ID: 1007074192

View in Genome Browser
Species Human (GRCh38)
Location 6:39056410-39056432
Sequence TTTCTGCACCGTCTCCCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007074192_1007074197 20 Left 1007074192 6:39056410-39056432 CCCTCTGGGAGACGGTGCAGAAA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1007074197 6:39056453-39056475 GTGCCAGCGCTCCCTGACTGAGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007074192 Original CRISPR TTTCTGCACCGTCTCCCAGA GGG (reversed) Exonic