ID: 1007066233 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:38992734-38992756 |
Sequence | CTCTCAAGAAAGATGAAACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1007066230_1007066233 | 9 | Left | 1007066230 | 6:38992702-38992724 | CCTTGTTCACTGCAGGCTGTTTC | 0: 1 1: 0 2: 0 3: 48 4: 514 |
||
Right | 1007066233 | 6:38992734-38992756 | CTCTCAAGAAAGATGAAACAGGG | No data | ||||
1007066229_1007066233 | 15 | Left | 1007066229 | 6:38992696-38992718 | CCTAGGCCTTGTTCACTGCAGGC | 0: 1 1: 0 2: 1 3: 20 4: 218 |
||
Right | 1007066233 | 6:38992734-38992756 | CTCTCAAGAAAGATGAAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1007066233 | Original CRISPR | CTCTCAAGAAAGATGAAACA GGG | Intronic | ||
No off target data available for this crispr |