ID: 1007083234

View in Genome Browser
Species Human (GRCh38)
Location 6:39123767-39123789
Sequence CCTAGCTCCCTCACTCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007083226_1007083234 26 Left 1007083226 6:39123718-39123740 CCTGAAAAAGTCTTCAACCAATT No data
Right 1007083234 6:39123767-39123789 CCTAGCTCCCTCACTCCTTATGG No data
1007083225_1007083234 27 Left 1007083225 6:39123717-39123739 CCCTGAAAAAGTCTTCAACCAAT No data
Right 1007083234 6:39123767-39123789 CCTAGCTCCCTCACTCCTTATGG No data
1007083230_1007083234 9 Left 1007083230 6:39123735-39123757 CCAATTTTAGATGGGAGTTGGTG No data
Right 1007083234 6:39123767-39123789 CCTAGCTCCCTCACTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007083234 Original CRISPR CCTAGCTCCCTCACTCCTTA TGG Intergenic
No off target data available for this crispr