
944648365 2:201803449-201803471 AAACAGAGCCTGAAGGAAAAGGG + Intronic
945071863 2:205998702-205998724 GATGAGAGCCTGGAGGAGAAAGG + Exonic
945996717 2:216443257-216443279 TATGGGAGACTGAGGGAGGAGGG + Intronic
946098637 2:217299385-217299407 AATGAGAGGCTGGAGAATGAAGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
948012568 2:234661712-234661734 ACAGAGACCCTGAAGCAGGAAGG + Intergenic
948490615 2:238310315-238310337 TGTGGGTGCCTGAAGGAGGAAGG - Intergenic
948572421 2:238926050-238926072 GAAGAAAGTCTGAAGGAGGAAGG + Intergenic
948883083 2:240870233-240870255 GATGACAGACTGAAGGATGAGGG - Intronic
949061021 2:241957375-241957397 GGTGAGAGCCGGAAGGTGGAGGG + Intergenic
949061033 2:241957443-241957465 GGTGAGAGCCAGAAGGTGGAGGG + Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1171152717 20:22842078-22842100 GATGAGAGCCAGAAGCAGAAGGG - Intergenic
1171209150 20:23303613-23303635 AAGGAGAGGGTGAAGGATGAGGG - Intergenic
1173418045 20:42876049-42876071 AGGGAGAGAGTGAAGGAGGATGG - Intronic
1174445511 20:50588198-50588220 AAGGAGAGCGTGAGGGAGGCAGG - Intronic
1174590362 20:51640213-51640235 AAGGAGAGCCTGAAGGCGAAGGG - Intronic
1175783077 20:61695992-61696014 AACCAGGGCCTGGAGGAGGAGGG - Intronic
1177522746 21:22250575-22250597 AAAGAGAGCCTGAATCAGAAAGG + Intergenic
1177874859 21:26619601-26619623 AATGAGAGTGTCAAGGAGGAGGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178277441 21:31251939-31251961 AGCGAGAGCCTGGAGGAGGCCGG - Exonic
1178292773 21:31383587-31383609 AATGACAGCCTGAAAGAGATAGG - Intronic
1178553959 21:33569727-33569749 ACTGGAAGCCTGAGGGAGGATGG + Intronic
1178910766 21:36671564-36671586 AAGCTGAGCCTGAAAGAGGATGG + Intergenic
1178970128 21:37167049-37167071 ACTTAGCGCATGAAGGAGGAAGG + Intronic
1179262055 21:39766019-39766041 AGGGAGAGCATGAGGGAGGAAGG - Intronic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1179379947 21:40889278-40889300 AATGAGACACTGGAGGAGAAGGG - Intergenic
1179582510 21:42352355-42352377 AATGAGGGTCTGGAGGACGAGGG - Intergenic
1180170872 21:46057475-46057497 ACTGACAGCCTGAAGAAGGGTGG - Intergenic
1180179703 21:46112440-46112462 AACCAGAACCTGAAGGAGCAGGG + Exonic
1180904211 22:19397131-19397153 AATGACAGCATCAAGGAGGCAGG + Intronic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181094534 22:20496282-20496304 AATGAGAGAGTGAAGGAGGGAGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1182033028 22:27174998-27175020 AATGAGAGCATGAGGGAGTAGGG + Intergenic
1183639900 22:39086573-39086595 AATGGAAGCCTGGAGTAGGATGG + Intronic
1183806873 22:40219308-40219330 AAGGAGAGCTTGGAGTAGGAAGG + Intronic
1184056673 22:42056304-42056326 AATAACAGCATAAAGGAGGAGGG - Intronic
1184067427 22:42128630-42128652 AAGAAGGGCCTGGAGGAGGAGGG - Intronic
1184070157 22:42142325-42142347 AAGAAGGGCCTGGAGGAGGAGGG - Intergenic
1184783455 22:46660329-46660351 TCTGGAAGCCTGAAGGAGGAGGG + Intronic
949571016 3:5293286-5293308 GATTGGAGCCTGAGGGAGGATGG + Intergenic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
950230628 3:11272572-11272594 AGTGAGTCCCTGGAGGAGGAAGG - Intronic
950332022 3:12163534-12163556 ACTCAGAGTCTGGAGGAGGAGGG - Intronic
950489656 3:13296066-13296088 AATGGTAGCCTGAGGTAGGAAGG + Intergenic
950580974 3:13861807-13861829 AATGATAGCTTCAAGGAGAATGG + Intronic
950835757 3:15917723-15917745 AGAGAGAGCTTGAAGGAGCAGGG + Intergenic
950891425 3:16408152-16408174 CATGAGGGCCTGAGGCAGGAGGG - Intronic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
951959221 3:28296951-28296973 AATAAGAGTTTGAAGGTGGAAGG - Intronic
952029299 3:29121291-29121313 AATGAGAGAGAGAAGGAGGGAGG + Intergenic
952153071 3:30613432-30613454 AATGACAGCCTTCAGGAAGATGG - Intronic
952960022 3:38583287-38583309 AATTAGAGGCTGCTGGAGGAGGG - Intronic
953192608 3:40701658-40701680 AATGAGCTCCTGAACAAGGAAGG + Intergenic
953597779 3:44334580-44334602 AATGAGAGCATTAAAGAGGCAGG + Intergenic
954171298 3:48804725-48804747 AATGAGTGGCTGAAGTAGGGTGG + Intronic
954674880 3:52310340-52310362 AATGAGAGACTTGAGGAGCAGGG - Intergenic
955289680 3:57679717-57679739 AAGGTGAGCCTGAAGAAGTAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
957597307 3:82283967-82283989 CAAGAGAGCCTGTTGGAGGATGG - Intergenic
959258130 3:104040720-104040742 AATGAGAAATTGAAGGAGTAAGG - Intergenic
959623976 3:108428757-108428779 AATGAGAGGCTGGAGGAGGTAGG - Exonic
961084955 3:124059031-124059053 AATGAGAGTCTCAGGAAGGAAGG - Intergenic
961312043 3:126008640-126008662 AGTGAGAGGCTGAGGGAGGCGGG - Intronic
961913169 3:130342512-130342534 AATGTGACCCTGAAGGTTGATGG - Intergenic
962844204 3:139260832-139260854 GCTGTGAGCATGAAGGAGGAAGG - Intronic
962916221 3:139906219-139906241 AATGAGAGCAAGAAAGTGGAAGG - Intergenic
963838278 3:150079092-150079114 CCTGTGAGCCGGAAGGAGGAAGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
966272660 3:178126357-178126379 AAAGAGAGAGTGAGGGAGGAAGG + Intergenic
967032117 3:185617624-185617646 AATGATAGCCAAAAGGGGGAGGG - Intronic
967056271 3:185831510-185831532 TTTGGGAGCCTGAAGCAGGAGGG + Intergenic
967494484 3:190127644-190127666 AGTTAGAGCCAGAAGGAGTAAGG - Intergenic
967598410 3:191355583-191355605 ACTGAAAGCCAGAAGGAAGAAGG - Intronic
968471190 4:783162-783184 AATGGGAGGCTGGGGGAGGATGG + Intergenic
969220452 4:5755417-5755439 AACGAGCGAATGAAGGAGGATGG + Intronic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
970000771 4:11363962-11363984 GATGTGATCCTGATGGAGGAGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971298016 4:25417230-25417252 TATGAGAGGCTGAGGCAGGAGGG - Intronic
972090734 4:35279192-35279214 AAAGAGAGTTTCAAGGAGGATGG - Intergenic
972279606 4:37589591-37589613 GAAGAGAGCCAAAAGGAGGAAGG - Intronic
973134492 4:46689493-46689515 GATGCGAGCCAGAAGGGGGATGG - Intergenic
974070838 4:57122034-57122056 TATGAGAACCTGGAGGAGGTTGG - Intergenic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977672648 4:99714205-99714227 GAAGAGAACCTGAAGGAGGCAGG + Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
978541134 4:109817171-109817193 CTTGAGAGCCTGAATCAGGATGG + Intronic
978854452 4:113378144-113378166 AATGAAATCCTGAAAGAGGATGG + Intronic
978913855 4:114099406-114099428 ATTGAGAGCCTGGAAGAGGGAGG - Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980615117 4:135210202-135210224 AATGAGATCATAAAGGAGGGTGG - Intergenic
980670256 4:135995502-135995524 AATGAGAGAGAGATGGAGGAGGG - Intergenic
980678817 4:136127352-136127374 AATGGGAGCATAAAGGAGAATGG - Intergenic
981887401 4:149693177-149693199 AATGAGCCCATGAAGGAGAAAGG - Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982399949 4:154954943-154954965 AATTAAAGACTGGAGGAGGATGG + Intergenic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
983739691 4:171113869-171113891 AAGGAAGGCATGAAGGAGGAAGG + Intergenic
983830654 4:172322630-172322652 AGAGAGAGCGTGAAGGTGGAGGG + Intronic
984321052 4:178197081-178197103 AGTGAGAGACTGATGAAGGAAGG - Intergenic
984866106 4:184282063-184282085 ACTGAGAGGTTGCAGGAGGAAGG + Intergenic
985660238 5:1153368-1153390 ATTCACAGCCTGAAGCAGGAAGG + Intergenic
986837006 5:11650214-11650236 GAAGAGAGAGTGAAGGAGGAGGG - Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987247219 5:16060951-16060973 ACTGAGAACCTGAAGTAGCAGGG - Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
989678921 5:44006563-44006585 AATATGAGCTTGAAGGAGAAGGG + Intergenic
990351811 5:54925266-54925288 AATAACAGCATAAAGGAGGAGGG - Intergenic
990361940 5:55029649-55029671 TTTGAGAGGCTGAAGCAGGAGGG - Intronic
990366099 5:55071357-55071379 AATGAGTGGCTGAGGGAGGTTGG + Intergenic
990556561 5:56942352-56942374 AATGAGAGCCTGAACTAAGGAGG + Intronic
990623145 5:57581979-57582001 AATGAGAGGCTGAGGGATGCTGG + Intergenic
990869225 5:60413446-60413468 GATGAGAGGAGGAAGGAGGAAGG + Intronic
990985016 5:61633167-61633189 AATGACAGCCTGAAAGAGAATGG + Intergenic
991386110 5:66092268-66092290 AGTGAAAGCCTGCAGGAAGAAGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993407651 5:87531534-87531556 AAAGAGAGAAGGAAGGAGGAAGG - Intergenic
993426136 5:87766205-87766227 AATGAGAGCCAGAAAGGGGTGGG + Intergenic
993786636 5:92147065-92147087 ACTGAGAGCCAGCAGCAGGATGG + Intergenic
994427532 5:99610630-99610652 CAAGTGAGTCTGAAGGAGGAGGG + Intergenic
994977929 5:106834788-106834810 AATGAGAGCTTAAAGCAGGTTGG - Intergenic
995151537 5:108853343-108853365 AATGTAAGCCTCAAGGAGGCTGG - Intronic
995793817 5:115921766-115921788 TGTGAGAGTCTGAAGGAGGTAGG - Intergenic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996347306 5:122500982-122501004 AATGAGATGCTGAAAAAGGAGGG - Intergenic
998813157 5:145986512-145986534 CGTGGGAGCCTGAAGGATGAGGG - Intronic
999610777 5:153367108-153367130 AATGAGAGAATGGAGGAGGAGGG + Intergenic
999840967 5:155426073-155426095 AATGAGACAGTGAAGGAAGAGGG + Intergenic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1001080840 5:168666067-168666089 AATGATAGCCTGTCTGAGGAAGG - Intronic
1001408736 5:171495379-171495401 AGGGAGAGCGGGAAGGAGGAAGG + Intergenic
1001763686 5:174227845-174227867 AAAGAGACCCTGCCGGAGGAAGG + Intronic
1001826025 5:174745705-174745727 GATGACAGCCTGAAGGATTACGG + Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002026697 5:176400703-176400725 GATAAGTGCTTGAAGGAGGAGGG - Intronic
1003744895 6:8989725-8989747 AAGAAGAGAGTGAAGGAGGAGGG + Intergenic
1003783762 6:9459836-9459858 AATTATGGCCTGAAGGAGAATGG + Intergenic
1004742694 6:18477205-18477227 AATGAGAGCCTGATCCAGGTTGG + Intergenic
1004915900 6:20331883-20331905 AAAGAAAGCCAGAAGGAGGTTGG + Intergenic
1005265892 6:24111927-24111949 ATTGAGATCCTGTAAGAGGAAGG + Intergenic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007130303 6:39466233-39466255 AAGGAGAGAAGGAAGGAGGAAGG - Intronic
1007233934 6:40377166-40377188 CATGACAGCATCAAGGAGGATGG + Intergenic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1011741127 6:90361871-90361893 AAGGTGAGCCTGGAGGAGGTGGG - Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012280545 6:97322710-97322732 AATGAGAGAATGAGTGAGGAAGG - Intergenic
1012556002 6:100512366-100512388 AATCAGAACCTCAAGGAGGCGGG - Intronic
1012954343 6:105552866-105552888 TATGAGAGGCTGAAGATGGAAGG + Intergenic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013394594 6:109722646-109722668 AATGAAAGCCAGAATGAAGAGGG - Intronic
1014003599 6:116392251-116392273 AATGGAGGCCTGAAGGAGGAGGG + Intronic
1014046135 6:116889563-116889585 AATGAGGACCTGATGGAAGAAGG + Intronic
1014218992 6:118781142-118781164 AGTGGGAGCCTGGAGGAAGAGGG + Intergenic
1016163032 6:140905648-140905670 AATGAGTGCCTGAAGCACCAAGG - Intergenic
1016339687 6:143049550-143049572 AAGGAGGGCCTGAAGGCTGAGGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017273992 6:152544403-152544425 AATGTGAGCCTCAAGGATGAAGG - Intronic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017954722 6:159168919-159168941 AATGACAGCCAGACGGAGCAGGG + Intergenic
1018816797 6:167338939-167338961 AGGGAGAGCAGGAAGGAGGAAGG - Intronic
1019230994 6:170562923-170562945 AAAGGGAGTATGAAGGAGGAAGG - Intronic
1019874010 7:3792674-3792696 GATGGGAGACTGCAGGAGGAGGG - Intronic
1020487802 7:8740140-8740162 TATGAAACCCTGAAGGAGAAAGG - Intronic
1020819897 7:12954196-12954218 AATGTGAGTCTGGAGGAGTAAGG + Intergenic
1021408807 7:20304840-20304862 AATGGGAGAATGAAGGAGCAGGG - Intergenic
1022495001 7:30847353-30847375 AAGCAGAGCCTGTAGGATGAGGG + Intronic
1022575505 7:31493212-31493234 AATGAGAGACTCCAGGAGGCAGG - Intergenic
1023560668 7:41470309-41470331 GGTCAGAGTCTGAAGGAGGAGGG - Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1024013908 7:45294154-45294176 AATCAGTGCCTGGTGGAGGATGG + Intergenic
1024977518 7:55127428-55127450 AAGGAGAGGATGAAGGAGTAAGG - Intronic
1026150852 7:67787117-67787139 AGTGAGACTCTGAAGAAGGAAGG - Intergenic
1026280225 7:68915694-68915716 TTTGAGAGGCTGAAGCAGGAGGG + Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027464956 7:78503650-78503672 GGTGAGAGAATGAAGGAGGAGGG - Intronic
1027689811 7:81330317-81330339 TATGAGAGCCAGAAGCAGGAAGG + Intergenic
1027870369 7:83699152-83699174 AATGTGAGCCTCATGGAGGTAGG + Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029356077 7:100052749-100052771 AGTGAGTGCAGGAAGGAGGAAGG + Intronic
1030482046 7:110116584-110116606 TTTGAGAGTCTGAAGCAGGAGGG + Intergenic
1031886735 7:127252269-127252291 AATGGGAGACTGAAGGGTGACGG - Intronic
1032173437 7:129605039-129605061 GTTCAGAGCATGAAGGAGGAGGG - Intergenic
1032592882 7:133208508-133208530 AATGAGACCCAGAAGAAAGAAGG - Intergenic
1032727711 7:134606422-134606444 AATGAAAGCCTGAAGTTTGAAGG - Intergenic
1033274825 7:139963915-139963937 GAGGAGAGCATGATGGAGGATGG - Intronic
1033432319 7:141300424-141300446 AATGAGAAAGTGAGGGAGGATGG + Intronic
1033858741 7:145598489-145598511 GATGAGAGCCTGAGGCAGGAAGG + Intergenic
1034522136 7:151628688-151628710 AGTGAGACCCTGAGGGAGGGAGG + Intronic
1036130380 8:6104222-6104244 AATGAGACCCTGAAAAAAGAAGG + Intergenic
1036291029 8:7490765-7490787 AATGGGAGATTGAAGAAGGAAGG + Intergenic
1036330461 8:7820771-7820793 AATGGGAGATTGAAGAAGGAAGG - Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1038405949 8:27323102-27323124 AAAGAGAACCTGAACCAGGATGG + Intronic
1038774622 8:30517456-30517478 AATTAGTGGCTGAAGGTGGAGGG + Intronic
1039129170 8:34242160-34242182 AATGTGAGTGTGAAAGAGGAGGG + Intergenic
1039393545 8:37202787-37202809 AAAGAGACACTGCAGGAGGAAGG - Intergenic
1040783429 8:51138687-51138709 AATGAACGACGGAAGGAGGAAGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041830310 8:62146094-62146116 AATGATAGCCTGAGGGAAAAAGG + Intergenic
1042072639 8:64953288-64953310 ATTGTGAGCTTGAAGGAGAAAGG + Intergenic
1042490640 8:69393791-69393813 AGTGAGAGCCTGGATGAAGAAGG + Intergenic
1042989063 8:74618457-74618479 AATGAGAGCCGGAAGGGAGGGGG + Intronic
1043585181 8:81760489-81760511 AAAGAGAGCCGTAAGCAGGAAGG + Intergenic
1044822305 8:96162488-96162510 CATGACAGCCTGCAGGGGGAGGG + Intergenic
1045135358 8:99211156-99211178 AATGAGAGGCTGAATGAAGTAGG + Intronic
1046093746 8:109533966-109533988 AATGAAACCCTAAAGGAGCAAGG - Intergenic
1047705418 8:127494504-127494526 CATGAGATCATGAAAGAGGAAGG + Intergenic
1048326599 8:133443845-133443867 AATGAGGCCCTGATGGAGCAAGG - Intergenic
1049340119 8:142107685-142107707 GATGAGAACCTGAAGGTGCACGG - Intergenic
1050479527 9:6075400-6075422 AAAGAGAGCCTGGAGGAGGGAGG - Intergenic
1052088447 9:24296365-24296387 ACTGAGAGCCTGACTGAGAAAGG - Intergenic
1053103278 9:35389563-35389585 ACTGAGAGAAGGAAGGAGGATGG + Intronic
1055320860 9:75082204-75082226 AATGACAGCCTGTATCAGGATGG + Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056419148 9:86407003-86407025 AATGAGAGGGTAAAGGAGAATGG - Intergenic
1056523160 9:87418762-87418784 AAAGAGAGAATGAAGGAGGGAGG - Intergenic
1057268884 9:93636109-93636131 ACTCAGGGCCTGAATGAGGAGGG + Intronic
1057347520 9:94264046-94264068 AATTACAGCCTGAAGAATGACGG - Intronic
1057914361 9:99044263-99044285 AGTGGGAGCCTGAAGGGGCATGG + Intronic
1058138688 9:101335580-101335602 AATAAGGGAGTGAAGGAGGATGG + Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1059770238 9:117416955-117416977 AAGGAGAGACTGAGGGAGGCAGG - Intergenic
1060018030 9:120104249-120104271 AATGAGATCAGAAAGGAGGACGG + Intergenic
1060277598 9:122193741-122193763 AACCAGGTCCTGAAGGAGGAAGG + Intronic
1060424524 9:123493400-123493422 ACTGAGAGGGTGAAAGAGGATGG + Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061877095 9:133549625-133549647 TATGAGAGGCTGAGGCAGGAGGG - Intronic
1061967021 9:134020690-134020712 AATGTGCCTCTGAAGGAGGAGGG + Intergenic
1062468754 9:136692863-136692885 AATGAGTGACGGAAGGAGGGAGG + Intergenic
1062722953 9:138053832-138053854 AAACACAGCCTGCAGGAGGAGGG - Exonic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1186387648 X:9126136-9126158 AGTGAGACCCTGAAGAAGAAAGG + Intronic
1186617411 X:11203766-11203788 AATGAGAGAATGAAGGAGTTTGG - Intronic
1187065424 X:15832245-15832267 TTTGAGAGTCTGAAGGATGATGG - Intronic
1188122566 X:26327312-26327334 TATGAGAGTCTGAACGATGATGG - Intergenic
1188642304 X:32521430-32521452 AATGATAGGGTGGAGGAGGATGG - Intronic
1189611475 X:42740939-42740961 ATTGGGATCCTGAAGTAGGATGG + Intergenic
1189921248 X:45905040-45905062 AATAAATGGCTGAAGGAGGAAGG - Intergenic
1190006920 X:46749154-46749176 CATAAGAACTTGAAGGAGGAGGG + Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190627426 X:52350238-52350260 AAAGAAAGACTGAAGGAGTAGGG + Intergenic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190952013 X:55155385-55155407 AATGCAAGCCTGAATTAGGATGG + Intronic
1190984035 X:55484542-55484564 AATGGCAGCCTGATGGATGAAGG + Intergenic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1193291820 X:79782193-79782215 AAAGAGACCCTGAAAGAGAAGGG + Intergenic
1194142999 X:90228418-90228440 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195694748 X:107658712-107658734 AGTGAGACCCTGAGGAAGGAAGG + Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1197749068 X:129952673-129952695 AAGGAGAGCGGGAGGGAGGAGGG - Intergenic
1197817145 X:130509677-130509699 AATGAGAGACTGAAAGAGGGTGG - Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199555057 X:149098138-149098160 AAGGAGAGAAGGAAGGAGGAAGG + Intergenic
1199757761 X:150881163-150881185 AATGAGAGCATGAAGGACACTGG - Intronic
1200413100 Y:2880903-2880925 AATGAGGGCCTAAATTAGGATGG - Intronic
1200488752 Y:3797737-3797759 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic
1201539347 Y:15089510-15089532 AATGGGAGCAAGAAGAAGGATGG + Intergenic