ID: 1007065703

View in Genome Browser
Species Human (GRCh38)
Location 6:38988323-38988345
Sequence TTGTATGTGTATAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007065698_1007065703 13 Left 1007065698 6:38988287-38988309 CCCAAATAGCCTCCAAATTTGGT 0: 1
1: 1
2: 1
3: 23
4: 227
Right 1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 291
1007065701_1007065703 1 Left 1007065701 6:38988299-38988321 CCAAATTTGGTGAAACTCAGCTA 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 291
1007065700_1007065703 4 Left 1007065700 6:38988296-38988318 CCTCCAAATTTGGTGAAACTCAG 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 291
1007065695_1007065703 15 Left 1007065695 6:38988285-38988307 CCCCCAAATAGCCTCCAAATTTG 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 291
1007065696_1007065703 14 Left 1007065696 6:38988286-38988308 CCCCAAATAGCCTCCAAATTTGG 0: 1
1: 0
2: 2
3: 17
4: 187
Right 1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 291
1007065699_1007065703 12 Left 1007065699 6:38988288-38988310 CCAAATAGCCTCCAAATTTGGTG 0: 1
1: 0
2: 0
3: 11
4: 206
Right 1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007065703 Original CRISPR TTGTATGTGTATAAAGTGCT GGG Intronic
901889342 1:12249051-12249073 TTGTGTTTGTATAAAGTGCCTGG + Intronic
902952554 1:19897884-19897906 TTGTATGTGTATAAGATACATGG + Intronic
903424406 1:23243112-23243134 GTGTATGTGTGTATAGTGTTAGG - Intergenic
905027706 1:34862461-34862483 CTAAATGTGTATAAAGTGCTTGG + Intergenic
905328108 1:37172380-37172402 TTGTATGTGGTTAAAATGATTGG - Intergenic
906827320 1:48995399-48995421 TTGAATGTTTACTAAGTGCTGGG + Intronic
906927460 1:50134236-50134258 TTGTATATTTATAAAATGCCTGG - Intronic
907686985 1:56621854-56621876 TTGTATGTGTATAGAGGAGTGGG + Intronic
908196295 1:61748906-61748928 TTGAATGTGTACCATGTGCTAGG + Intronic
908419300 1:63944177-63944199 TTCTTTGTGTATCAAATGCTTGG - Intronic
909131647 1:71744291-71744313 ATATATATATATAAAGTGCTTGG + Intronic
909401224 1:75233212-75233234 TTGTATTTGTATAAATTTATGGG + Intronic
910417784 1:87018934-87018956 TTGTATGTTTGTAAAATGCATGG + Intronic
911485204 1:98496977-98496999 TTGAATGTGTATAAAGTGTGTGG + Intergenic
911488681 1:98534605-98534627 ATGTATGTATATATAGTTCTGGG + Intergenic
912784163 1:112583538-112583560 GTGTATCTGCATATAGTGCTAGG - Intronic
913192923 1:116428830-116428852 TTGGAAGTGTATAAAATACTAGG + Intergenic
913215730 1:116618695-116618717 TTGTGTGTGTATACAGTCATGGG - Intronic
915813673 1:158943664-158943686 TTGTATGTCGATACAGTACTAGG + Intronic
916396056 1:164388734-164388756 ATGAATATGTATAAAATGCTTGG - Intergenic
916451091 1:164921117-164921139 TTGTATGTATATAATGTACCGGG - Intergenic
919421233 1:197372756-197372778 TTGTATGCGTACAAAGAGATAGG - Intronic
920125991 1:203694210-203694232 TTGTGTGTGTACAATGTGCTGGG + Intronic
921212102 1:212909671-212909693 GTGTATGTGGGTACAGTGCTGGG + Intergenic
921496585 1:215849834-215849856 TTAAATGTGTATAAAATTCTTGG - Intronic
921721805 1:218480819-218480841 TTGTATGTTTATAAAGCTGTTGG + Intergenic
921879755 1:220242520-220242542 TTGTATCTGTATTAATTGCACGG - Intronic
922063693 1:222115838-222115860 TTTTATGTGTATAAATTTATGGG + Intergenic
924422355 1:243921433-243921455 TTGTATAAGGATAAAGTCCTTGG + Intergenic
1064717828 10:18195307-18195329 TGGTATGAGAATATAGTGCTGGG - Intronic
1064816493 10:19271019-19271041 TTGAATGTTTATATACTGCTGGG + Intronic
1064833471 10:19498480-19498502 TTGTGCTTGTATAATGTGCTGGG - Exonic
1065113276 10:22460514-22460536 TAGGAAGTGTATAAAGTCCTGGG - Intergenic
1065247412 10:23772830-23772852 TTGTTTGTGTATAAAGTTTGAGG - Intronic
1067519671 10:46988406-46988428 TTGTATATATTTAAAGAGCTAGG - Intronic
1067642577 10:48063433-48063455 TTGTATATATTTAAAGAGCTAGG + Intergenic
1068285828 10:54933481-54933503 TTGTATGTGTATCAGGTTGTAGG - Intronic
1069252644 10:66289336-66289358 TTGTTTGTTTCCAAAGTGCTGGG - Intronic
1071390773 10:85173128-85173150 TTATATGAATATAAACTGCTAGG + Intergenic
1072213907 10:93272216-93272238 TTGTATATATAAAAAGTTCTGGG + Intergenic
1072569962 10:96649969-96649991 ATGTATGTCTATAAAGTTGTTGG - Intronic
1073041352 10:100609132-100609154 TTGCAGGTGTATGAACTGCTAGG - Intergenic
1075633261 10:124014038-124014060 TTCTATGTGTAGAAAGTCCTGGG + Intronic
1079298235 11:19254065-19254087 TCCTATCTGGATAAAGTGCTGGG + Intergenic
1081629211 11:44677036-44677058 TTGTCTGGGTATAAATTTCTCGG + Intergenic
1081871992 11:46387265-46387287 TTTTAAGTGTCAAAAGTGCTTGG - Intergenic
1084248166 11:67874540-67874562 ATGTATATGTATACAGTGCCTGG - Intergenic
1084341539 11:68506398-68506420 TTTTTTGAGTATAAAGGGCTGGG - Intronic
1084824659 11:71720946-71720968 ATGTATATGTATACAGTGCCTGG + Intergenic
1086011419 11:82108280-82108302 TTTTATGTGTATAAATTTATGGG + Intergenic
1086103266 11:83123745-83123767 TTGAATGTTTACAAAGTGCCAGG - Intergenic
1086247931 11:84776899-84776921 TTTTATTTGTATAAATTACTGGG + Intronic
1087104603 11:94397254-94397276 TTGAATGAGTAAATAGTGCTGGG - Intronic
1087705228 11:101482510-101482532 TTTGATGTATATAAAGTGCTTGG + Intronic
1091534556 12:1393638-1393660 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1091828818 12:3534976-3534998 GTGTCTATCTATAAAGTGCTTGG + Intronic
1091892575 12:4071861-4071883 TTGTATTTGTATAAATTTATGGG - Intergenic
1092214821 12:6673607-6673629 TTGAATATTTATAATGTGCTGGG - Intronic
1092696663 12:11178668-11178690 TTGTATTTGTGTATAGTTCTAGG - Intergenic
1093758457 12:22878714-22878736 TTGTATGTCTATAATGTGATCGG - Intergenic
1094002371 12:25708556-25708578 TTGAATGTGTTTAAGGTCCTGGG - Intergenic
1097207740 12:57337665-57337687 GTGTATGTGTGTAAAGATCTTGG + Intronic
1098148725 12:67524798-67524820 ATTGATGTATATAAAGTGCTTGG + Intergenic
1098869265 12:75798706-75798728 GAGTTTGTGTTTAAAGTGCTTGG - Intergenic
1099260780 12:80379779-80379801 TTGAATGTTTATAAAGTTCTAGG - Intergenic
1099552635 12:84067198-84067220 TTGTTAGTGTCTAAATTGCTTGG - Intergenic
1100142860 12:91640041-91640063 TTGAATATTTATTAAGTGCTGGG + Intergenic
1100890123 12:99116119-99116141 TTTTATGTGCGTAAAGTGCTAGG + Intronic
1101078893 12:101161138-101161160 TTGTTTGAGTAGAAATTGCTAGG - Intronic
1101484031 12:105132820-105132842 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1101484887 12:105146430-105146452 TTGTATGTGTATTATGTTGTAGG + Exonic
1101822765 12:108196577-108196599 TTCTATATATGTAAAGTGCTTGG - Intronic
1102659833 12:114516497-114516519 TTGTATGTTTCAAAATTGCTCGG + Intergenic
1104860689 12:131921832-131921854 CTCTATATGCATAAAGTGCTTGG - Exonic
1105571382 13:21606054-21606076 TTGAATGTCTATTACGTGCTGGG - Intergenic
1105665249 13:22548533-22548555 TTTTATCTGTAAAAAGTGTTAGG + Intergenic
1106060625 13:26287827-26287849 TTTTAAGACTATAAAGTGCTAGG + Intronic
1106804078 13:33288151-33288173 ATGAATGTGTTGAAAGTGCTGGG + Intronic
1109941575 13:69374210-69374232 TTTTCTGTGTAAGAAGTGCTGGG - Intergenic
1110511026 13:76350551-76350573 TTTTTTGTGTATAAACTTCTTGG + Intergenic
1110621555 13:77601545-77601567 TTTCATTTATATAAAGTGCTGGG + Intronic
1110747864 13:79077426-79077448 ACGTATGTGTATATAGTGTTTGG + Intergenic
1111235931 13:85407518-85407540 TAATGTGTGTATAAAGTTCTTGG - Intergenic
1111236176 13:85411484-85411506 TAATGTGTGTATAAAGTTCTTGG + Intergenic
1120267474 14:82269635-82269657 ATGAATGTGTGTCAAGTGCTTGG + Intergenic
1120579191 14:86225292-86225314 TTGTAGGTATATAAATTCCTGGG + Intergenic
1120600693 14:86502750-86502772 TTTTATGTGTAGAACTTGCTGGG - Intergenic
1120633978 14:86928492-86928514 GTTTCTGTGTCTAAAGTGCTTGG + Intergenic
1122000571 14:98648240-98648262 CTGTGTGTTCATAAAGTGCTTGG + Intergenic
1124194341 15:27607798-27607820 TTGTTTGTGCATACAATGCTTGG - Intergenic
1125109898 15:36020174-36020196 TTGTATATCTAAAAAGTCCTAGG - Intergenic
1128722855 15:69964961-69964983 TTGTTTGTGTTTTAAGTGATAGG + Intergenic
1128780200 15:70354160-70354182 TTGTTTGTGTTTAATGGGCTTGG + Intergenic
1130437957 15:83921145-83921167 TAGAATTTGTATAAAGTCCTAGG - Intronic
1130745152 15:86645283-86645305 TTGTGTGTGTAAAAAGAGCAGGG + Intronic
1130862286 15:87901616-87901638 TTGCATGTTTATACTGTGCTAGG + Intronic
1131844557 15:96475331-96475353 TTGTCTGTGTGCAAAGTGATTGG + Intergenic
1133438185 16:5798186-5798208 TGATATGTGTAAAAAGTGATTGG + Intergenic
1134467429 16:14491932-14491954 TGGTATGTGAAAAAAGTGCCTGG + Intronic
1138150209 16:54649841-54649863 ATTTATGTTTATAAAGTGCCTGG + Intergenic
1140852214 16:78945772-78945794 TGGTATGTGTATTATGTTCTTGG + Intronic
1143277855 17:5726875-5726897 TTGTTTGTGTAACAAGTGGTCGG - Intergenic
1143316930 17:6039960-6039982 TGAGAAGTGTATAAAGTGCTTGG + Intronic
1143992608 17:10979360-10979382 TTCTATTTGTATCAGGTGCTGGG - Intergenic
1144333082 17:14241960-14241982 TTTTATTTATATAAAGTGCAAGG - Intergenic
1144375633 17:14637305-14637327 GTCTATGTATATAAAGTTCTAGG - Intergenic
1146726846 17:35163156-35163178 GTGAATGTGTATAAAGCTCTTGG + Intronic
1149520172 17:57312734-57312756 TTGTATGTGTATGAATTAATGGG + Intronic
1155098434 18:22583471-22583493 TTGTCTGGGTATAAAGTTCTTGG - Intergenic
1155874181 18:31064619-31064641 TTGCATGAGTTTGAAGTGCTAGG + Exonic
1158779781 18:60633683-60633705 TTATATCTGTATAAAGAGGTAGG - Intergenic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1159989484 18:74886667-74886689 ATCTAGGTGTATAAATTGCTAGG + Intronic
1164490252 19:28704631-28704653 TTGTATGTGCATTTTGTGCTGGG - Intergenic
1166340415 19:42133617-42133639 GTGTGTGTGTGTGAAGTGCTGGG - Intronic
926054047 2:9763429-9763451 ATGAATGTGTACAAGGTGCTAGG - Intergenic
926264112 2:11298686-11298708 TTATTTGTGTTCAAAGTGCTGGG + Intronic
926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG + Intergenic
927308828 2:21605098-21605120 TTGGATGTGTTTAATGTGTTTGG - Intergenic
927365688 2:22293730-22293752 TTGTGTGTCTACAATGTGCTAGG + Intergenic
927882046 2:26695819-26695841 TTATTTATTTATAAAGTGCTGGG + Intronic
928589292 2:32797585-32797607 TAGCATGTGTATACAGTGTTAGG - Intronic
929279200 2:40059840-40059862 ATGTATGTGTATAGATTGCTGGG - Intergenic
929292125 2:40205275-40205297 TTATAAGTCTAAAAAGTGCTAGG + Intronic
929954903 2:46449738-46449760 TTGTAAGGGTATAAAGAGCCAGG + Intronic
930460655 2:51670534-51670556 TTGTATATGTATAAACTCATGGG - Intergenic
930907599 2:56590865-56590887 TTGTATGTGGATATGATGCTTGG + Intergenic
931151966 2:59584523-59584545 TCCTGTGTATATAAAGTGCTTGG - Intergenic
932982435 2:76686169-76686191 TGGCATGAGTTTAAAGTGCTGGG + Intergenic
933714097 2:85347691-85347713 TTGTTTGTTTTTCAAGTGCTAGG - Intronic
935329531 2:101966449-101966471 TTTTATGTCTATAGAATGCTTGG + Intergenic
935557807 2:104529448-104529470 TTATTTTTGTATAAAGTGCAAGG - Intergenic
935953264 2:108350306-108350328 GTTAATGTGTATAAAGTGCCTGG + Intergenic
937371494 2:121300904-121300926 ATGTATTTGTATAAAGTATTAGG - Intergenic
939266642 2:139882589-139882611 ATGTAAGTGTATGAAGTCCTAGG + Intergenic
939685431 2:145192910-145192932 TTGTATTGGTATAAAGTTATGGG + Intergenic
939972230 2:148675541-148675563 TTCTATCTGTATAAAATGATGGG + Intronic
940201972 2:151161962-151161984 TTATATGTGTACACAGGGCTAGG + Intergenic
942730939 2:179060129-179060151 TTTTATGTGTATAAATTTATGGG - Intergenic
944281264 2:197900722-197900744 TTGTATGTTTACAAAGTGAAAGG + Intronic
945972748 2:216246165-216246187 TTGTACTTGGATAAAGTCCTGGG - Intergenic
946842603 2:223833553-223833575 TTTTCTGTGTGTAAAGTACTAGG + Intronic
947474162 2:230427790-230427812 TTGTATGTGTTTGAAGTTGTTGG - Intronic
947557750 2:231111943-231111965 TTGAGTGTTTATAATGTGCTAGG - Intronic
948394589 2:237635210-237635232 TTGGTTGTGTATAGAGTTCTAGG + Intronic
1169747857 20:8961561-8961583 TTGAATGTGTAAAAACTGTTTGG + Intronic
1169904203 20:10584368-10584390 TTGTTTGTGTTTAAAGAACTAGG + Intronic
1170522104 20:17197339-17197361 TTGTATGTTTTTAAAGCACTTGG + Intergenic
1170710756 20:18788298-18788320 TTGTATTTGTATAAATTTATGGG - Intergenic
1170994052 20:21334896-21334918 TTGAATGTGTATAAAGCTCAGGG + Intronic
1174146728 20:48457228-48457250 GTGTATGTGTATAGTGAGCTTGG - Intergenic
1177947574 21:27491065-27491087 TTGTATCTATATAAAATGCCTGG + Intergenic
1178262354 21:31111488-31111510 ATGTAAGTGTATCAATTGCTAGG - Intergenic
1179211558 21:39329104-39329126 TTGAATGTCTATTATGTGCTAGG + Intergenic
1181888840 22:26043423-26043445 TTGTATTTGTCTAGATTGCTGGG + Intergenic
1182088641 22:27579003-27579025 CTGTATTCATATAAAGTGCTTGG - Intergenic
1182540865 22:31040918-31040940 TGGCATTTGTATAAAGTTCTAGG + Intergenic
1183859860 22:40662036-40662058 ATGTATGTGGATAGACTGCTCGG + Intergenic
949752556 3:7371542-7371564 TTGATTGTTTATAATGTGCTAGG + Intronic
950059611 3:10059439-10059461 TTGAATGTCTATCATGTGCTAGG + Intronic
950879741 3:16313584-16313606 TAAGATGTGAATAAAGTGCTTGG - Intronic
951665700 3:25121076-25121098 ATGCATGTGTATAAAGTGGTGGG + Intergenic
952239215 3:31512489-31512511 TTTTATTTGTATAAAGTTGTGGG + Intergenic
953068562 3:39497515-39497537 TTGGACCTGTCTAAAGTGCTTGG + Intronic
954998844 3:54907472-54907494 TTTTATGTATATAAAGTTTTTGG + Intronic
955877253 3:63505133-63505155 TTACATGTGTCTAAAGCGCTTGG - Intronic
956574091 3:70732356-70732378 TTGTATTAATTTAAAGTGCTTGG - Intergenic
956994370 3:74807138-74807160 CTGTTTGTTTATAAAGTTCTCGG + Intergenic
957217233 3:77336199-77336221 TTGTAGGTGAATAAAGAGCCAGG + Intronic
957227272 3:77465918-77465940 TTGCATGTATAAAAAGTACTTGG + Intronic
957579350 3:82050704-82050726 TTCTCTGTCTATAAGGTGCTAGG + Intergenic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
959032011 3:101309938-101309960 TTCTATTTATATAAAGTCCTAGG + Intronic
961625855 3:128263067-128263089 GTTAATGTGTATAATGTGCTCGG + Intronic
962060802 3:131925224-131925246 TTGTGTGTGTGTAGAGTGCAAGG - Intronic
963333687 3:143946548-143946570 TTGTGTGTCTATAAATTCCTAGG + Intergenic
963445479 3:145400926-145400948 CAGTATTTGTAGAAAGTGCTAGG + Intergenic
963760335 3:149281750-149281772 TTGAATTTGTATAAAGACCTTGG + Intergenic
963926222 3:150953816-150953838 TTTTATATATATAAAGTACTTGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964839387 3:160977319-160977341 TTGACTGTGTAGAAATTGCTAGG + Intronic
965138050 3:164800277-164800299 TTGAATGTGTATAATGTTCAAGG + Intergenic
965485046 3:169268302-169268324 GTGAATGTATATAAAGTGGTTGG - Intronic
965570919 3:170172288-170172310 GTTTATGTGTATAAAGTTCTAGG - Intronic
965745059 3:171916234-171916256 TTGTATTTGGTGAAAGTGCTGGG - Intronic
966312906 3:178614843-178614865 GTGTCTGTGCATAAAGTGTTAGG + Intronic
967919625 3:194604638-194604660 TTGTATGTGTATAGAGTATCTGG - Intronic
968219964 3:196929762-196929784 CTGTATGTGTATATGATGCTAGG + Intronic
969832055 4:9805809-9805831 TTGTGTGCTTATTAAGTGCTGGG + Intronic
969996667 4:11319416-11319438 TTGATTGTGTGTAAAGTGATTGG - Intergenic
970013907 4:11491191-11491213 TTGGCTGTGTATAAAATTCTGGG + Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
971636671 4:29069083-29069105 TTGTATATATATCAAGTGGTAGG + Intergenic
971862745 4:32129122-32129144 TAGTATCTGTAAAAAGTGCCTGG + Intergenic
972114666 4:35616482-35616504 TTGTATGTGTATAATTTTATAGG + Intergenic
972116483 4:35641479-35641501 TTTTTTGAGTATAAAGTTCTAGG - Intergenic
972437654 4:39049386-39049408 TTGAATGTGTATAAGGGGCCAGG + Intronic
973116706 4:46469478-46469500 GTTTATGTGTATAAAATCCTTGG + Intronic
974459143 4:62165131-62165153 TTGTTTGTGTCTAAAGACCTGGG - Intergenic
975597105 4:76058648-76058670 GTGTATGTGTATAAATAGATAGG - Intronic
975605056 4:76147442-76147464 TTGTATGTGTAACCAGTGTTGGG - Intronic
978034092 4:103972992-103973014 TTGTGTGTGTATACATTTCTAGG + Intergenic
978152988 4:105459022-105459044 TTGGATGCCTATTAAGTGCTAGG - Intronic
978622743 4:110650589-110650611 TGCTATGTGTATACAGTACTTGG - Intergenic
978716732 4:111853250-111853272 ATGCATGCATATAAAGTGCTTGG + Intergenic
979184168 4:117767493-117767515 TTGTGGGTGTTTAAAGTGCTGGG + Intergenic
981048462 4:140288016-140288038 TGGTATGTGTGTAAAGTGTGGGG - Intronic
982714695 4:158794478-158794500 TTGTATGTTTTTTAAGTTCTAGG + Intronic
983180411 4:164641860-164641882 TTGTAGGTGTATATACTTCTGGG - Intergenic
984083696 4:175282090-175282112 TAATATTTGTATAAAATGCTTGG + Intergenic
985157989 4:187012957-187012979 TTGAATGCATATCAAGTGCTGGG + Intergenic
986548123 5:8922053-8922075 TTTTATGGGTATAAAATTCTAGG - Intergenic
986761861 5:10887430-10887452 ATGTATGTGTCTAAAGTGCTGGG - Intergenic
987435736 5:17891997-17892019 TTGTATGTGTGTGAAGTTCAAGG + Intergenic
989484509 5:41973728-41973750 TTGAATGTGTAAAAAGTAATGGG - Intergenic
990105488 5:52253655-52253677 TTTTAAGTGTATAAAGTAATTGG - Intergenic
990863456 5:60353784-60353806 TTGTATGCATATAAAGTATTTGG - Intronic
991217279 5:64170172-64170194 TTGTTTGTGGATATATTGCTTGG + Intronic
992343387 5:75849539-75849561 CTGAATGTGTATAAAATACTTGG + Intergenic
993088186 5:83390940-83390962 TTGTTTTTGGATAAGGTGCTTGG + Intergenic
994361696 5:98857918-98857940 TTGTATGATTATAAATTGCGTGG - Intronic
995928899 5:117411316-117411338 TTGTCTGTGGAGAAAGTTCTAGG - Intergenic
996221988 5:120944596-120944618 ATGTATGTGTATTAAATGTTTGG - Intergenic
996959068 5:129222339-129222361 TTGTATGTGTGTAGAATTCTCGG + Intergenic
997756666 5:136406115-136406137 ATATATGTGTGTAAATTGCTTGG + Intergenic
998393517 5:141803339-141803361 GAGGATGTGTATAAAGTGCTTGG - Intergenic
1000022465 5:157330282-157330304 GTGTTTGTGTTTAAAGTGCCTGG + Intronic
1000857732 5:166420474-166420496 TTATATGAGTATAAAGTGTCAGG + Intergenic
1001278588 5:170369299-170369321 ATGTATGTGTGTAAAGGGCTTGG + Intronic
1004270549 6:14191565-14191587 ATGCATTTGTATAATGTGCTAGG + Intergenic
1004330887 6:14719808-14719830 TTGTTTTTCTCTAAAGTGCTTGG - Intergenic
1004471065 6:15929512-15929534 TTCCATGTGTATAGTGTGCTAGG + Intergenic
1005209479 6:23443928-23443950 TCATATGTGTAGTAAGTGCTGGG + Intergenic
1005278307 6:24243491-24243513 TTTAATGTGTTTAAAATGCTCGG + Intronic
1006034581 6:31201581-31201603 TTTTATGTTTACAAAGTGATAGG + Intronic
1006765434 6:36500931-36500953 TTGTTTTTGTATATAGTTCTTGG + Intronic
1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG + Intronic
1007184771 6:39960124-39960146 TTGTATTTGAATAAAGGGATAGG + Intergenic
1007868700 6:45007058-45007080 TTGGTTGGGTATAAAGTCCTTGG + Intronic
1008436070 6:51478028-51478050 ATGGGTGTGTATAAAGCGCTAGG - Intergenic
1009346853 6:62624041-62624063 TTTTATGTTTGTAAAGGGCTGGG + Intergenic
1009405321 6:63305454-63305476 TAGTCTGTTTATAAAGTTCTAGG - Intronic
1009866351 6:69402361-69402383 TTTTATTTTTATAAAGTGCTGGG - Intergenic
1010082570 6:71881363-71881385 GTGAATATGTATATAGTGCTTGG - Intergenic
1010385216 6:75272141-75272163 TTGAATGTATACTAAGTGCTGGG + Intronic
1011284853 6:85712425-85712447 TTGGATGTGTATAAAGTCCTTGG + Intergenic
1011499445 6:87971783-87971805 CTCAATGTTTATAAAGTGCTTGG - Intergenic
1011827698 6:91330107-91330129 TTGTATTTCTTTGAAGTGCTTGG + Intergenic
1012635205 6:101529613-101529635 TTGAATGTTTATAATGTGCGAGG + Intronic
1014507502 6:122278077-122278099 TGGTGTGTGTATAAAGCGATGGG - Intergenic
1014651681 6:124047370-124047392 TCGTATGTCTATAAAATGCAAGG + Intronic
1017267372 6:152463908-152463930 TTTTATTTGTATAAATTGATGGG + Intronic
1017411211 6:154169509-154169531 TAGCATGTGTATAATTTGCTAGG - Intronic
1019152043 6:170013302-170013324 ATTTAAGTGTATAAAATGCTTGG + Intergenic
1019819124 7:3227677-3227699 ATGTATATATATAAAGTGCTGGG + Intergenic
1020237085 7:6364678-6364700 TTGTCTCTAAATAAAGTGCTGGG - Intergenic
1021049641 7:15966632-15966654 TTATATATATATAAAGTTCTGGG - Intergenic
1021353401 7:19623916-19623938 TTGGCTGAGTATAAAGTCCTTGG + Intergenic
1022262434 7:28719383-28719405 TTGTGTGAGGATCAAGTGCTTGG - Intronic
1022960509 7:35421877-35421899 TTTTATTTGTATAAACTGATGGG + Intergenic
1023344792 7:39260332-39260354 TTGTATGTGTATAGAGTGTGTGG - Intronic
1023366585 7:39470572-39470594 GTGTGTGTGTATAAAGGGGTTGG - Intronic
1023586680 7:41738194-41738216 GTGTCTGAGTATAAAGTGATAGG + Intergenic
1027235761 7:76296904-76296926 GTGAATGTGTGTAAAGTGCTCGG - Intergenic
1028388100 7:90282380-90282402 TTGTATCTGTATAAACACCTTGG + Intronic
1030581479 7:111361157-111361179 TTCTATATGTACAAAATGCTAGG + Intronic
1031309382 7:120176396-120176418 TTTTATGTGTATAAATTTATGGG + Intergenic
1032552447 7:132797109-132797131 TATTTTGTGTAGAAAGTGCTGGG - Intronic
1032818123 7:135497996-135498018 GTTAATGTATATAAAGTGCTTGG - Intronic
1032950910 7:136911328-136911350 TTTTCTGTGTATTAAGTACTTGG + Intronic
1032963337 7:137066434-137066456 TTGTATTTATAAAAATTGCTAGG - Intergenic
1033826895 7:145202203-145202225 TTTTATGTGTATAAATTTATGGG + Intergenic
1035933207 8:3807373-3807395 TTGAATTTCTATAAAGGGCTTGG - Intronic
1035980226 8:4362115-4362137 TTCTATTTTTATAAAGTACTTGG - Intronic
1036547161 8:9782979-9783001 ATGTATGTATACAAAGTACTTGG - Intergenic
1036965662 8:13294917-13294939 GTTTATGTCTATAAAGTGCTTGG + Intronic
1036984064 8:13506514-13506536 GTGTATGTGTATAAAGCAGTAGG - Intronic
1037067458 8:14599807-14599829 TTGCATGTTTATAAAATGCTAGG - Intronic
1037599897 8:20385207-20385229 ATGTATGTGTATCAATTGCTTGG + Intergenic
1041568329 8:59306073-59306095 TTCTATTTGGATAAAGTTCTAGG + Intergenic
1042050036 8:64693740-64693762 GTGTATGTGTATATATTGCATGG - Intronic
1042180836 8:66086175-66086197 TTGTGTGTGTGTAAATTCCTTGG + Intronic
1043193448 8:77257076-77257098 TTGTATGTGTGTAACATGCTTGG + Intergenic
1043363754 8:79506689-79506711 TTGTATGTGTGTATTTTGCTAGG - Intergenic
1043528763 8:81126703-81126725 TTGTATGTGTGTGAAGAGTTAGG + Intergenic
1043674099 8:82927670-82927692 TTGCATTTGTATAAATTTCTGGG - Intergenic
1043750731 8:83930463-83930485 CTGTATATGTATATAGAGCTCGG + Intergenic
1043943442 8:86223179-86223201 TTGTATTTGTATAAATTAATGGG + Intronic
1045037292 8:98185510-98185532 TTGCAGGTGTATAAAGTTCATGG - Intergenic
1045492385 8:102679998-102680020 GTGTGTGTGTGTGAAGTGCTTGG - Intergenic
1046426992 8:114066926-114066948 TTTTATGTATATAAAATGATTGG - Intergenic
1046503221 8:115105637-115105659 TTGGATGTGTATATAGGTCTGGG + Intergenic
1048739034 8:137533652-137533674 TTTTATGTATAGAAAGTGTTTGG + Intergenic
1051696671 9:19775164-19775186 TTGTATGGGTAAAAACTGGTGGG - Intronic
1052552946 9:29974451-29974473 TTGAATGTGTAAAAAGTGCCTGG - Intergenic
1052590088 9:30480616-30480638 TTGTCTGGGTATAGAGTTCTAGG - Intergenic
1055375589 9:75646071-75646093 TTGTATCTGAGTAAAGTCCTGGG - Intergenic
1055507635 9:76964461-76964483 TTGAATGTGTACTAAATGCTAGG + Intergenic
1056407643 9:86290883-86290905 TTGTATGTGTATGAAGTATGAGG - Intronic
1056533858 9:87510895-87510917 TGTGATATGTATAAAGTGCTTGG + Intronic
1056849515 9:90070502-90070524 TGGGATGTGTATAAACTACTTGG + Intergenic
1058285453 9:103171254-103171276 TGGTATTTGTAGAAAGAGCTGGG + Intergenic
1059009986 9:110446770-110446792 TTAAATGAGTACAAAGTGCTTGG + Intronic
1059034112 9:110734829-110734851 ATGTATGTAGGTAAAGTGCTTGG - Intronic
1059141748 9:111859568-111859590 TTGGATGAGTATAAAATTCTAGG + Intergenic
1059529511 9:115023126-115023148 TTGCATTTTTATAAAGTCCTTGG + Intronic
1060357162 9:122920163-122920185 TTGTATTTGTGTAAATAGCTTGG + Intronic
1061332265 9:129902617-129902639 TTGTATCTGTATACGGTGCGGGG - Intronic
1061627515 9:131849767-131849789 ATGAGTGTGTATAAAGTGCATGG + Intergenic
1185569375 X:1121551-1121573 TTGCAGGTCTATAAAGGGCTTGG + Intergenic
1186507795 X:10107840-10107862 TAGTATGAGTATAAAATGGTCGG + Intronic
1186942664 X:14528000-14528022 TTGTATGTAAATAGAATGCTTGG + Intergenic
1187277003 X:17825033-17825055 TTGTATGTGTATGTACTTCTTGG + Intronic
1188680431 X:32997205-32997227 CTGTAGGTGTATAAATTTCTGGG + Intronic
1191850616 X:65583208-65583230 TTGTATACGTATGAAGTACTGGG - Intergenic
1192348648 X:70335566-70335588 TTGTATTTGTATAAATTTATGGG + Intronic
1192814072 X:74573047-74573069 TTCCATGTGTCTAAAGTGCCTGG + Intergenic
1196141428 X:112267064-112267086 CAGTATGTTTATATAGTGCTGGG - Intergenic
1196507575 X:116465501-116465523 CTGTATGTGTATACCATGCTTGG + Intergenic
1197082270 X:122433462-122433484 TTTTATTTGTATAAATTTCTGGG + Intergenic
1197809841 X:130431402-130431424 TTGTAAATGTATAAAGGGCAAGG + Intergenic
1198610908 X:138399351-138399373 TTGTATTTGTTTTATGTGCTGGG + Intergenic