ID: 1007083702

View in Genome Browser
Species Human (GRCh38)
Location 6:39127710-39127732
Sequence ACATGGAAGGCTCTGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007083696_1007083702 -2 Left 1007083696 6:39127689-39127711 CCTCACCCAGAGCTGCTAAAGAC No data
Right 1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG No data
1007083698_1007083702 -7 Left 1007083698 6:39127694-39127716 CCCAGAGCTGCTAAAGACATGGA No data
Right 1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG No data
1007083695_1007083702 2 Left 1007083695 6:39127685-39127707 CCTTCCTCACCCAGAGCTGCTAA No data
Right 1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG No data
1007083699_1007083702 -8 Left 1007083699 6:39127695-39127717 CCAGAGCTGCTAAAGACATGGAA No data
Right 1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007083702 Original CRISPR ACATGGAAGGCTCTGTGGTG AGG Intergenic
No off target data available for this crispr