ID: 1007073471

View in Genome Browser
Species Human (GRCh38)
Location 6:39052576-39052598
Sequence ACACTGGCTGCCAATCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007073471_1007073486 27 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073486 6:39052626-39052648 TTGGAAAGCCCACCACCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1007073471_1007073479 8 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073479 6:39052607-39052629 GGAGCCCCTTCCTGGGGTGTTGG 0: 1
1: 0
2: 9
3: 36
4: 287
1007073471_1007073477 1 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073477 6:39052600-39052622 TGGAGAGGGAGCCCCTTCCTGGG No data
1007073471_1007073484 25 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073484 6:39052624-39052646 TGTTGGAAAGCCCACCACCCCGG No data
1007073471_1007073485 26 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073485 6:39052625-39052647 GTTGGAAAGCCCACCACCCCGGG No data
1007073471_1007073476 0 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073476 6:39052599-39052621 TTGGAGAGGGAGCCCCTTCCTGG No data
1007073471_1007073478 2 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073478 6:39052601-39052623 GGAGAGGGAGCCCCTTCCTGGGG No data
1007073471_1007073487 28 Left 1007073471 6:39052576-39052598 CCTTTCAGATTGGCAGCCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1007073487 6:39052627-39052649 TGGAAAGCCCACCACCCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007073471 Original CRISPR ACACTGGCTGCCAATCTGAA AGG (reversed) Intronic
906073451 1:43034689-43034711 ACAGTAGCTGCCAACCTTAAAGG - Intergenic
906521831 1:46471403-46471425 AAATTGGCTGCCTGTCTGAATGG - Intergenic
907357520 1:53888692-53888714 ATACTCGTTACCAATCTGAAGGG + Intronic
907772195 1:57476554-57476576 ACATTGGCAGCCAATGTGAAGGG + Intronic
911782729 1:101903182-101903204 ACACTGGAGTCCAGTCTGAATGG + Intronic
912175712 1:107153790-107153812 ACTATGGCTGGCAATCTGATTGG + Intronic
915777273 1:158503316-158503338 ACAGTGGTTGCCAGTCTGCAGGG - Intergenic
916260664 1:162839015-162839037 ACAGTGCCAGCCAAGCTGAAGGG - Intronic
916421979 1:164646076-164646098 ACACAAGATGCGAATCTGAAGGG + Intronic
921747202 1:218752314-218752336 TGACTGGCTGCCAATCTGGAGGG + Intergenic
1069585133 10:69594872-69594894 ACACTGACTTCTCATCTGAATGG - Intergenic
1070704793 10:78629864-78629886 ACGATGGGTGCCCATCTGAAAGG + Intergenic
1071132210 10:82407688-82407710 ACTCTGCCAGGCAATCTGAATGG + Intronic
1077005881 11:355935-355957 ACACTGGCTGCCACGCGGGACGG + Intergenic
1077126447 11:940775-940797 CCAGTGCCTGCCAACCTGAAGGG + Intronic
1077739603 11:4830811-4830833 GCACTGGTCACCAATCTGAAGGG + Intronic
1080361868 11:31524356-31524378 CCTCTGGCTGCCAATCAGCAAGG - Intronic
1083908513 11:65690563-65690585 ACCCAGGCTGCCATTGTGAAAGG + Intergenic
1084305243 11:68278409-68278431 ACACTGGCTACAAATCAGAGGGG + Intergenic
1086856820 11:91875504-91875526 ATGCTGTTTGCCAATCTGAAAGG + Intergenic
1088909377 11:114179360-114179382 ACACTGGCTGCCAATTCCAAAGG - Intronic
1094479132 12:30866493-30866515 CCACTGGCTGCTAATCTGATGGG + Intergenic
1097970619 12:65629492-65629514 AAACTGGATGCCAATGTCAAAGG + Intergenic
1099150873 12:79111768-79111790 ACACTGGATGCAGAACTGAAAGG - Intronic
1106527355 13:30553164-30553186 ATAATGGTTGCCAATTTGAAAGG + Intronic
1107341857 13:39415825-39415847 AAACTGGCTGCAAATGAGAAAGG - Intronic
1107916967 13:45162276-45162298 CCACTAGCTGCCAAAGTGAATGG - Intronic
1110004743 13:70251657-70251679 TTACTGGCTGCCTATCTGTATGG - Intergenic
1113069807 13:106409486-106409508 AGACTGGCTTCCTGTCTGAAAGG - Intergenic
1116007336 14:39308858-39308880 ATACTGGCAGGGAATCTGAATGG + Intronic
1116037664 14:39647293-39647315 ACACTGGCTATCCATCTAAATGG - Intergenic
1119186278 14:72644945-72644967 ACATTGTCTTCCAATCTGCATGG + Intronic
1120242621 14:81966836-81966858 AGACTGGCTGCCCACCTTAAGGG + Intergenic
1121282667 14:92710525-92710547 AGACTGGCTCCCAATCAGAAGGG + Intronic
1122225879 14:100279041-100279063 ACACTGGGTGCAAATCGGCAAGG + Exonic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1127701327 15:61504431-61504453 GCACTTGCTGCGATTCTGAATGG + Intergenic
1133981587 16:10636592-10636614 ACAGTCTCTGTCAATCTGAAAGG - Intronic
1143923964 17:10353036-10353058 TCACAGGCTGCCAAACTGATGGG + Intronic
1149641492 17:58205845-58205867 ACAGTGGCTGCAAATATAAAGGG + Exonic
1154071949 18:11160710-11160732 ACAATGGCTTCCTTTCTGAAAGG - Intergenic
1154193137 18:12246799-12246821 ACACTGGCGGCAAGTCTGCAGGG + Intergenic
1155404961 18:25477731-25477753 TTCCTGGCTGCCAATCTCAATGG + Intergenic
1156387905 18:36623204-36623226 ACACTGTGTGCCTCTCTGAAAGG + Intronic
1157481473 18:48057796-48057818 ACACTGGCTGTCTATCTCATGGG + Intronic
1159218477 18:65428427-65428449 ACTCTGGCTGCCACTCTGGAGGG + Intergenic
1159275470 18:66215021-66215043 CCACTGGCTGCCAAAATGAATGG - Intergenic
1160325588 18:77944607-77944629 AGGCTGGCAGACAATCTGAATGG - Intergenic
1162210361 19:9086674-9086696 ACATTGGCTTCCAATAAGAATGG + Intergenic
1164709998 19:30349209-30349231 ACACTGTCTGCAAAGCAGAAAGG - Intronic
927802014 2:26109613-26109635 ATACTGGATGAAAATCTGAAAGG - Intronic
928400194 2:30972231-30972253 ACAATGGCTCCGAATCTTAAAGG + Intronic
928950470 2:36808964-36808986 GCCATGGCTGCCCATCTGAAGGG + Exonic
933301383 2:80545046-80545068 ACACAGGCTGTCAATCTGGGTGG - Exonic
937295063 2:120805132-120805154 ACACTCACTGCCACTCAGAACGG + Intronic
938196706 2:129334921-129334943 ACAGTGACTGCCACTCAGAAAGG - Intergenic
939043669 2:137223539-137223561 ACCCTGACTACCAAGCTGAAAGG + Intronic
940099113 2:150013297-150013319 ACAGGGGGAGCCAATCTGAATGG + Intergenic
941195389 2:162444282-162444304 ACAGTGGCTGTCACTTTGAAGGG + Intronic
944904897 2:204252528-204252550 AGACTGGCTGGCAAGCTGACAGG - Intergenic
945813992 2:214581628-214581650 ACAGTGTCTGCCACTCAGAAGGG - Intergenic
947074122 2:226323235-226323257 ACAATGGCTGCATATCTCAAAGG + Intergenic
948659222 2:239496912-239496934 ACACTGGCTGACTTTCAGAAAGG - Intergenic
1169251626 20:4065319-4065341 ACACTGGCTGGCCATGGGAAGGG - Intergenic
1169949681 20:11029979-11030001 ACACTGGGTCACAATCTAAACGG + Intergenic
1172591947 20:36123922-36123944 ACTCTGGCTGCCACTTGGAAAGG - Intronic
1173394585 20:42667410-42667432 ACAGTGGCTGCCAATTTGAGGGG - Intronic
1174991498 20:55515482-55515504 ACACTGGCTGGGAAGCAGAATGG + Intergenic
1175571329 20:60024985-60025007 AGGCTGGCTGCCGACCTGAAGGG + Intronic
1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG + Intronic
1179831299 21:43998340-43998362 ACACTGCCCTCCAATTTGAAGGG + Intergenic
1183169823 22:36179709-36179731 ACACTGTCTCTTAATCTGAAAGG + Intergenic
1184666277 22:45990752-45990774 ACCCTGGCTGCCCACCTGAAGGG - Intergenic
1184848139 22:47101693-47101715 GCACTGGAGGCCAATGTGAAGGG + Intronic
951318966 3:21222222-21222244 CCAATGACTGCCAATCTGATGGG + Intergenic
952856687 3:37777237-37777259 ACAATGGCTGAAAAGCTGAAAGG - Intronic
954898061 3:53994410-53994432 ACACTGGCCTCCATGCTGAAGGG - Intergenic
955786105 3:62540614-62540636 ACACAGGCAGACAATCTGAATGG - Intronic
955993859 3:64657789-64657811 ACAGTGGCTGCCACTGGGAAGGG + Intronic
957961457 3:87259054-87259076 ACAATGGCTACAAATGTGAATGG - Intergenic
957986823 3:87582526-87582548 AGGCTGGCGGACAATCTGAAGGG - Intergenic
958474535 3:94564180-94564202 ACACTTGTTGCAGATCTGAAAGG + Intergenic
959234937 3:103708489-103708511 AAACTGGCTGCCCATGTGAGAGG + Intergenic
962061469 3:131932194-131932216 ACACATGCTGACAATTTGAAAGG + Intronic
962406401 3:135104176-135104198 TCACTGGCTGCAGAACTGAATGG + Intronic
962473983 3:135739852-135739874 TCTCTGGCTGCCAATGTGAAAGG + Intergenic
963068008 3:141279200-141279222 GCCCTGGCTGCCATTCTGGATGG - Intronic
963269331 3:143270153-143270175 ACAACAGCTGCCCATCTGAAAGG - Intronic
963287868 3:143453901-143453923 ACATTGGGTGCCCATATGAAAGG + Intronic
964368093 3:155970752-155970774 AGACTCGCAGACAATCTGAAAGG - Intergenic
965493089 3:169363819-169363841 ACAATGGCAGACACTCTGAATGG + Intronic
966703435 3:182882976-182882998 ATAATGGATGCCAATCTGACAGG - Intronic
967780972 3:193438947-193438969 ACACTGGCAGCTACTCTAAAGGG + Intronic
968607645 4:1543035-1543057 ACCCTGGCTCCCCATCTGAGGGG - Intergenic
972106607 4:35495309-35495331 ACACAGCCTGCCAGGCTGAATGG + Intergenic
975943678 4:79678787-79678809 CCACTGGTTGCCAAACTGCAGGG - Intergenic
978512107 4:109531665-109531687 ACACTGGCTGTGGATCTGATTGG + Intronic
985553962 5:547118-547140 ACAATGGCTGCCAGGCTGACTGG + Intergenic
987820836 5:22964283-22964305 ACACTGAGTGCCAACCTGATTGG - Intergenic
988448967 5:31320574-31320596 ACACTGGCAACCAGTATGAAAGG + Intronic
989691939 5:44154811-44154833 ACCCTGGCTGCCATTGTAAATGG - Intergenic
991065353 5:62418604-62418626 CCACTAACTGCCAATCTAAAAGG - Intronic
991930424 5:71748556-71748578 ACACTGGCTGCCTGCCAGAAAGG - Intergenic
994451962 5:99955095-99955117 GCACAGGCTGCCAGGCTGAATGG - Intergenic
994688271 5:102983852-102983874 ACACTGTCTCCCGATCTGTAAGG - Intronic
998421786 5:141994214-141994236 ACTTTGGCTGCCACTCTGAGAGG + Intronic
998827733 5:146121368-146121390 CCAAATGCTGCCAATCTGAATGG + Intronic
1001645867 5:173281922-173281944 ACACTGGCTGAAAATATAAATGG - Intergenic
1004045699 6:12020713-12020735 ACACTGACTTCCAATCTTAAAGG - Intronic
1004869314 6:19888750-19888772 ACACTGGCTGCCATGCTGTAGGG - Intergenic
1007073471 6:39052576-39052598 ACACTGGCTGCCAATCTGAAAGG - Intronic
1007286745 6:40753332-40753354 ACACTGCCTGTCAGTCTCAAGGG - Intergenic
1007570705 6:42888574-42888596 ACACTATCTGCCACTATGAAGGG - Exonic
1008205084 6:48645523-48645545 ACATTGGCTGCCCATAAGAATGG - Intergenic
1013494716 6:110687150-110687172 GCACTGGCTGAGGATCTGAAGGG + Intronic
1013673816 6:112434842-112434864 ACACTGGCTCCCAATTTATATGG - Intergenic
1016915854 6:149243949-149243971 ACACTGGATGCCACACTGGATGG - Intronic
1018114781 6:160572768-160572790 AAACTGGCTGTTAATCTGATAGG + Intronic
1018309759 6:162495650-162495672 ACACTGGCAGAGAATCTGCAAGG - Intronic
1019005626 6:168794206-168794228 ACACTGGATGCCAAGATGAATGG - Intergenic
1019183856 6:170209560-170209582 ACACGGGCTGCCCCTCGGAATGG - Intergenic
1024741364 7:52358465-52358487 ACTCTGGATGCAAATGTGAACGG + Intergenic
1024756566 7:52540182-52540204 ATACTGCCTGCCCATGTGAAAGG - Intergenic
1024770502 7:52715978-52716000 ACACTGGCTGGCAAAGAGAAGGG + Intergenic
1026464326 7:70640939-70640961 ACACTGGCTGCCATGTGGAACGG - Intronic
1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG + Intergenic
1028955911 7:96690095-96690117 ACTCTTGCTGCCAATCTTGAGGG + Intronic
1030324561 7:108205506-108205528 ACTCTGGCTGCCAAGCTTGAGGG + Intronic
1030432279 7:109465613-109465635 ACACTGGCTGTCCATCAGGAAGG + Intergenic
1031647923 7:124249960-124249982 AAAGTGGCTGCCATTCTGACAGG - Intergenic
1031809919 7:126353646-126353668 CCACCAGCTGACAATCTGAAGGG - Intergenic
1032210628 7:129910912-129910934 ACTCTGGCAGCCAAGATGAAAGG + Intronic
1032609155 7:133392399-133392421 ACACTGCCTCCCAAACAGAAAGG - Intronic
1033262084 7:139852703-139852725 AAACTGTCTGCCAAGCTCAAAGG + Intronic
1034635533 7:152564473-152564495 ACACAGACTGCCAGTGTGAACGG + Intergenic
1044336135 8:90985827-90985849 ACACAGACTGCCATCCTGAAAGG + Intergenic
1047281225 8:123447918-123447940 ACACTGGCTGCAAAGGAGAATGG - Intronic
1048541513 8:135346122-135346144 ACTCTGGCTGGGGATCTGAAAGG + Intergenic
1048744540 8:137599329-137599351 ACATGGGCTGCCAATATGTAAGG + Intergenic
1055595024 9:77857424-77857446 ACACTGTATTCCAATCTAAAAGG + Intronic
1060791516 9:126488757-126488779 ACACTGGCTGCAGTTCTGGAAGG - Intronic
1060861340 9:126957217-126957239 ACACCCTCTGCCCATCTGAAGGG - Intronic
1061609140 9:131734666-131734688 ACAATGACTGCCAATCTAAGAGG + Intronic
1062556489 9:137115299-137115321 ACACTGGGTGCCAGTCGGAAGGG - Intergenic
1186409106 X:9330416-9330438 TCACAGGCTGCAAAACTGAAGGG + Intergenic
1189612609 X:42753193-42753215 ACACTGGCTGTAAATGTCAAAGG - Intergenic
1190136342 X:47802727-47802749 ACCCAGGCTGCCAGTGTGAAAGG + Intergenic
1190338410 X:49277259-49277281 ACAATGGCTGCCAAGCTGATAGG - Intronic
1192534369 X:71914651-71914673 ACTCTGGCTCCAAATCAGAAAGG + Intergenic
1192615211 X:72613410-72613432 ACACTGACTGCCCATGAGAAGGG + Intronic
1194482373 X:94442071-94442093 AGCCTGGCTGCCATTCTTAAAGG - Intergenic
1194545359 X:95226895-95226917 ACACTGACTGGCAAAATGAATGG + Intergenic
1195322031 X:103728231-103728253 AGCCTGGCTGCCAATGTGAGAGG + Exonic
1196097209 X:111813304-111813326 ACAGGAGCTGACAATCTGAAAGG - Intronic
1196783456 X:119402569-119402591 GCACTGGCTGCCAACCTGTTAGG + Intronic
1198141084 X:133804265-133804287 AACCTGGCTGCAAATCGGAATGG + Intronic