ID: 1007083392

View in Genome Browser
Species Human (GRCh38)
Location 6:39125161-39125183
Sequence CAATTCCTATGGTTTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007083392_1007083395 17 Left 1007083392 6:39125161-39125183 CCTGAAGAAAACCATAGGAATTG No data
Right 1007083395 6:39125201-39125223 TGCTTCCTCATGATTTTGTATGG No data
1007083392_1007083396 18 Left 1007083392 6:39125161-39125183 CCTGAAGAAAACCATAGGAATTG No data
Right 1007083396 6:39125202-39125224 GCTTCCTCATGATTTTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007083392 Original CRISPR CAATTCCTATGGTTTTCTTC AGG (reversed) Intergenic
No off target data available for this crispr