ID: 1007070577

View in Genome Browser
Species Human (GRCh38)
Location 6:39035115-39035137
Sequence CATGGTAACCAGAAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007070575_1007070577 -8 Left 1007070575 6:39035100-39035122 CCAGTAGGTGCATTGCATGGTAA No data
Right 1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007070577 Original CRISPR CATGGTAACCAGAAGGAGCA TGG Intergenic
No off target data available for this crispr