ID: 1007066233

View in Genome Browser
Species Human (GRCh38)
Location 6:38992734-38992756
Sequence CTCTCAAGAAAGATGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007066230_1007066233 9 Left 1007066230 6:38992702-38992724 CCTTGTTCACTGCAGGCTGTTTC 0: 1
1: 0
2: 0
3: 48
4: 514
Right 1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG No data
1007066229_1007066233 15 Left 1007066229 6:38992696-38992718 CCTAGGCCTTGTTCACTGCAGGC 0: 1
1: 0
2: 1
3: 20
4: 218
Right 1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007066233 Original CRISPR CTCTCAAGAAAGATGAAACA GGG Intronic
No off target data available for this crispr