ID: 1007077528

View in Genome Browser
Species Human (GRCh38)
Location 6:39077459-39077481
Sequence ATGTGCTGAGAGAACTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007077528 Original CRISPR ATGTGCTGAGAGAACTCAGA AGG (reversed) Intronic
900585237 1:3429448-3429470 ATGTGCTGTGAGATCTCATCTGG - Intronic
902835071 1:19041908-19041930 GTGTGCTTTGAGCACTCAGAAGG + Intergenic
902925940 1:19695713-19695735 AGGTGCTCAGAGACCACAGAGGG - Intronic
906276944 1:44523718-44523740 ATGTGCTGAGGCAGCTCAGAGGG + Intronic
906548714 1:46642479-46642501 ATGTGCAGAGAGAACACAGTGGG + Intronic
906768538 1:48460379-48460401 ATGTTCTCAGCAAACTCAGAAGG + Intronic
907743234 1:57187307-57187329 ATGTTGTTAGATAACTCAGATGG - Intronic
910246938 1:85149058-85149080 GTGTGGTGAGAGAATGCAGAAGG - Intergenic
910343073 1:86209913-86209935 ATGTGCTGAGAAAACTTAATGGG + Intergenic
912533387 1:110342178-110342200 AACTGCTGGGAGAACTCACAAGG - Exonic
917004143 1:170394023-170394045 ATGTACTGTGGGAACCCAGAAGG - Intergenic
917507695 1:175643126-175643148 ATGCACTGAGGGAACCCAGAAGG + Intronic
918107074 1:181424665-181424687 ATGCCCTGAGAGAAAGCAGAGGG + Intronic
918549541 1:185726143-185726165 ATATGCTTAAAGTACTCAGATGG + Intergenic
918718943 1:187827732-187827754 ATGTGCTCTGAGAACTTGGATGG + Intergenic
918752602 1:188291052-188291074 ATGTTCTGGGAGAACACAGGGGG - Intergenic
922254321 1:223879264-223879286 CTGTAATGAGAGAAATCAGATGG - Intergenic
922364585 1:224851923-224851945 GTGAGCTGAGAGGACTCAGGAGG - Intergenic
922466416 1:225847986-225848008 GTGTGCAGAGAGAACTAGGAAGG + Intronic
923951879 1:238964758-238964780 ATGTGCTGAGACTACTTAGCAGG - Intergenic
1063980987 10:11451706-11451728 AAGTGGTGAGAGAACTCAGAGGG - Intergenic
1064068900 10:12208305-12208327 AGAGGCTGAAAGAACTCAGAGGG - Intronic
1064766726 10:18682888-18682910 ATGTGTTGACAGAAGCCAGATGG - Intergenic
1064863282 10:19850854-19850876 CTGTGCTGTTGGAACTCAGAGGG + Intronic
1067910103 10:50337949-50337971 ATATGCTGAGAGAACTAGGATGG - Intronic
1068883586 10:62075958-62075980 ATGTGCAGAGAGCACTCTCAGGG + Intronic
1071481949 10:86071211-86071233 CTGTGCTGAGAGAGCTCACTGGG + Intronic
1072215547 10:93284675-93284697 GAGAGCTGAGAGAACTCAGGTGG + Intergenic
1072916195 10:99538682-99538704 AGGTGCTGACAGAGCCCAGAGGG - Intergenic
1073042305 10:100615851-100615873 ATGTGCTGAGAGCACTTAGGAGG - Intergenic
1073922013 10:108470207-108470229 ATGTTGTGAGAGGAATCAGATGG - Intergenic
1079862173 11:25686879-25686901 AGGTGATGTGAGAAGTCAGAAGG - Intergenic
1083149493 11:60783211-60783233 ATGTGGAGAGAGAAGCCAGATGG + Intergenic
1083445714 11:62706852-62706874 ATGTGCTGTGGGGACTCTGAGGG - Intronic
1085815044 11:79728230-79728252 AGCTGCTTAGAGAACTCATAGGG - Intergenic
1086157943 11:83688733-83688755 AATTTCTGAGAAAACTCAGAAGG + Intronic
1087437229 11:98136604-98136626 ATGTGCAGAAAGACCTGAGAGGG - Intergenic
1088474245 11:110218855-110218877 ATGAGCTCTGAGAGCTCAGAAGG - Intronic
1088935107 11:114391767-114391789 ATGTGCTGACAAAATTCAGTGGG + Intronic
1090388353 11:126369835-126369857 ATGTGAATAGAGTACTCAGAAGG - Intronic
1091620184 12:2081634-2081656 CTGTGCTGAGAGAACTACCAAGG + Intronic
1091891367 12:4057266-4057288 ATGTGCAGTGGGAAGTCAGAAGG + Intergenic
1092675089 12:10907888-10907910 ATGTGTTGAGAGAATTGAGAGGG - Intronic
1092710633 12:11333500-11333522 ATGGACTTAGGGAACTCAGAGGG - Intergenic
1093360380 12:18219019-18219041 CAGTGCTGAGAAAACTGAGAAGG - Intronic
1093941056 12:25055101-25055123 ATGTGCTGATGCAACTTAGATGG - Intronic
1097386491 12:58955977-58955999 ATGTGATGAGAGAAGGCAGCAGG + Intergenic
1097688815 12:62715151-62715173 ATGGCCTGAGACATCTCAGAGGG + Intronic
1099236419 12:80087459-80087481 ATTTGCTGAGATAATTCATATGG + Intergenic
1099246584 12:80199999-80200021 ATGTGCTTATAGAGCTCAGTGGG - Intergenic
1101758330 12:107638982-107639004 ATATGCTGTGGGAACTCAGCTGG + Intronic
1103310929 12:120007340-120007362 AGGTCCTGAGAGAGCTCAGATGG - Intronic
1105755192 13:23457369-23457391 AAGTGCTGGGAGAACAGAGAGGG + Intergenic
1106119420 13:26846919-26846941 ACATGCTGAAAGAACTAAGATGG - Intergenic
1106210325 13:27637018-27637040 ATGTGATGATATAACTAAGAAGG - Intronic
1106671722 13:31913223-31913245 ATGTTTTCAAAGAACTCAGATGG + Intergenic
1107598089 13:41984925-41984947 ATATGCTGAGGGAACGCTGAAGG + Intergenic
1107716778 13:43207882-43207904 CTGTGATGAGAGAACTTTGATGG + Intergenic
1107841698 13:44464867-44464889 AGGTGCTGATATAACACAGAAGG - Intronic
1108492454 13:50994807-50994829 AGGAGCTGAAAGAACACAGAGGG + Intergenic
1110841109 13:80144530-80144552 AGGAGCTGAGAGAACTCAAAAGG + Intergenic
1117786625 14:59292366-59292388 ATGTGCTGAGAGATGCCACATGG - Intronic
1118641680 14:67798394-67798416 ATGTGCTGAGGGCTCTCTGATGG + Exonic
1120078708 14:80189982-80190004 AAGTCCTGAAAGAAATCAGAGGG + Intergenic
1120141425 14:80933677-80933699 AAATGCTGAGTGAACTCTGAGGG + Intronic
1121050733 14:90817206-90817228 ATTCACTGAGAGAACACAGAGGG - Intergenic
1121518219 14:94568008-94568030 TTGTGGGGACAGAACTCAGATGG + Intronic
1122156769 14:99754711-99754733 ACGTGCTGAGATAACGCAGCTGG - Intronic
1122210663 14:100171867-100171889 ATTAGCTGAGTGAACACAGATGG + Intergenic
1122258465 14:100498279-100498301 ATGTGCTGAGAGGAGACTGAGGG + Intronic
1125107167 15:35985742-35985764 ATGTTCAGAGAGAAAACAGATGG + Intergenic
1125665828 15:41429369-41429391 AAGTACAGAGAGGACTCAGAAGG - Intronic
1126108648 15:45162984-45163006 ATGTGCTGTCAGCATTCAGAGGG + Intronic
1127318314 15:57817978-57818000 GTGTGCTGAGAGAACACAGAGGG - Intergenic
1128675054 15:69602492-69602514 AGGTGCTAAGAGACCTCTGAAGG + Intergenic
1131487935 15:92837619-92837641 ATGACATGAGAGATCTCAGAGGG - Intergenic
1131805906 15:96122311-96122333 AGGTGCTGTGGGAACACAGAGGG - Intergenic
1132026939 15:98411831-98411853 AGGTGGAGAGAGAACCCAGAGGG + Intergenic
1132708747 16:1257357-1257379 ATGTGGAGAGAGAAATCACACGG + Intronic
1133172450 16:3989773-3989795 CTGTGCTGAGAGTACTTACATGG + Intronic
1134637298 16:15802280-15802302 AGCTGCTGAGAGAATTCAGTGGG - Intronic
1135852510 16:25977375-25977397 ATGTGCTCAGAGAACTAAAAGGG - Intronic
1136363559 16:29797454-29797476 ATTTGGGGACAGAACTCAGAAGG + Intronic
1138343128 16:56303783-56303805 CTATCCTGAGAGAACTCTGAGGG - Intronic
1141301085 16:82816271-82816293 ATTTACTGAGTGAATTCAGATGG - Intronic
1141335271 16:83148395-83148417 ATTTGCTGGAAGAACTAAGACGG + Intronic
1141904851 16:87017746-87017768 ATCTGCTGTGAGAATTCAGCTGG + Intergenic
1142641254 17:1287098-1287120 ATGGGCTGAGAGAAGACAAAGGG + Intronic
1143523941 17:7461954-7461976 AGGGGTTGAGAGAACCCAGAAGG - Exonic
1144008283 17:11121275-11121297 ATATGGTGTGAGGACTCAGATGG + Intergenic
1144580552 17:16456626-16456648 CTGTGCAGAGGGAACACAGAGGG + Intronic
1144591292 17:16526117-16526139 ATGTGCTAAGAGAATTAAGCTGG + Intergenic
1144915306 17:18719389-18719411 ATGCCCTAATAGAACTCAGAGGG - Intronic
1144930620 17:18856091-18856113 AAGTGCTGAGAGAAAAGAGAGGG - Intronic
1145994439 17:29097382-29097404 AGGTGCTGAGAGTCCCCAGAAGG + Intronic
1150214644 17:63459872-63459894 CTGTGCTTAGCAAACTCAGAAGG - Intergenic
1150484844 17:65536565-65536587 ATGAGCAGAGAGAAAACAGAAGG + Intronic
1153468590 18:5417207-5417229 ATCTGCTAAGAAAAATCAGAAGG - Intronic
1153807613 18:8723013-8723035 ATGTGAGGAGAGAACGGAGAGGG + Intronic
1158372635 18:56826871-56826893 ATGTGCTGATAGAAGACATAAGG - Intronic
1158853207 18:61516440-61516462 GTGTGCTGTGAGAACAAAGAAGG + Intronic
1158864941 18:61629386-61629408 ATGTCCAGAGAGAAGGCAGAAGG - Intergenic
1163136755 19:15317029-15317051 TTGTTCTCAGTGAACTCAGATGG - Intronic
1167213762 19:48150211-48150233 CTGCGGTGAGAGAGCTCAGACGG + Intronic
1167428697 19:49442524-49442546 CGGTGGGGAGAGAACTCAGAGGG - Intergenic
926946927 2:18198525-18198547 ATGTGGTGAGCGATCTTAGATGG + Intronic
927625673 2:24715713-24715735 CTTTGCTGAGAGAAATTAGAGGG + Intronic
927670715 2:25066445-25066467 ATGTTCTGAGAGACATCAGCTGG - Intronic
929732842 2:44514128-44514150 CAGTGCTTAGAGAAATCAGAGGG + Intronic
932223950 2:70024432-70024454 AGATGCTGAGAGAACAGAGAGGG + Intergenic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
938247757 2:129792175-129792197 AGGTGCTGAGAAAACTCTGCAGG - Intergenic
939135841 2:138292083-138292105 ATGGCCTAAGAGAACTGAGAGGG - Intergenic
939166132 2:138643141-138643163 ATGTGCTGGGTGAACTGAGGAGG - Intergenic
939184078 2:138840261-138840283 ATGTTATGACAGAACTCAGGAGG + Intergenic
943208990 2:184938538-184938560 ATGTGCTGGTAGACCTCACATGG - Exonic
943683582 2:190793120-190793142 ATGAGCTCATAGAACTGAGAGGG - Intergenic
944165246 2:196711911-196711933 ATGTACTGAGATAACTCATTTGG - Intronic
944175081 2:196820065-196820087 AAGTCCTGAGATAACTCAGATGG + Intergenic
944906304 2:204265235-204265257 ATGGGCTGAAAGAAATCAGAGGG - Intergenic
945867402 2:215191589-215191611 AGGTGGTGAGAGCACTCACAAGG + Intergenic
946594816 2:221294734-221294756 CTGTGTTGATTGAACTCAGATGG - Intergenic
946949402 2:224856493-224856515 ATGGGCTGAGAGAGATCAGCTGG - Intronic
947360664 2:229342292-229342314 ATGTGCTGTGCTCACTCAGATGG - Intergenic
948489291 2:238302060-238302082 AGGAGCTGTGAGCACTCAGATGG + Intergenic
1169024600 20:2358413-2358435 ATGTGCTGAAAGCACTAACAAGG + Intergenic
1169103915 20:2977900-2977922 AAGTGCTGAGGGAACTCAGAAGG + Intronic
1169509527 20:6248862-6248884 ATATGCTGAAAGAAGCCAGAGGG - Intergenic
1170064250 20:12293461-12293483 ATGTGCACAGTGAACTCATAAGG + Intergenic
1170686825 20:18576820-18576842 ATTTGCTGGGAGGACTCACAGGG - Intronic
1174382605 20:50166230-50166252 ATGTGCTGAGACACGTCAGCGGG + Intergenic
1175182206 20:57156594-57156616 ATGTGCTGAGTGAACTCCTGAGG + Intergenic
1175299907 20:57935297-57935319 GGGTGCTGTGAGAACACAGAAGG - Intergenic
1175751416 20:61500546-61500568 TTGTGCTGGGAAAACACAGAAGG + Intronic
1180786550 22:18550853-18550875 ATGTGCTGAGAGTCATCAGTGGG + Intergenic
1181243470 22:21490406-21490428 ATGTGCTGAGAGTCATCAGTGGG + Intergenic
949845961 3:8371291-8371313 AAGTGCTGTGAGAACCCAGAGGG - Intergenic
950057609 3:10039827-10039849 ATGTGGGGAAAGAACTCAGGTGG + Exonic
951309704 3:21109505-21109527 ATGTGCTAAGAGGTCTCAAATGG - Intergenic
952450493 3:33427816-33427838 AGGTGTTGAGAGAACTCTGTGGG - Intronic
952471833 3:33662558-33662580 ATGTGTTGCGGGAAGTCAGATGG - Intronic
952508017 3:34025147-34025169 ATCTGCTGAAAGAAGTCACATGG + Intergenic
954654067 3:52183220-52183242 GTGTGTTGAGAGAACTTAGGGGG - Intergenic
955459394 3:59163947-59163969 ATGTGCTAAGAGAAATCAGAAGG - Intergenic
960315270 3:116168556-116168578 ATATGCTGAGAAAAAGCAGAAGG - Intronic
961640459 3:128361629-128361651 ATGTGCTGTGGGAAATCAGAGGG + Intronic
961798652 3:129427822-129427844 ATGAGGTGAGAGAGGTCAGAAGG - Intronic
962013395 3:131415932-131415954 ATGTAGAGAGAGAACTCTGAGGG - Intergenic
962739913 3:138356008-138356030 GGGTGCTGAGAGACCTCAGAAGG + Intronic
966971410 3:185048780-185048802 ATGAGCTGTGAGGACACAGAAGG + Intronic
967767137 3:193293388-193293410 ATGTGTTGTGGGAACTCAGAAGG - Intronic
970653683 4:18206519-18206541 GGGTGCTGAGAGCACTCAGTGGG + Intergenic
971184895 4:24365097-24365119 ATCTGCAGAGAGTACTGAGAAGG - Intergenic
972723701 4:41726992-41727014 ATGGGTTGAGAGAATTCTGATGG - Intergenic
974718954 4:65711426-65711448 ATGTGCTGGGAGAAAACAGAAGG + Intergenic
976121021 4:81781607-81781629 ATGTTTTGAGACAAATCAGAAGG - Intronic
976560423 4:86494399-86494421 ATGGGCTGAGATAAGGCAGAAGG + Intronic
977969981 4:103201790-103201812 TTGTTCTGAGAGAAATCAGAGGG - Intergenic
978084125 4:104629571-104629593 ATGTGCTGGGGGATCCCAGAAGG + Intergenic
978768632 4:112431124-112431146 ATGTTCAGAGGGAACTCAGAAGG + Exonic
979766174 4:124466865-124466887 GTGAGCTAAGAGAACTCTGAAGG - Intergenic
979768835 4:124496930-124496952 AAATGCTGAGAGAACAGAGAGGG + Intergenic
981760757 4:148192502-148192524 GTGTGCTGAGGGAACTGTGATGG + Intronic
982685861 4:158488234-158488256 AGGTGCTGAAATAATTCAGATGG + Intronic
983275709 4:165614958-165614980 ATTTGCTCAGGGAACTCAGTAGG - Intergenic
983800403 4:171921879-171921901 ATTTGCTTAGAGAACACAAAGGG + Intronic
984949338 4:184995130-184995152 AAGTGCCAAAAGAACTCAGAGGG + Intergenic
985008703 4:185560464-185560486 ATCTTCCGAGAGAACTCTGAGGG - Intergenic
986741942 5:10712354-10712376 ATGTGCAGAAAGAATTCGGATGG + Intronic
988427499 5:31080417-31080439 GTGTGGTGAGAGAAAGCAGAAGG - Intergenic
988900816 5:35730262-35730284 AGGTGCAGAGAGAACGCAGAAGG + Intronic
990273463 5:54170941-54170963 CTGTGCAGAGAGAGCTGAGAAGG - Intronic
990365176 5:55063264-55063286 AGGTGCTGAGAGAAGCTAGAAGG + Intergenic
991007297 5:61842244-61842266 ATGTGTCTAGATAACTCAGAAGG - Intergenic
995208773 5:109512935-109512957 AAGTATTGAGAGAGCTCAGACGG - Intergenic
995827602 5:116318019-116318041 AGGTGTTAAGATAACTCAGAGGG - Intronic
996045866 5:118873153-118873175 AGCTGCTTAGAGAACCCAGAGGG + Intronic
999850030 5:155528012-155528034 CTGTGCTCTGAAAACTCAGAAGG + Intergenic
1001556180 5:172638805-172638827 AAGTGCAGAGGGATCTCAGATGG + Intergenic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1004792241 6:19039530-19039552 AAATGCTGAGAGAACTCTCAGGG - Intergenic
1005144834 6:22677128-22677150 AAGTCCAAAGAGAACTCAGAGGG - Intergenic
1005242119 6:23843041-23843063 ATGTCCTGAAAGGAATCAGAAGG + Intergenic
1006600202 6:35220183-35220205 AAGTGCTTAGAGAACACAGTGGG + Intronic
1006645173 6:35510827-35510849 GGGTGCTGAGAGAGCTCACAGGG - Intronic
1007077528 6:39077459-39077481 ATGTGCTGAGAGAACTCAGAAGG - Intronic
1007263191 6:40578006-40578028 CTGTGCTGGGAGCACTCAGGGGG - Intronic
1008146161 6:47894076-47894098 ATGGGCTGATAGAACTCAGCTGG - Intronic
1011744557 6:90397010-90397032 AAGCTCTGAGAGCACTCAGATGG + Intergenic
1013180613 6:107714094-107714116 ATGTGGTGAGAGAGATGAGAGGG + Intronic
1014489429 6:122043975-122043997 TTGTCCTGAGAGTCCTCAGAAGG + Intergenic
1014706948 6:124759495-124759517 AAGTGAGGAGAGAACGCAGAGGG - Intronic
1015233800 6:130947450-130947472 ATTTGCTGAGAGTAAACAGATGG + Intronic
1016243592 6:141958497-141958519 ATGAGCTGTAAGAAATCAGATGG - Intergenic
1017194715 6:151686940-151686962 ATGAGCTGAGATAACACATAGGG - Intronic
1017559075 6:155607328-155607350 ATATGCTGTGAGAACCCAGAGGG - Intergenic
1017684977 6:156904063-156904085 ATGGGCAGAGGGAACTAAGACGG - Intronic
1018634091 6:165845670-165845692 ATGTGCTGTGAAACCTCATAAGG + Intronic
1019079822 6:169422711-169422733 AAGTGCTCAGTAAACTCAGAGGG + Intergenic
1019767891 7:2864868-2864890 AAGTGCTGTGAGAATTCACAAGG - Intergenic
1019879572 7:3846732-3846754 ATGTGCTGAGTGTGCTCACAGGG - Intronic
1020509435 7:9034897-9034919 ATCTGCTGAGTGAACTCTGCGGG + Intergenic
1021343649 7:19494126-19494148 TTGTTCTGAGAGAATTCAAACGG + Intergenic
1022545736 7:31187251-31187273 AAGTGCTGTGGGAACTTAGAGGG - Intergenic
1024132536 7:46369330-46369352 CTGTGCTGAGAGTTCTAAGATGG - Intergenic
1024163471 7:46704985-46705007 AAGTGCTGAGAGAAAACAGCTGG + Intronic
1024349312 7:48347610-48347632 ATCTGCTGTGGGAACACAGAGGG - Intronic
1030511138 7:110483299-110483321 GTGTGCTGAAAAAAATCAGAAGG + Intergenic
1031237271 7:119192119-119192141 ATGTGAGGACAGAATTCAGAAGG - Intergenic
1034559717 7:151872233-151872255 CTGTGATGAGAGAATGCAGAAGG - Intronic
1035177041 7:157058892-157058914 CTGTGCTGAGGAAGCTCAGAGGG - Intergenic
1040654194 8:49485631-49485653 AGGACCTGAGAGAACTAAGAAGG - Intergenic
1040990771 8:53347338-53347360 TTGTGCAGAGAGAACTAAGGAGG - Intergenic
1041004150 8:53483296-53483318 ATGAGCAGAAAGAACTCAGGGGG - Intergenic
1041384292 8:57281271-57281293 CTTTGCTGAGAGACCTTAGAAGG + Intergenic
1041447542 8:57969327-57969349 TTGTGCTTACAGAACTCAGCTGG - Intergenic
1045424959 8:102056624-102056646 CTGAGCTGAGAGAAATCACAAGG + Intronic
1046809388 8:118516084-118516106 ATTTGCTGAGAGAACTCTCTAGG + Intronic
1046961598 8:120119305-120119327 ATGTGCTGGGAGAACTGATATGG - Intronic
1047276482 8:123409344-123409366 ATGTACTATGTGAACTCAGAGGG - Intronic
1048751458 8:137681587-137681609 ATGTCCTGAAATGACTCAGAGGG - Intergenic
1049298863 8:141859176-141859198 ATGTGGTGAGAGGAGGCAGAGGG + Intergenic
1050701739 9:8347388-8347410 ATGTGCTGAGACATCGAAGAAGG + Intronic
1051632318 9:19151632-19151654 ATGTGGTGATGGAATTCAGAAGG + Intergenic
1059798178 9:117722531-117722553 ATGTGTAGAGAGGACTCAGAAGG - Intergenic
1060433120 9:123568066-123568088 ATGGAATGAGACAACTCAGATGG + Intronic
1185700914 X:2229121-2229143 TTGTGCTGAGAGAGATCTGAGGG + Intronic
1188704561 X:33310465-33310487 ATGTTCTGAAAGAACACAAAAGG + Intronic
1188984310 X:36755741-36755763 ATGTGCAGGGATAACTCAGAAGG - Intergenic
1189058514 X:37726954-37726976 ATGTGCTGAGGGACATCAAAAGG + Intronic
1189212395 X:39294925-39294947 ATTTCCTGAGAAAACTAAGAGGG + Intergenic
1189688456 X:43590653-43590675 ATGTACTCAGAGAGCTAAGAGGG - Intergenic
1194258145 X:91659759-91659781 ATGTGCTCAGTGCAATCAGAAGG + Intergenic
1194304403 X:92224909-92224931 GTGTGCTGTGAGAATTCAGTGGG + Intronic
1194621269 X:96175774-96175796 GTGTGCTGAGGGTACACAGATGG + Intergenic
1196498812 X:116352933-116352955 CTCTGCTGAGAGAACACAAAGGG - Intergenic
1196532687 X:116807354-116807376 ATATGATTAGAGAACTCACATGG + Intergenic
1196782540 X:119396515-119396537 ATGTACTGAGAGATTTCAGTTGG + Intergenic
1197030953 X:121815145-121815167 TAGTTCTGAAAGAACTCAGAGGG - Intergenic
1197124451 X:122927851-122927873 ATTTTCTGAGAAAACTCAAACGG + Intergenic
1198157627 X:133977382-133977404 GTGTGCAGAGAGAATACAGAAGG - Intronic
1200576909 Y:4899266-4899288 ATGTGCTCAGTGCAATCAGAAGG + Intergenic
1201940390 Y:19452535-19452557 ATGTGGTGAAATAACTCAGAAGG + Intergenic