ID: 1007068693

View in Genome Browser
Species Human (GRCh38)
Location 6:39018833-39018855
Sequence AAAATCCATCTGGCCATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 238}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007068693_1007068697 17 Left 1007068693 6:39018833-39018855 CCAAAAATGGCCAGATGGATTTT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 1007068697 6:39018873-39018895 GGCAGAAGTCTCAGTGGAATAGG No data
1007068693_1007068696 11 Left 1007068693 6:39018833-39018855 CCAAAAATGGCCAGATGGATTTT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 1007068696 6:39018867-39018889 ACTGTTGGCAGAAGTCTCAGTGG No data
1007068693_1007068701 25 Left 1007068693 6:39018833-39018855 CCAAAAATGGCCAGATGGATTTT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 1007068701 6:39018881-39018903 TCTCAGTGGAATAGGTGGGGAGG No data
1007068693_1007068699 21 Left 1007068693 6:39018833-39018855 CCAAAAATGGCCAGATGGATTTT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 1007068699 6:39018877-39018899 GAAGTCTCAGTGGAATAGGTGGG No data
1007068693_1007068700 22 Left 1007068693 6:39018833-39018855 CCAAAAATGGCCAGATGGATTTT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 1007068700 6:39018878-39018900 AAGTCTCAGTGGAATAGGTGGGG 0: 1
1: 0
2: 2
3: 34
4: 210
1007068693_1007068698 20 Left 1007068693 6:39018833-39018855 CCAAAAATGGCCAGATGGATTTT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 1007068698 6:39018876-39018898 AGAAGTCTCAGTGGAATAGGTGG No data
1007068693_1007068695 -4 Left 1007068693 6:39018833-39018855 CCAAAAATGGCCAGATGGATTTT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 1007068695 6:39018852-39018874 TTTTTCAACAAGAAGACTGTTGG 0: 1
1: 0
2: 2
3: 30
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007068693 Original CRISPR AAAATCCATCTGGCCATTTT TGG (reversed) Intronic
902971862 1:20059444-20059466 AAAGACCATATGGCCATTTTAGG + Intronic
906134569 1:43488058-43488080 AAAGTGCATTTGGCCTTTTTTGG - Intergenic
906390301 1:45409579-45409601 AAATTCAATCTGGCTATTGTGGG + Intronic
907012910 1:50979454-50979476 AAAATCTTCCTGGACATTTTTGG + Intergenic
908178270 1:61578217-61578239 CAACTCCATCAGGCCATTTACGG + Intergenic
908384756 1:63630624-63630646 AAAATCAATCAGACTATTTTGGG + Intronic
908438203 1:64127876-64127898 ACAAGCCATCTGGCCGTTCTTGG - Intronic
908966402 1:69769902-69769924 AAAAACCAACTGGCCATTTTAGG + Intronic
909043093 1:70676924-70676946 AAAATCCATTTTGCCATCTATGG + Intergenic
909602284 1:77473038-77473060 AAAATCCCTTTGGCCATGTAAGG + Intronic
911333014 1:96547132-96547154 AAAATTTCTGTGGCCATTTTTGG - Intergenic
912116804 1:106417550-106417572 GAAATCCATCTTGCTTTTTTAGG - Intergenic
912563444 1:110566690-110566712 AAATCCCAGCTTGCCATTTTGGG + Intergenic
912658756 1:111510019-111510041 AAAACCCAAATTGCCATTTTGGG + Intronic
913157296 1:116112400-116112422 AAAATCCATCTGTCATCTTTTGG - Exonic
915334406 1:155132536-155132558 AAAATCCATCAGGCCATGCGCGG - Intronic
918056993 1:181030421-181030443 AAAATCCATTTGCCAATTTTTGG - Intergenic
918136843 1:181681358-181681380 AAAACCCACTTGGCCATCTTGGG + Intronic
920683598 1:208092015-208092037 CAAATCCAACTGGCCATGCTGGG + Intronic
920757198 1:208744250-208744272 AAAATCTAGATGGCCTTTTTAGG + Intergenic
921009916 1:211131575-211131597 AAAATCCATGAGCCCTTTTTTGG - Intronic
923974056 1:239239880-239239902 GAAACACATCAGGCCATTTTTGG - Intergenic
1064286722 10:13998015-13998037 AAAATCCATCATGCCCTTCTGGG + Intronic
1064702998 10:18041036-18041058 TAACTCAATCTTGCCATTTTGGG - Intronic
1065419330 10:25524478-25524500 AAAATACATCTTTCCATTTGTGG + Intronic
1065996050 10:31060381-31060403 AAAAAGCATCTGACCATATTCGG - Intergenic
1066007251 10:31156689-31156711 AAAATACAACTGGCGATTCTAGG - Intergenic
1066070001 10:31798451-31798473 AAGCTCCAACTGTCCATTTTTGG + Intergenic
1067058468 10:43065636-43065658 AAAATTAATCTGGCCACTATAGG - Intergenic
1068046922 10:51897849-51897871 AAAATCCTTCTGCCAGTTTTAGG - Intronic
1069321444 10:67176624-67176646 AAAATCCCTCTTGCCATGTCAGG - Intronic
1071032972 10:81206431-81206453 AGATTCCACCTGGCCACTTTGGG + Intergenic
1071185210 10:83035801-83035823 CAAATCCATCTTGCCATTCGTGG - Intergenic
1072329833 10:94336693-94336715 AAAATCCCTCAGTCCATTTATGG - Intronic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1074235453 10:111580456-111580478 AACTTCCACCTGGCCACTTTGGG - Intergenic
1074252705 10:111768224-111768246 AAAATCCATGCTGCCATTTTTGG - Intergenic
1075419712 10:122291778-122291800 CAAATCCCCCTGCCCATTTTAGG + Intronic
1076588283 10:131565624-131565646 AAAATCTTTGTTGCCATTTTTGG - Intergenic
1077105174 11:839099-839121 AAAACCCTTCTGGCCATGGTGGG + Intronic
1077179417 11:1205612-1205634 AAAATCCACCTGGATATTTGAGG - Intergenic
1078164371 11:8870021-8870043 ACACTGCAACTGGCCATTTTGGG - Intronic
1080273953 11:30482270-30482292 ATGATCCATCTGTACATTTTTGG + Intronic
1080353926 11:31419323-31419345 AAAATCCATCTTGACAGTTGGGG + Intronic
1081314534 11:41615514-41615536 AAATATTATCTGGCCATTTTGGG - Intergenic
1081409621 11:42741513-42741535 AAAATTGCTCTGGCCATTCTTGG + Intergenic
1084765614 11:71306286-71306308 AAAAACTAGCTGGGCATTTTGGG - Intergenic
1085586281 11:77710308-77710330 AAAATCTATTTGGCAATTTTAGG + Intronic
1085812767 11:79700375-79700397 TATATCCATCTGGTTATTTTTGG - Intergenic
1086271725 11:85075490-85075512 AAGATCTATTTGGCCATATTTGG - Intronic
1086804863 11:91227878-91227900 AGAAACCATCTGGCCATGCTTGG - Intergenic
1089434229 11:118450027-118450049 CAAATCAATCTGGTCATTTATGG + Intronic
1090658426 11:128862841-128862863 AAAGTGCATGTGACCATTTTGGG - Intronic
1090739286 11:129642639-129642661 AGAATACATGTGGCCACTTTGGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092758502 12:11787707-11787729 ATGATCCCTTTGGCCATTTTTGG - Intronic
1092961224 12:13598399-13598421 CAGATCTATCTGGCCATTGTGGG + Intronic
1093419765 12:18961996-18962018 TAAATCCTTCTGCCCCTTTTTGG + Intergenic
1093695383 12:22153975-22153997 AAGAATCATCTGGCTATTTTAGG - Intronic
1093929479 12:24940860-24940882 AAAATCTATTAGGTCATTTTGGG - Intronic
1094719664 12:33051486-33051508 ATATTCCATCTGTCTATTTTGGG - Intergenic
1095073483 12:37888179-37888201 AAAATCTGTCTAGCCATATTAGG - Intergenic
1095546552 12:43378052-43378074 GAAATCTATTTGCCCATTTTTGG - Intronic
1099275611 12:80571980-80572002 AAAATTCTTCTGGCTATTTTTGG + Intronic
1099617485 12:84955916-84955938 AATATCACTCTGGCCAATTTAGG - Intergenic
1100042090 12:90332283-90332305 AAAATCTATATAGCCAATTTTGG + Intergenic
1100157014 12:91811878-91811900 AAAATCCATCTGGCCACCAGGGG + Intergenic
1100440263 12:94610372-94610394 AAAAACCATCTAGCCCTTTTGGG + Intronic
1101744040 12:107524428-107524450 AAACTCCATCTCACCTTTTTTGG - Intronic
1103021820 12:117540389-117540411 AGAATCCATGTGTGCATTTTCGG + Intronic
1103575280 12:121872687-121872709 CAAATCCATATGGCCAGTTCTGG - Intergenic
1105702200 13:22942038-22942060 AAAAGCCAGCTGGCCACTTCTGG - Intergenic
1105854818 13:24363823-24363845 AAAAGCCAGCTGGCCACTTCTGG - Intergenic
1110153836 13:72289357-72289379 AAGATTCATTTGGCCATTGTTGG - Intergenic
1112264664 13:97912469-97912491 AGAATCCTTCTGGCCCCTTTTGG + Intergenic
1113481505 13:110625351-110625373 AAAATCCATCAGGACGCTTTCGG - Intronic
1114748947 14:25182210-25182232 AAATGCCATCTGGTCATTTGGGG - Intergenic
1116799589 14:49429163-49429185 AAAGGCCACCTGGACATTTTTGG + Intergenic
1118103683 14:62633963-62633985 CATATCCATCTGTCTATTTTTGG - Intergenic
1118274107 14:64370409-64370431 AAGATCATTCTGGCTATTTTGGG - Intergenic
1118799334 14:69174866-69174888 AGATACCACCTGGCCATTTTGGG - Intergenic
1121401197 14:93678804-93678826 AAAATCCACCTGAACATTTAAGG - Intronic
1125274148 15:37972784-37972806 AGATTCCATCTGACAATTTTTGG + Intergenic
1125560614 15:40629848-40629870 AAAATCCATGTGAAAATTTTTGG - Intronic
1126283826 15:46987888-46987910 AATTGTCATCTGGCCATTTTGGG + Intergenic
1127823316 15:62680132-62680154 AAAATCATTTTAGCCATTTTAGG + Intronic
1127888552 15:63226589-63226611 AAAATGACGCTGGCCATTTTAGG - Intronic
1129375452 15:75127359-75127381 AAAATGCCTCTGGGCATTTTGGG + Intergenic
1129404661 15:75308078-75308100 AAGACCCATGTGTCCATTTTAGG + Intergenic
1132116488 15:99139995-99140017 AAAATTATTTTGGCCATTTTGGG - Intronic
1132122483 15:99189539-99189561 GAAATCCATCTGTCCTTTTCTGG - Intronic
1133353621 16:5119731-5119753 AAAGTCCATCTGGCCAGGTGCGG - Intergenic
1136124231 16:28165566-28165588 AAAATCTATCTGGAAGTTTTGGG - Intronic
1138138636 16:54546869-54546891 AAACTCCATGTTGCCATTTTGGG - Intergenic
1138849962 16:60615883-60615905 AAGATCCATTTGGTCAGTTTTGG + Intergenic
1140595315 16:76402157-76402179 TGAATCCGTCTGGCCCTTTTTGG + Intronic
1141317024 16:82972047-82972069 AAAATCCATCTGTACATATCTGG - Intronic
1142310614 16:89310472-89310494 AAAATCCCTGTGGGCTTTTTTGG - Intronic
1143889666 17:10092975-10092997 AAAATCCGTCTTGCCATATAAGG + Intronic
1144631923 17:16878073-16878095 AAACTGCATCTGGCCATTAAGGG + Intergenic
1145833271 17:27934859-27934881 CAAATCCATCAGGCACTTTTTGG - Intergenic
1146129942 17:30263647-30263669 AGAAACCTTCTGTCCATTTTTGG + Intronic
1147604374 17:41765790-41765812 GAAATCAATCTGGCCATTTGGGG + Intronic
1149949510 17:60970673-60970695 TAAATGCATCTTGACATTTTGGG + Intronic
1150091382 17:62328827-62328849 AAAATTCATCAGGAAATTTTGGG + Intergenic
1150900550 17:69271744-69271766 AAAATCTATCTGACAATTTTAGG + Intronic
1151079711 17:71315053-71315075 ATAATCCATGAGGCAATTTTTGG + Intergenic
1151132118 17:71907918-71907940 AAAATGCCTCTGGCGATTTCAGG - Intergenic
1151800666 17:76377572-76377594 AAAATCCCTCTTGCCATATAGGG - Intronic
1159021667 18:63148023-63148045 AAAATCCATCAGTCATTTTTGGG + Intronic
1163891938 19:20024545-20024567 AGAATCCATGTGGCCAGGTTCGG + Intronic
1166651965 19:44581551-44581573 AAAAGCCATGTGGCTATCTTGGG - Intergenic
1166717750 19:44979482-44979504 AAGATCCATCTGGCTGGTTTTGG + Intronic
1167281219 19:48569982-48570004 AAAGTCCGTTTGGCCATTTGTGG + Intronic
926229804 2:10993836-10993858 AAAATCCAACTGGACATTGAGGG - Intergenic
926527042 2:13993458-13993480 ATAATCCAACTGTCCATTCTAGG + Intergenic
926910860 2:17851481-17851503 AAAAAGCATCTGGCAAATTTGGG + Intergenic
927816620 2:26223165-26223187 AACTGCCATCTGGCCACTTTGGG + Intronic
928209409 2:29312485-29312507 AGAATCCAGCTGGCCATGTGGGG - Intronic
928236844 2:29549891-29549913 AAAATCCAAAAGGACATTTTTGG + Intronic
928891767 2:36212672-36212694 AAGATTCATCTGGCCCTTGTGGG + Intergenic
929315600 2:40474413-40474435 AAAGTTAATCTGGCCATTTAAGG - Intronic
932083743 2:68739043-68739065 AACAGCCTTCTGGCCATTTGAGG + Intronic
933074171 2:77902421-77902443 AAAATTCACATGGGCATTTTTGG - Intergenic
933441205 2:82316641-82316663 AAAATCCATATGACAAATTTAGG - Intergenic
935157366 2:100495215-100495237 AAAAACCCTCTGGCCAGCTTGGG - Intergenic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
938709774 2:133966207-133966229 AACTTCCATCTGGCCATTTTGGG + Intergenic
939212476 2:139194572-139194594 AAAATTCATCTGCCTATCTTAGG + Intergenic
939279554 2:140044646-140044668 AGAAATCATCTGACCATTTTGGG - Intergenic
939338256 2:140859555-140859577 AAAATCCCACTGTCCATTATAGG - Intronic
940486334 2:154300401-154300423 AATATCTTTCTGGCCATTTCTGG - Intronic
942763813 2:179430461-179430483 AAAATTCCTCTGGTAATTTTTGG + Intergenic
944420380 2:199523834-199523856 AAAATTCATCTGGACAGATTTGG - Intergenic
944803303 2:203257332-203257354 AAATTCCATTTGGTCAGTTTGGG + Intronic
945647144 2:212511846-212511868 AGAATCCATTTTGCCTTTTTGGG + Intronic
945696285 2:213109344-213109366 AATATTCATCTTGCAATTTTAGG + Intronic
947399423 2:229715924-229715946 AAAATTCATGTGGCCATTGCAGG + Intergenic
947920275 2:233864908-233864930 AGAATCCATCTGGACACTTACGG + Intergenic
1169173003 20:3480693-3480715 AAAAAGCATCTGCCCATCTTGGG - Intronic
1170288758 20:14743761-14743783 AAAGTCCATTTTGCCATTTAAGG - Intronic
1170828172 20:19814911-19814933 AAAATCCACTTGGCCATTTCTGG + Intergenic
1172967087 20:38844368-38844390 AAGATCCATTTGCCCTTTTTAGG + Intronic
1173299311 20:41787105-41787127 AAAATCCATCTGTCTATTGATGG + Intergenic
1173574080 20:44098954-44098976 AAACTCCATCTTGCCATGCTGGG - Intergenic
1177311552 21:19401140-19401162 AATATCCATAGGGCCCTTTTAGG - Intergenic
1178694070 21:34778172-34778194 CAAATCCACCTAGACATTTTAGG + Intergenic
1180182123 21:46122775-46122797 AAAATCGATCTGGCATTTTGGGG - Intronic
1181235233 22:21444529-21444551 TAAAGCCATCTGGTCATTTTTGG + Intronic
1184800913 22:46758717-46758739 AAACTCCCTTTGGCCATTTAAGG - Intergenic
1185196666 22:49475099-49475121 AAATTCCATCAGGCCATTCTCGG + Intronic
949357540 3:3197867-3197889 AAACTCCCTCTTGCCATTTAAGG + Intergenic
949614728 3:5740488-5740510 AATATTGATCTGGCTATTTTTGG - Intergenic
949634380 3:5967029-5967051 AATATTCCTCTGGCCATTTTTGG - Intergenic
950809992 3:15641964-15641986 AACATCCATTTATCCATTTTTGG + Exonic
952618628 3:35307553-35307575 AAGATCCATATGGCCAGTTCTGG - Intergenic
953094602 3:39762576-39762598 AAAAACAATCTGGCCAGTCTTGG - Intergenic
953473475 3:43185923-43185945 ACAATACATCAGGGCATTTTGGG + Intergenic
953594357 3:44294763-44294785 AAAATTCATTTGACTATTTTGGG - Intronic
954482004 3:50808317-50808339 AAAATCCAGCAGGCTTTTTTTGG + Intronic
955443761 3:58985073-58985095 AAAAATCAGCTGGCCATTGTGGG - Intronic
959241322 3:103798463-103798485 AAACTACTTCAGGCCATTTTGGG - Intergenic
959357126 3:105345879-105345901 AAAATCCATTTAGGCATTTATGG - Intergenic
960313395 3:116145232-116145254 AAATTCTATCAGGCCATTTTTGG + Intronic
960377128 3:116916861-116916883 AAAATTCATTTGACCATATTTGG - Intronic
961295886 3:125884007-125884029 AAAGTCCATCTGGCCAGGTGCGG + Intergenic
961611393 3:128142718-128142740 AAGACTCAACTGGCCATTTTTGG - Intronic
965224717 3:165973126-165973148 AATATCCCTCTTGTCATTTTTGG + Intergenic
965703058 3:171478260-171478282 AAAATCCATTTAGCCCTTTGGGG - Intergenic
965743523 3:171901436-171901458 AAAAGCATTCTGGTCATTTTGGG + Intronic
966093246 3:176165911-176165933 ATAATCCATGTATCCATTTTAGG + Intergenic
969753625 4:9132532-9132554 AAAGTCCATCTGGCCAGGTACGG + Intergenic
969978610 4:11130883-11130905 AAAAGCCAGCTTGGCATTTTCGG - Intergenic
970962122 4:21884461-21884483 TCCATCCATCTGGCCATCTTGGG - Intronic
972345208 4:38187094-38187116 AAAATCCCACTGGGCATCTTGGG - Intergenic
974420902 4:61672117-61672139 AAAATTGATCTGGGCAATTTTGG - Intronic
976114375 4:81711256-81711278 AAAATCAGTCTGGCCATCTCCGG + Intronic
977090127 4:92662334-92662356 AGAATCCTTTTGGTCATTTTTGG - Intronic
977567081 4:98591894-98591916 AAAATTCTTTTGGCTATTTTTGG - Intronic
979835333 4:125359977-125359999 AAAATCCATCTAGGGAATTTGGG - Intronic
982081440 4:151794019-151794041 AAGATTCATATGGCCAGTTTAGG - Intergenic
982962807 4:161861583-161861605 AAAATCCAGCAGTCCAATTTTGG + Intronic
984155526 4:176191803-176191825 AATATCCATCTCACAATTTTAGG + Intronic
984343928 4:178495828-178495850 AAAATCTATTTTGCCATTTAGGG - Intergenic
988005033 5:25399369-25399391 AAAATCAAGTTGGACATTTTTGG - Intergenic
988087934 5:26495814-26495836 AAAATGCAAATGGCCCTTTTTGG + Intergenic
989298127 5:39853828-39853850 AAAATCTAGTTTGCCATTTTTGG - Intergenic
989408916 5:41094691-41094713 AAAAATCCTCTGGCCATTTCAGG + Intergenic
990184716 5:53200894-53200916 AAAATCCACATGGCCTCTTTTGG + Intergenic
990795547 5:59535872-59535894 AAAGTCCATCTAGCGATTTTAGG - Intronic
992819731 5:80484357-80484379 AAAATCCATCTGGCCAGGCATGG - Intergenic
993402450 5:87470484-87470506 AAAATTCTTTTGGCTATTTTTGG + Intergenic
993570808 5:89536562-89536584 AATATCCATCTGGTAATTGTAGG - Intergenic
995510763 5:112906854-112906876 GAAATCCAAATGGCCAGTTTGGG + Intronic
995714012 5:115063885-115063907 AGAATCCATCGGGCCATGTGAGG + Intergenic
997573877 5:134957802-134957824 AAAATCCATTTGACCATGTATGG - Intronic
998083022 5:139292678-139292700 AAAAACCAGCTGGCCACTTTGGG + Intronic
998123320 5:139597466-139597488 AAGATCCATCAGTCCATTTCAGG - Intronic
998514553 5:142741031-142741053 AAAATCCAGATGGCAATTTCTGG - Intergenic
999206611 5:149852947-149852969 AAAATCCAACTGCCCAAATTTGG + Exonic
999937662 5:156505114-156505136 CTAATCCATCTGTCTATTTTGGG + Intronic
1000023197 5:157336768-157336790 AAAAGCCATGTGGGCAGTTTAGG - Intronic
1000201580 5:159015982-159016004 AAAATCCATATGCCCATATCTGG + Intronic
1000414135 5:160965592-160965614 GAAATTTATCTGGCAATTTTGGG - Intergenic
1000498566 5:162019059-162019081 AAAAGTCATATGGACATTTTTGG - Intergenic
1000918789 5:167114105-167114127 AAAATCGATGTGGCTCTTTTTGG - Intergenic
1001880288 5:175237723-175237745 ATAAGCCTTCTGCCCATTTTAGG - Intergenic
1002555403 5:180034154-180034176 AAAAGCCAACTAACCATTTTCGG - Intronic
1003392358 6:5724845-5724867 GAAATACATCTGCCCCTTTTTGG + Intronic
1003497484 6:6677228-6677250 AAAATGCAGCTGCACATTTTAGG + Intergenic
1004885845 6:20050777-20050799 AAAATCCAGCTGGATATTTGTGG + Intergenic
1005839617 6:29733908-29733930 AAAATCCATCTCGCTGTCTTAGG - Intronic
1005991111 6:30902784-30902806 AAAATCCTTCTGGCCAAGGTTGG + Intergenic
1006203830 6:32321507-32321529 AAAATCCATATGCCCATGTTTGG - Intronic
1007068693 6:39018833-39018855 AAAATCCATCTGGCCATTTTTGG - Intronic
1009918674 6:70028764-70028786 AAAATCCATGAGGTAATTTTGGG - Intronic
1010406798 6:75515268-75515290 AACTGCCACCTGGCCATTTTGGG - Intergenic
1011167121 6:84461373-84461395 ATAAGCCATCTGGCCTCTTTAGG - Intergenic
1014076245 6:117238535-117238557 AAAATCCATTTTGTCATTTTTGG + Intergenic
1015275739 6:131381831-131381853 AAAATCCATCTGGGAAATTAGGG - Intergenic
1015403470 6:132812764-132812786 GAAATCCTTCTTGCCTTTTTTGG - Intergenic
1015473141 6:133629103-133629125 AAGAACCACCTGGCCACTTTGGG + Intergenic
1015844475 6:137505491-137505513 GACTACCATCTGGCCATTTTGGG - Intergenic
1016098752 6:140071085-140071107 AAAATCACACTGTCCATTTTGGG - Intergenic
1016245610 6:141976874-141976896 ATAATCCAACTTGCCCTTTTTGG + Intergenic
1022623530 7:32010178-32010200 AAAATTGATTTGGCTATTTTAGG - Intronic
1023083370 7:36546323-36546345 AAAATCCATTTGCTCATTTTGGG + Intronic
1025242128 7:57285853-57285875 CAAATCCTTCCGGCCATTTCAGG + Intergenic
1026114561 7:67485389-67485411 AAGATCAGTGTGGCCATTTTTGG - Intergenic
1030935427 7:115580227-115580249 AAAGTCCCTCTTGCCATTTAAGG - Intergenic
1032137938 7:129298583-129298605 AAAATCCTTCTGGGAATTTTAGG - Intronic
1034570873 7:151955421-151955443 AAACTCCAGTTGGCCATATTGGG + Intergenic
1034845962 7:154444996-154445018 AAAATTCATGGGGCCATTATAGG - Intronic
1036031714 8:4981228-4981250 ACAATCTATTTGGCCATTTTAGG + Intronic
1037831601 8:22192907-22192929 AATATCCGTCTGGCTGTTTTAGG - Intronic
1039379447 8:37071288-37071310 CAAATCCAGCTCCCCATTTTGGG + Intergenic
1040845071 8:51829399-51829421 AAAAAGCAGCTGGCCATGTTTGG + Intronic
1043764815 8:84117627-84117649 AAAATACATTTGACAATTTTTGG + Intergenic
1045147507 8:99363430-99363452 AAAATTGGTTTGGCCATTTTGGG + Intronic
1045694352 8:104791466-104791488 AAAATCCAACTGCTCATGTTTGG - Intronic
1045701070 8:104866674-104866696 ACAATCCATCGGACCATATTTGG - Intronic
1045779313 8:105845491-105845513 CAAATCCATCAGGTCATTTAAGG + Intergenic
1045874944 8:106969820-106969842 AAAATTGCTGTGGCCATTTTCGG - Intergenic
1046411685 8:113852455-113852477 AAAATCAATCTGTGCATTTATGG - Intergenic
1047540425 8:125759947-125759969 AAAATAGATCTGTCAATTTTGGG + Intergenic
1048584115 8:135756796-135756818 AATATCCATCTTGCCCTTCTGGG + Intergenic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1048967156 8:139623593-139623615 AAAATCCACCTGGGCATGTGTGG - Intronic
1050198684 9:3116414-3116436 AAAATTAATTTGGCTATTTTGGG + Intergenic
1050242581 9:3652777-3652799 AAAATTCATTTGTCCATTGTTGG + Intergenic
1052139520 9:24961957-24961979 AAACTCCCTCTGCTCATTTTTGG + Intergenic
1053262689 9:36683694-36683716 TAAATCCAGCTAACCATTTTTGG + Intergenic
1055649722 9:78395519-78395541 AGAAACCATCTGGCAATTATAGG + Intergenic
1056895464 9:90543589-90543611 AAAATCCATTGGTCCATCTTGGG - Intergenic
1057300082 9:93873023-93873045 AAAATCCATCTTGGCATGTAAGG + Intergenic
1058323522 9:103664801-103664823 ACAATCCATCTGTTCTTTTTTGG - Intergenic
1058382595 9:104394391-104394413 AAAATCTATCTATACATTTTGGG + Intergenic
1060120604 9:120986044-120986066 AAAATCCCTCTGGCCAGCCTAGG + Intronic
1060689525 9:125644403-125644425 AAAATTAATTTTGCCATTTTGGG - Intronic
1186166728 X:6834563-6834585 AAAGTCCTTCTGGCCATGTAAGG - Intergenic
1187962947 X:24583973-24583995 CAAATCCTTATGGCAATTTTAGG + Intronic
1188038913 X:25349515-25349537 GCAATCCATCTGCCCATTGTTGG - Intergenic
1188290542 X:28382304-28382326 AAAGTCCATTTTGCCATATTTGG + Intergenic
1188879879 X:35479087-35479109 AAAATCCATATGACCATCTGAGG - Intergenic
1197886119 X:131220123-131220145 AAGATCCATCTGGCCACTGTGGG + Intergenic
1198248078 X:134850938-134850960 AAAATTCATTTGGCCATTTTTGG + Intronic
1199346845 X:146750801-146750823 AAAAATAATCTGACCATTTTAGG - Intergenic