ID: 1007082834

View in Genome Browser
Species Human (GRCh38)
Location 6:39120784-39120806
Sequence GATAATGATGTGTCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007082831_1007082834 4 Left 1007082831 6:39120757-39120779 CCATATAAAGCAGAGGGGGGTAG No data
Right 1007082834 6:39120784-39120806 GATAATGATGTGTCTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007082834 Original CRISPR GATAATGATGTGTCTAGAGC AGG Intergenic
No off target data available for this crispr