ID: 1007090753

View in Genome Browser
Species Human (GRCh38)
Location 6:39183390-39183412
Sequence CTGGGTAATAACACTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007090750_1007090753 -9 Left 1007090750 6:39183376-39183398 CCTCAGCTTCCAAACTGGGTAAT No data
Right 1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG No data
1007090747_1007090753 19 Left 1007090747 6:39183348-39183370 CCTCTAGCTGTTGTATAATCACT No data
Right 1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG No data
1007090744_1007090753 30 Left 1007090744 6:39183337-39183359 CCCAGACTCCACCTCTAGCTGTT No data
Right 1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG No data
1007090745_1007090753 29 Left 1007090745 6:39183338-39183360 CCAGACTCCACCTCTAGCTGTTG No data
Right 1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG No data
1007090746_1007090753 22 Left 1007090746 6:39183345-39183367 CCACCTCTAGCTGTTGTATAATC No data
Right 1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007090753 Original CRISPR CTGGGTAATAACACTGTTGT GGG Intergenic
No off target data available for this crispr