ID: 1007074193

View in Genome Browser
Species Human (GRCh38)
Location 6:39056411-39056433
Sequence ATTTCTGCACCGTCTCCCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007074193_1007074197 19 Left 1007074193 6:39056411-39056433 CCTCTGGGAGACGGTGCAGAAAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1007074197 6:39056453-39056475 GTGCCAGCGCTCCCTGACTGAGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007074193 Original CRISPR ATTTCTGCACCGTCTCCCAG AGG (reversed) Exonic