ID: 1007079062

View in Genome Browser
Species Human (GRCh38)
Location 6:39085985-39086007
Sequence GCTGCTGGTGGGACACTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007079062_1007079068 -4 Left 1007079062 6:39085985-39086007 CCCTCAAGTGTCCCACCAGCAGC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1007079068 6:39086004-39086026 CAGCCTGAGCAGTGGAGCCACGG 0: 1
1: 0
2: 4
3: 32
4: 331
1007079062_1007079073 29 Left 1007079062 6:39085985-39086007 CCCTCAAGTGTCCCACCAGCAGC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1007079073 6:39086037-39086059 CATGTACACAGCCACTTGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 247
1007079062_1007079070 -1 Left 1007079062 6:39085985-39086007 CCCTCAAGTGTCCCACCAGCAGC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1007079070 6:39086007-39086029 CCTGAGCAGTGGAGCCACGGCGG 0: 1
1: 0
2: 3
3: 26
4: 223
1007079062_1007079071 0 Left 1007079062 6:39085985-39086007 CCCTCAAGTGTCCCACCAGCAGC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1007079071 6:39086008-39086030 CTGAGCAGTGGAGCCACGGCGGG 0: 1
1: 1
2: 0
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007079062 Original CRISPR GCTGCTGGTGGGACACTTGA GGG (reversed) Exonic
901000289 1:6145643-6145665 GCTGCTGCTGGGGCACTGGGGGG + Intronic
901077437 1:6564094-6564116 GCGGCGGGTGGGTCACTTGTAGG + Intronic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
903478325 1:23635519-23635541 GCTGCTGGTGTTAGACTTGGGGG + Intronic
904539927 1:31225892-31225914 CATGCTGGTGGGACACTGGGTGG + Intronic
905583529 1:39100102-39100124 GCTGCTGGTGGGTTAATTGGTGG + Intronic
906431503 1:45759339-45759361 GCTCTTGGTGGGACACGAGATGG + Intergenic
909040444 1:70643071-70643093 GCTGCTGGTGGGGAAGCTGAAGG - Intergenic
910257896 1:85267079-85267101 GATACTGGAGGAACACTTGATGG - Exonic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912546196 1:110453444-110453466 GCTGAGGCTGGGCCACTTGAGGG + Intronic
915225763 1:154410195-154410217 TCTGCAGGTGGGATCCTTGAGGG + Intronic
919779452 1:201212871-201212893 GCTTTTGGTGGGACCCATGAAGG + Exonic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
922714513 1:227859931-227859953 GCTGCTTGTGGGCCCCTTGGGGG + Intergenic
924419584 1:243895846-243895868 GATTCTGGTGGGAGACTTGGAGG - Intergenic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063240991 10:4169004-4169026 GCTGCTGCTGGTAGACTTGTAGG + Intergenic
1066508374 10:36067682-36067704 GCTGATGAAGGGACACCTGAAGG + Intergenic
1070072692 10:73105043-73105065 GAGGCTGGTGGATCACTTGAGGG + Intergenic
1070685193 10:78475409-78475431 GATGCTGGATGGTCACTTGACGG + Intergenic
1071300483 10:84252743-84252765 GAGGCTGGTGGATCACTTGAAGG + Intronic
1071489716 10:86128086-86128108 GCTGCTGGTGGCACAGAGGAAGG - Intronic
1073266143 10:102229661-102229683 TCTGCAGGTGGGACGCCTGAGGG + Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1078094025 11:8285486-8285508 GCTGCTGATGGGACTCTCAAGGG - Intergenic
1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG + Intronic
1080623587 11:34008224-34008246 GAAGCTGGTGGGACACTGGTGGG + Intergenic
1080888780 11:36390324-36390346 GGTGCTGGTGGAAGACATGAAGG + Intronic
1083857528 11:65400499-65400521 CCTGCTGGTGGGACTGTTGTGGG + Intronic
1085527469 11:77172683-77172705 GCGGCTCCTGGGACACTGGATGG + Intronic
1091601034 12:1917934-1917956 GCAGCTTCTGGGACACCTGAAGG - Intronic
1097455696 12:59796194-59796216 GCTGGTGCTGGGAAACTGGACGG + Intergenic
1103142175 12:118557960-118557982 GCTGCTGTTGGGAGAATAGAGGG + Intergenic
1103465444 12:121138783-121138805 GCTCCTGGTGGGACTCAGGAAGG - Intronic
1104914265 12:132256667-132256689 GCTGGAGGGGGGACACTGGAAGG + Intronic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1106671442 13:31910070-31910092 GCTGCACGTGGGACACCAGAGGG + Intergenic
1110432939 13:75446885-75446907 CCTGCTGATGGGACATTTTAAGG - Intronic
1112921364 13:104616676-104616698 GCTTCTGGTGTGACATTTAAGGG + Intergenic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1115410073 14:33064332-33064354 GTTGCTGGTAGGACAATTAAGGG - Intronic
1117322866 14:54640713-54640735 CCTGCTGCTGTGACAATTGAGGG - Intronic
1118176189 14:63442276-63442298 GAAGCTGGTGGGAAATTTGAAGG - Intronic
1119872425 14:78028964-78028986 TCTGATGGTGGGAAACTGGAGGG + Intergenic
1119878272 14:78078627-78078649 GCTGCTGGTGGGTCCATTGGAGG + Intergenic
1122057974 14:99118003-99118025 GCAGCTGGTGGGACAGGGGAGGG - Intergenic
1122472876 14:101983906-101983928 GAGGCAGGTGGAACACTTGAAGG - Intronic
1125725205 15:41864746-41864768 GGTGCTGCTTGGACACTGGATGG + Intronic
1126739612 15:51764454-51764476 GCTGCAGGTGGGCCTCTTAAGGG - Intronic
1129767798 15:78181282-78181304 GCTGGTGGAGGGAAACTTGCTGG + Intronic
1131211690 15:90503219-90503241 TCTCCTGGTGGGACTCTGGAAGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133264620 16:4575738-4575760 GCTGGTGGTGGGGCCCTGGAGGG - Exonic
1135888097 16:26331692-26331714 GCTGCTGGTGGGATGCTAAATGG + Intergenic
1136494866 16:30636483-30636505 GCTGGTGGTGGCACAATTGGAGG + Intergenic
1138155123 16:54695961-54695983 GGGGCTGGTGGAACTCTTGAGGG - Intergenic
1139423754 16:66866225-66866247 CATGCTGGTGGGACACTCGAAGG + Intronic
1140457830 16:75115038-75115060 GCTGCTGGGGGGACACCCGCGGG - Intronic
1143124897 17:4635818-4635840 TCTTCTGAGGGGACACTTGATGG - Exonic
1143403617 17:6661332-6661354 TCTTCTGAGGGGACACTTGATGG + Intergenic
1144825951 17:18105833-18105855 GCTGATGGTGGCACAGTGGAGGG - Intronic
1146372046 17:32270711-32270733 GCAGCAGGTGGGAGACCTGAGGG + Intronic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1148117173 17:45182959-45182981 CCTGCTGGTGGCACACATGGGGG + Intergenic
1148674653 17:49438425-49438447 GCTGCTGGAGGGACGCTGCAGGG + Intronic
1148806417 17:50266271-50266293 GCACATGGTGGGACACTTGAGGG + Intergenic
1151318543 17:73338638-73338660 GCTGCTGGGGGGACGGTAGAGGG + Exonic
1151842326 17:76627191-76627213 GCTGCTGCTGGGGCACTGGAGGG + Exonic
1152161117 17:78669345-78669367 GCTGCTGGAGGGAGAATTGTTGG - Intergenic
1152576759 17:81144496-81144518 GCTGCAGCTGGGACAATGGAGGG + Intronic
1155213517 18:23622299-23622321 GGTGCGGGTGGGACCCTGGAAGG + Intronic
1157197642 18:45632386-45632408 GATGCTGGTGGGACTGCTGATGG + Exonic
1159189069 18:65017816-65017838 GCTCCTGGTGGGAAAGGTGAGGG - Intergenic
1159953618 18:74504026-74504048 ACTGCTGCTGGGACAAATGATGG + Intronic
1160794482 19:938552-938574 GCTGCTGGTGGGACGGTTTTGGG + Intronic
1161315550 19:3615670-3615692 GCTGCTGGTGACACACTGGGCGG + Intronic
1163284883 19:16340240-16340262 GCTCCTGGTGGGGCAGTTGCTGG - Intergenic
1164043039 19:21510543-21510565 GCTGCTGGTTGACCACTTTATGG + Intronic
1165829122 19:38721878-38721900 GCCCCAGGTGGGACACCTGAAGG + Intronic
926378161 2:12255545-12255567 GCTGCTGTTGTAGCACTTGATGG + Intergenic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
929134708 2:38612662-38612684 GCTAGTGGTGGGGCACTAGAGGG + Intergenic
929248776 2:39730436-39730458 CCTGCACGTGGGAAACTTGACGG - Intergenic
930176391 2:48305419-48305441 GAGGCAGGTGGGTCACTTGAGGG - Intergenic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
933418156 2:82013782-82013804 ACAGCTGCTGGGACACTTTATGG - Intergenic
935236754 2:101145115-101145137 GCAGGTGGTGGGATACTGGAGGG - Intronic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
939738815 2:145881247-145881269 GCTGCGGGTGCGGCGCTTGAGGG - Intergenic
939792765 2:146599904-146599926 GGTGCTGTTGGGACACTGCAGGG - Intergenic
948860753 2:240751604-240751626 GGTGGTGATGGGACAGTTGAGGG - Intronic
1171489884 20:25509331-25509353 GCCTCTGTTGGGACACTTGAAGG - Intronic
1172092485 20:32443839-32443861 GCTGCTGGTGGGTAACTGCATGG - Exonic
1174744570 20:53048637-53048659 GCTGCTGGTGGGGCTCTCTATGG - Intronic
1175502537 20:59460594-59460616 GCTGCTGCTGGCACCCTAGAGGG - Intergenic
1175541984 20:59753762-59753784 GCAGGTGGTGGGACGCATGATGG + Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177884518 21:26732411-26732433 TCTGGTGCTGGGAGACTTGAAGG - Intergenic
1178763672 21:35428815-35428837 GCTGCTTGTGGGCCAGGTGATGG + Intronic
1180078160 21:45473611-45473633 GCAGCTGATGGGCCACCTGAGGG - Intronic
1180082513 21:45493325-45493347 GCTGCTGCTGTGACACGTGAGGG + Intronic
1180090602 21:45531989-45532011 GCTGCTGCTGGGCCACTCGGTGG - Exonic
1180102484 21:45595305-45595327 GCTGTTGGTGGGAACCCTGAAGG - Intergenic
1181556484 22:23674522-23674544 GCTGCAGGTGGGACAATGGCTGG + Intergenic
1183732887 22:39628390-39628412 GGGGGTGGTAGGACACTTGAAGG + Intronic
1183959085 22:41400340-41400362 CCTCTTGGTGGGACTCTTGAGGG + Intergenic
1185296973 22:50059138-50059160 GGGGCTGGTGGGGGACTTGAAGG + Intergenic
951295279 3:20926244-20926266 GCTTCTGGTGAGAGACTTCAGGG + Intergenic
951441492 3:22728623-22728645 GCAGCTGGGGGGAGGCTTGAGGG - Intergenic
951935380 3:28017117-28017139 CCTGCTTGTGGGACATCTGAGGG - Intergenic
953579292 3:44138992-44139014 ACTGCTGCTGGGTCACTTTAAGG + Intergenic
953906159 3:46869186-46869208 GCTGCTGGTGGGAGAGTACAGGG - Intronic
954590172 3:51776315-51776337 GCTGCTGGTGGGACTCTCAGAGG - Intergenic
954683737 3:52359523-52359545 GCTGGTTGTGAGACACTTCAAGG - Intronic
956821765 3:72960169-72960191 CCTCCTGGTGGATCACTTGAGGG + Intronic
956898931 3:73693466-73693488 GCTGCTGGTGCAAGTCTTGAAGG + Intergenic
957734674 3:84190036-84190058 GCTGCTGCAGGGAGACATGATGG + Intergenic
960916584 3:122701516-122701538 GCTGCTGGTGGTAAACCTGGCGG - Exonic
969565649 4:7975992-7976014 ACTGCTGGTGGGAAAGGTGAGGG - Intronic
970149019 4:13069451-13069473 GCTGCCAGTGGGAAACTTGAAGG - Intergenic
974598152 4:64039471-64039493 GCTTCTGGTGGAACACCTAATGG - Intergenic
978587863 4:110292828-110292850 GCTGATGGTGGGATACTTCAAGG - Intergenic
980209037 4:129761091-129761113 CCAGATAGTGGGACACTTGAAGG - Intergenic
980704485 4:136475157-136475179 CCTGCAGGTGGGGCACTTGGTGG - Intergenic
980779983 4:137481928-137481950 GCTTCTGCTGGGACACTGCACGG + Intergenic
983887746 4:172999385-172999407 GGTGCTGGAAGGACACTGGAAGG - Intronic
986200449 5:5573967-5573989 GCTGCTTGGGAGACTCTTGACGG + Intergenic
987423509 5:17747988-17748010 GCTGGTGACGGGGCACTTGAAGG + Intergenic
989215482 5:38900452-38900474 CCTGCAGGTGGGACAATCGATGG + Intronic
991579636 5:68140898-68140920 GTTGCTGGTGGGGGAGTTGAAGG - Intergenic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
995684489 5:114757376-114757398 CCTGCTGTTGTGAGACTTGAGGG + Intergenic
996374291 5:122787588-122787610 GCTGATGGTTGGACACCTGAAGG + Intronic
997900603 5:137760459-137760481 GCTGCTGCTGTGACAGTAGACGG + Intergenic
998256424 5:140592008-140592030 GGTGCAGGTGAGACCCTTGAGGG - Intronic
999308398 5:150535570-150535592 GCTGCTGGTCTGAGACTTCATGG - Intronic
1002770013 6:282526-282548 GCTGCTGCTGGGACACTTGAGGG + Intergenic
1004442802 6:15670072-15670094 GCTCCTGTTAGGACACTAGAGGG - Intergenic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1007789585 6:44301422-44301444 GCTGCTGGAGCGGCACTCGAAGG - Exonic
1007857041 6:44868611-44868633 TCTGCTGCTGGGAGTCTTGAAGG + Intronic
1015882131 6:137880246-137880268 GCAACTGGTGAGACACTTGGAGG + Exonic
1016012864 6:139157054-139157076 GCTGCTGGTTGCCCACTTTATGG + Intronic
1018974588 6:168555419-168555441 GCCCCTGGTGGGAAGCTTGATGG - Intronic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1023230397 7:38021892-38021914 GCTGGTGGTGGGGCAGGTGAAGG + Intronic
1025097528 7:56107937-56107959 GCTGTTGCTGGGACACAGGAAGG - Intergenic
1026832078 7:73616357-73616379 GCCGCTGGTGGGAGTCTGGAAGG - Intronic
1027526376 7:79274360-79274382 GCTGCTGGTTAGAGACTAGAGGG + Intronic
1030517523 7:110556970-110556992 GCTCCTGATGGGTCACTGGATGG + Intergenic
1032671109 7:134083232-134083254 CCTGCTGGTGCATCACTTGATGG - Intergenic
1035670245 8:1411585-1411607 CCTGCAGGTGGTAGACTTGAGGG + Intergenic
1036572202 8:9990328-9990350 ACTGCTGGTTGGACAGTTCAGGG - Intergenic
1038309981 8:26439057-26439079 GCTACTGGAGGGTCACATGAGGG - Intronic
1039198841 8:35063592-35063614 GAGGCGGGTGGGTCACTTGAGGG + Intergenic
1039421155 8:37442243-37442265 GCTGCTGGTGGTACCTCTGATGG + Intergenic
1044854127 8:96457340-96457362 GCTGCGGGTGTCCCACTTGATGG - Intergenic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1049752006 8:144289385-144289407 GCTGCTGGTGGGTGGCTGGAGGG - Intronic
1049790116 8:144468565-144468587 GCTGCTGGAGGGCCCCTTGAAGG - Exonic
1051083956 9:13325400-13325422 GATGCTGGAGAGACACTGGAAGG - Intergenic
1052163324 9:25291519-25291541 GCTGCTGCACGGAGACTTGAGGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1056744841 9:89291615-89291637 TTTGATGGTGGGACACTTGGAGG - Intergenic
1059205876 9:112464899-112464921 GCTGCTGGTGGGGATATTGAGGG - Intronic
1060578576 9:124721787-124721809 GCTGATGGTGGAAGACTTTAAGG - Intronic
1061198566 9:129122559-129122581 GCTGGGGGTGAGACACTTGGTGG + Intronic
1062117962 9:134819173-134819195 GCTGGTGGTGGGGAACCTGAGGG + Intronic
1062210465 9:135360831-135360853 GCTGCTGGGTGGACAGTTCACGG - Intergenic
1062694543 9:137866711-137866733 GCTGAGGGTGGGAGAGTTGAGGG - Intronic
1185924900 X:4134773-4134795 GCTCCTGGAGGGTCACTTAATGG - Intergenic
1193142831 X:78046525-78046547 ACTCCTGGTGGGAGACTTCAGGG + Exonic
1196433427 X:115652304-115652326 GTAGCTGGTGGGACACATTATGG - Intergenic
1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG + Intergenic