ID: 1007074197

View in Genome Browser
Species Human (GRCh38)
Location 6:39056453-39056475
Sequence GTGCCAGCGCTCCCTGACTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007074190_1007074197 29 Left 1007074190 6:39056401-39056423 CCACTGTGTCCCTCTGGGAGACG 0: 1
1: 0
2: 0
3: 21
4: 253
Right 1007074197 6:39056453-39056475 GTGCCAGCGCTCCCTGACTGAGG 0: 1
1: 0
2: 1
3: 10
4: 159
1007074193_1007074197 19 Left 1007074193 6:39056411-39056433 CCTCTGGGAGACGGTGCAGAAAT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1007074197 6:39056453-39056475 GTGCCAGCGCTCCCTGACTGAGG 0: 1
1: 0
2: 1
3: 10
4: 159
1007074192_1007074197 20 Left 1007074192 6:39056410-39056432 CCCTCTGGGAGACGGTGCAGAAA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1007074197 6:39056453-39056475 GTGCCAGCGCTCCCTGACTGAGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007074197 Original CRISPR GTGCCAGCGCTCCCTGACTG AGG Exonic