ID: 1007091990

View in Genome Browser
Species Human (GRCh38)
Location 6:39190377-39190399
Sequence GCCCGCCCGCATCCCAGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007091990_1007091991 -7 Left 1007091990 6:39190377-39190399 CCACAGCTGGGATGCGGGCGGGC 0: 1
1: 0
2: 0
3: 26
4: 168
Right 1007091991 6:39190393-39190415 GGCGGGCCCTGCTCCTGCTGTGG 0: 1
1: 0
2: 5
3: 34
4: 347
1007091990_1007091992 -2 Left 1007091990 6:39190377-39190399 CCACAGCTGGGATGCGGGCGGGC 0: 1
1: 0
2: 0
3: 26
4: 168
Right 1007091992 6:39190398-39190420 GCCCTGCTCCTGCTGTGGTACGG 0: 1
1: 0
2: 1
3: 16
4: 222
1007091990_1007091996 23 Left 1007091990 6:39190377-39190399 CCACAGCTGGGATGCGGGCGGGC 0: 1
1: 0
2: 0
3: 26
4: 168
Right 1007091996 6:39190423-39190445 ACACCTGACCCCACGCACAGCGG 0: 1
1: 0
2: 0
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007091990 Original CRISPR GCCCGCCCGCATCCCAGCTG TGG (reversed) Exonic
900418735 1:2546571-2546593 GCCAGCCCAGCTCCCAGCTGGGG + Intergenic
900465960 1:2825575-2825597 GTCCTACCGCAGCCCAGCTGGGG - Intergenic
901195568 1:7438156-7438178 GCCAGCTCTCACCCCAGCTGCGG + Intronic
901439984 1:9272045-9272067 CCCCGCGCGCCTCCCATCTGAGG - Intergenic
901759696 1:11462727-11462749 GCCCTCCTCCTTCCCAGCTGGGG + Intergenic
902811608 1:18891159-18891181 GCCCTGCCACCTCCCAGCTGTGG + Intronic
903688001 1:25146645-25146667 GCCCGTCCGCCTCCCTGCTCTGG - Intergenic
905731854 1:40303622-40303644 GGGCGCCCGCATCCCCGCTGGGG + Exonic
906297926 1:44660323-44660345 CCCCGCCCCCACCCCAGCTCTGG - Intronic
907429929 1:54405900-54405922 GCCCGCCCGCAGCCCGGCGGCGG + Intronic
908112242 1:60909072-60909094 GCCAACCCGCAACCCAGCAGGGG + Intronic
911062688 1:93761625-93761647 GCCCTCAGCCATCCCAGCTGGGG + Intronic
913293925 1:117300765-117300787 GCCCCCCCACCTCCCAGATGGGG + Intergenic
913959291 1:143326854-143326876 GCCCGCCCGCGTCTCTGCTGAGG + Intergenic
914053610 1:144152234-144152256 GCCCGCCCGGGTCTCTGCTGAGG + Intergenic
914125587 1:144814307-144814329 GCCCGCCCGGGTCTCTGCTGAGG - Intergenic
914523033 1:148435020-148435042 GCCCGCCCGCAGCCCGTCAGCGG - Intergenic
918105613 1:181413194-181413216 GCCCGCCCCCTGCCCGGCTGCGG + Intronic
919743531 1:200994667-200994689 GCCAGCTCACATCTCAGCTGCGG - Intronic
919845505 1:201639773-201639795 CCCCGTCCCCATCCCAGCTTGGG + Intronic
920270739 1:204761882-204761904 GCCCGCATTCATCCTAGCTGTGG + Intergenic
923109177 1:230877300-230877322 CCTCGCCTGCATCCCTGCTGAGG - Intergenic
1062795871 10:344815-344837 GCCAGCTAGCATCCCAGTTGTGG + Exonic
1070264156 10:74886391-74886413 CCCCACCTGCATCCCAGGTGAGG + Intronic
1070642105 10:78177653-78177675 GCCCGCCCACAGCCCAGCATGGG + Intergenic
1070693393 10:78543998-78544020 GCCCGCCCTCATTCCATCTGAGG - Intergenic
1076845844 10:133069201-133069223 CCCCGCCAGCTTCCCAGCTGTGG - Intergenic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1077102163 11:827227-827249 TCCCGTCCGGGTCCCAGCTGGGG + Intronic
1077454009 11:2667171-2667193 GCCTGCCATCAGCCCAGCTGTGG + Intronic
1083841768 11:65308859-65308881 GCCACCCTGCATCCCAGCAGAGG + Intergenic
1084657316 11:70527128-70527150 GCCCGCCCAGACCACAGCTGTGG - Intronic
1089345603 11:117789498-117789520 GCTCACCAGCATCCCAGCTGGGG + Intronic
1089684255 11:120137048-120137070 GTCCCCCCTAATCCCAGCTGGGG - Intronic
1096671195 12:53199203-53199225 ACCTGCCCCCATCCCAGCTTGGG + Intronic
1101131892 12:101698163-101698185 ACCCGCCCGCAGCGCATCTGGGG - Intronic
1104839098 12:131812038-131812060 GCTCTCCCTCATCCCAACTGTGG - Intergenic
1104974454 12:132546225-132546247 GCCCGCCCATATCACAGCAGGGG + Intronic
1105235931 13:18553716-18553738 GCTCCCCTGCATCCCAGCTGTGG + Intergenic
1113201849 13:107875141-107875163 GACCTCCAGGATCCCAGCTGTGG + Intergenic
1113571467 13:111361209-111361231 GCGCCCCCACCTCCCAGCTGTGG - Intergenic
1113654169 13:112057770-112057792 GCCCGCTCGGATCCCACCTTGGG - Intergenic
1116729030 14:48598650-48598672 GCCCCCCCACCTCCCAGATGGGG - Intergenic
1118955595 14:70477702-70477724 GCCCCCCCACCTCCCAGATGGGG - Intergenic
1119051808 14:71377199-71377221 GCCCCCCCACCTCCCAGATGGGG + Intronic
1119262480 14:73245824-73245846 GCCCCCACGCAGCCCTGCTGTGG - Intronic
1119560741 14:75587549-75587571 TCCCTCCCTCATCCCAGCTCTGG - Intronic
1122638928 14:103145801-103145823 CCCAGCCCGTCTCCCAGCTGTGG - Intergenic
1122889751 14:104726805-104726827 GCCAGCCTGCCTCCCAGATGCGG - Intronic
1125343317 15:38695680-38695702 TCCTGCCCCCATCCCAGCTCTGG - Intergenic
1127324650 15:57883487-57883509 GCCCGCCAGCACCTCAGCTATGG + Intergenic
1128073305 15:64810721-64810743 CCCTGCCTGCCTCCCAGCTGGGG + Intergenic
1131289921 15:91098836-91098858 GCGAGCCTGCATCCCAGCTTGGG + Intergenic
1131294753 15:91137115-91137137 GCCCTCTCACCTCCCAGCTGAGG - Intronic
1132360358 15:101207887-101207909 GCCCACCCTCACCCCATCTGGGG - Intronic
1132683550 16:1153290-1153312 GCCCGCCCGGCTCCCGGCCGCGG - Exonic
1134255802 16:12610355-12610377 GCTAGCCTGAATCCCAGCTGGGG + Intergenic
1136295071 16:29296968-29296990 GCCGGTCCACATCCCAGCTCTGG + Intergenic
1137559390 16:49493068-49493090 AACCGCCTGCATCCCATCTGTGG - Intronic
1137645107 16:50066584-50066606 GACCGCCCGCAGCCCAGACGCGG - Intronic
1139505553 16:67396544-67396566 CCCCTCCCGCATTCCTGCTGGGG + Intronic
1139960803 16:70716268-70716290 GCCAGGCCCCATGCCAGCTGTGG - Intronic
1140408927 16:74729788-74729810 GCCCACCAGCATCACAGATGAGG - Intronic
1141693079 16:85607361-85607383 TCCCGCCCGCTTTCCAGCCGCGG + Intergenic
1142100972 16:88270977-88270999 GCCGGTCCACATCCCAGCTCTGG + Intergenic
1144845957 17:18219178-18219200 GCTGGCCCAGATCCCAGCTGAGG - Intergenic
1146923896 17:36731171-36731193 GGCTGCCAGCATTCCAGCTGGGG + Intergenic
1148809118 17:50279124-50279146 CCACTCCCCCATCCCAGCTGAGG - Intronic
1148874616 17:50679637-50679659 GCCCACAGGCATGCCAGCTGGGG - Intronic
1150390742 17:64788608-64788630 GCCCACCCTCCTGCCAGCTGAGG - Intergenic
1150480293 17:65503937-65503959 GCACACCAGCATCCCAGGTGGGG - Intergenic
1151966933 17:77436459-77436481 CCCCGCCCCCGTCCCATCTGCGG - Intronic
1152393243 17:80015522-80015544 GCCTGCACGCAGCCCAGCTGTGG - Intronic
1154156474 18:11947953-11947975 GCCCCCCCTGATGCCAGCTGCGG + Intergenic
1154513613 18:15136282-15136304 GCTCCCCTGCATCCCAGCTGTGG - Intergenic
1155333893 18:24745763-24745785 GCACGCCCACAGCCCAGGTGGGG - Intergenic
1155872067 18:31041990-31042012 CCCCGCCAGCCACCCAGCTGGGG - Intronic
1156098638 18:33566344-33566366 CCCCACCCGCCTCCCAGCTGGGG - Intergenic
1156163211 18:34385162-34385184 GCCCGCCTGAATGCCAGCAGAGG - Intergenic
1160468869 18:79108181-79108203 TCCCTCCAGCATCCCTGCTGTGG - Intronic
1160546240 18:79657818-79657840 GCTCACGCGCATCCCAGCTGCGG + Intergenic
1160873265 19:1286412-1286434 GGGCGCCCGCATCCCGGCGGCGG - Intronic
1160930167 19:1566680-1566702 GCCCGCCCGCCCCGCAGCTCGGG + Intronic
1161108548 19:2456192-2456214 CCCCGTCTGCATCCCAGCTCAGG + Intronic
1161264974 19:3359856-3359878 CCCCCCCCGCACCCCGGCTGGGG + Intronic
1162141008 19:8585608-8585630 GCACGCCTGCATCGCAGCTGCGG + Exonic
1163577361 19:18118461-18118483 GTCCGCCAGCGTCGCAGCTGGGG + Intronic
1163669790 19:18620707-18620729 TCCCGCCCTCTTCCCAGCTGGGG - Exonic
1163720495 19:18896151-18896173 GCGCGCCCCCGGCCCAGCTGCGG - Intronic
1165065240 19:33224877-33224899 GCCCACCAGGATCCCAGCTCAGG + Intronic
1165119294 19:33548785-33548807 ACCTGCCCCCATCCCTGCTGTGG - Intergenic
1165204444 19:34172122-34172144 GCCCACCCGCCTCCGAGCTGTGG - Intergenic
1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG + Intergenic
1202693008 1_KI270712v1_random:104655-104677 GCCCGCCCGGGTCTCTGCTGAGG + Intergenic
929581118 2:43082331-43082353 GCCAGCCGGCCTGCCAGCTGGGG + Intergenic
933953389 2:87349307-87349329 GCCCGCCCGGGTCTCTGCTGAGG - Intergenic
934275605 2:91571174-91571196 GCCCGCCCGGGTCTCTGCTGAGG + Intergenic
936780528 2:116027443-116027465 GCCAGCCCGCACATCAGCTGTGG - Intergenic
937127277 2:119482656-119482678 GCCCGTCTACATTCCAGCTGTGG + Intronic
937991116 2:127663100-127663122 TCCTGCCTGCATCTCAGCTGTGG + Intronic
938513854 2:131980893-131980915 GCTCCCCTGCATCCCAGCTGTGG - Intergenic
939957654 2:148540157-148540179 CACCCCCGGCATCCCAGCTGTGG + Intergenic
941905995 2:170716463-170716485 CCGCCCCCGCATCCCAGCTTGGG + Exonic
944350048 2:198715668-198715690 GCCTTTCCACATCCCAGCTGAGG - Intergenic
946140002 2:217682216-217682238 GACCTCCTGCTTCCCAGCTGAGG - Intronic
946395419 2:219441816-219441838 GCCAGCCTGCACCCCACCTGGGG - Intronic
947910561 2:233798352-233798374 GCTCCACCACATCCCAGCTGTGG - Intronic
948423337 2:237873901-237873923 CCCTGGCCTCATCCCAGCTGTGG + Intronic
948953993 2:241272899-241272921 GCCCGCCCGCCCCGCCGCTGGGG + Intronic
1168883473 20:1226304-1226326 CGTCGCCCGCAGCCCAGCTGGGG + Intronic
1171284180 20:23924075-23924097 GCCCGCAGCCATCCGAGCTGGGG - Intergenic
1175634274 20:60567455-60567477 GGCCTCCTGCTTCCCAGCTGGGG + Intergenic
1175800449 20:61798285-61798307 CCTCGCACGCATCCCCGCTGTGG + Intronic
1176146258 20:63566796-63566818 CCCCGACCGCACCCCTGCTGGGG - Intronic
1176779930 21:13182002-13182024 GCTCCCCTGCATCCCAGCTGTGG + Intergenic
1178488448 21:33033187-33033209 CCCCGCCCGCCGCCCAGATGGGG - Intergenic
1178971659 21:37183646-37183668 CCACCCCAGCATCCCAGCTGAGG - Intronic
1179197899 21:39183198-39183220 GCCCGCGCACCTTCCAGCTGCGG + Intronic
1179522446 21:41953982-41954004 TCCCGCCCGCGGCCCAGCGGTGG + Intergenic
1179599356 21:42465760-42465782 GCCAGCCCTCATACCAGCTGGGG + Intergenic
1180648371 22:17358545-17358567 GCCAGCCTGCATCAGAGCTGGGG - Intergenic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1182455101 22:30445251-30445273 ACCCCGCCCCATCCCAGCTGAGG - Intergenic
1182775953 22:32831069-32831091 GCCAGCCTGCATCCCAGCCATGG - Intronic
1183344640 22:37300613-37300635 GCCGTCCCCCTTCCCAGCTGAGG + Intronic
1183391112 22:37546150-37546172 CCCCGCCCCCATCAGAGCTGGGG + Intergenic
1183607120 22:38872304-38872326 GCGCGCTCGCGTTCCAGCTGCGG + Exonic
1183672315 22:39280268-39280290 GCCCTCCCGTTTCTCAGCTGAGG + Intergenic
1183703550 22:39463293-39463315 GCCCTGCCACTTCCCAGCTGTGG - Intronic
1184098550 22:42329652-42329674 GCCCTCCTGCATCCCTGCAGTGG - Intronic
1185229539 22:49672275-49672297 CCCCGCCCCCACCCCCGCTGGGG - Intergenic
1185275194 22:49947699-49947721 GCCCACCCAGAGCCCAGCTGGGG + Intergenic
950480740 3:13242234-13242256 GCTCACCCGCATCACAGCCGCGG - Intergenic
950565674 3:13768298-13768320 CCCCTCCCCCAGCCCAGCTGGGG - Intergenic
950659135 3:14455820-14455842 GGCCAACCACATCCCAGCTGGGG - Intronic
951290366 3:20866746-20866768 GCCCCCCCACCTCCCAGATGGGG + Intergenic
954194745 3:48990026-48990048 GCCCGACGGCAACCCAGCTTGGG + Exonic
954580605 3:51700986-51701008 CCCTGCCCGCCTCCCTGCTGTGG + Intronic
961594539 3:128006398-128006420 TCCCGCCTGCCTCCCAGCTGGGG - Intergenic
962847872 3:139287075-139287097 GCCCCCCAGCATGCCGGCTGTGG + Intronic
968539400 4:1156059-1156081 GGCGGCCGGCATCCCAGATGTGG + Intergenic
969518812 4:7663991-7664013 ACCCGCCCCCATCCCTGCTTAGG + Intronic
969536068 4:7756749-7756771 GCCGGGCCGCATCCCACGTGGGG + Intergenic
969579310 4:8054760-8054782 GCAGGCCCACTTCCCAGCTGAGG - Intronic
969642120 4:8405221-8405243 CCCCGCCTGCATCCCAGCACAGG + Intronic
972941165 4:44196908-44196930 GCTCCCCAGCATCCCAACTGTGG - Intronic
975597876 4:76067062-76067084 GCCTGCCATCATCCCAGCTGTGG - Intronic
977290443 4:95159908-95159930 CCCCACCTGCCTCCCAGCTGTGG + Intergenic
980130039 4:128809869-128809891 GCCCGCGCGCGTACCTGCTGCGG - Exonic
981746066 4:148053463-148053485 TCCCGCCCGCATCTCAGCCAAGG - Intronic
982352512 4:154431198-154431220 CCCCGCCTGCATCCAAGCTGAGG - Intronic
987254664 5:16138259-16138281 GGCGCCCTGCATCCCAGCTGTGG + Intronic
991172669 5:63646605-63646627 TCCCGCCCCCACCCCATCTGTGG - Intergenic
996124195 5:119706361-119706383 GGCTGACCGCCTCCCAGCTGCGG + Intergenic
999467614 5:151822472-151822494 CCCCGCCCACAGCCCATCTGAGG + Intergenic
1000319018 5:160119136-160119158 GCTCGCCCGCAGCCCAGAGGCGG - Exonic
1001281933 5:170392240-170392262 GCCTGCCAGCCTCCCAGCTGAGG + Intronic
1002080356 5:176733808-176733830 GCCAGCCTGCATCCCAGGAGGGG + Intergenic
1002099759 5:176851590-176851612 CCCCGCCCCCAGCCCAGGTGTGG - Intronic
1002194002 5:177492512-177492534 GTCCACCCGCATACCTGCTGAGG + Exonic
1002758499 6:183601-183623 CCCAGCCCGCACTCCAGCTGTGG - Intergenic
1006475219 6:34248787-34248809 GCTGGCCCGCATCCTAGCAGCGG - Intronic
1006502370 6:34466749-34466771 CCCCGCTCCCATCCCAGCTGTGG - Intronic
1007091990 6:39190377-39190399 GCCCGCCCGCATCCCAGCTGTGG - Exonic
1011099905 6:83709110-83709132 CCCCGCCCCCACCTCAGCTGTGG + Exonic
1012251986 6:96990746-96990768 CCCCGCCCCCACCCCAGCTTGGG - Intronic
1013007386 6:106086417-106086439 GGGCGCCCGCGTCCCAGCTCCGG - Exonic
1014913381 6:127118856-127118878 GCCCGCCCGGATCCCGCCTGCGG + Exonic
1017493849 6:154966581-154966603 GCCCGGCCGCAACCCCGTTGGGG - Intronic
1018686628 6:166308421-166308443 CCCGGCCCGCGTCTCAGCTGTGG - Intronic
1020016413 7:4834517-4834539 GCGCTCCCGCCTCCCAGCCGGGG + Intronic
1022551996 7:31249757-31249779 TCCCACCCGCATCCCACCTGGGG - Intergenic
1022606095 7:31815648-31815670 GCCTGCCTGCCTGCCAGCTGGGG - Intronic
1024917937 7:54524861-54524883 GGCCACCCACCTCCCAGCTGTGG + Intergenic
1024944577 7:54795760-54795782 GCCCACCCACTTACCAGCTGGGG - Intergenic
1030820710 7:114087554-114087576 GCCCGCCCGCCTGCCCGCCGGGG - Intronic
1034466359 7:151232354-151232376 GGCAGCCCGGATCCCAGCCGAGG + Intergenic
1038451820 8:27644371-27644393 GCCCTCCCTCATAGCAGCTGTGG + Intronic
1045367703 8:101492522-101492544 GCCCGGCCGCCTCCGAGCTCGGG + Exonic
1047925316 8:129677033-129677055 GCACTTCCCCATCCCAGCTGAGG - Intergenic
1052236103 9:26214811-26214833 GCCCCCCCACCTCCCAGATGGGG + Intergenic
1053415540 9:37944876-37944898 GCCCACCCACATGCCAGCTCTGG + Intronic
1056755078 9:89376762-89376784 CCCCGCCCGCCCCCCACCTGTGG + Exonic
1057263273 9:93598077-93598099 GCCAGCCTCCACCCCAGCTGGGG - Intronic
1057759006 9:97857875-97857897 GGCCGCCCGCGACCCCGCTGTGG - Intergenic
1057904018 9:98970558-98970580 GCCCTTCCACATCACAGCTGTGG - Intronic
1059432960 9:114260785-114260807 GCACCCCCGGTTCCCAGCTGTGG + Intronic
1059459578 9:114421234-114421256 GCCAGTCCAGATCCCAGCTGTGG - Intronic
1060404865 9:123368206-123368228 ACCCGCCCGCATTCCTGCTGGGG + Intronic
1060514659 9:124258167-124258189 GCCCGCCCTCGGCCCGGCTGGGG - Intronic
1060559392 9:124530262-124530284 GCCAGCCCCCATCACTGCTGGGG - Intronic
1190274326 X:48890722-48890744 GCCCACCCACACCCTAGCTGCGG - Intergenic
1196389910 X:115196273-115196295 TCCCTCCCTCATCCCATCTGTGG - Intronic
1200000172 X:153056206-153056228 GCCCACCCCCATCCCCACTGCGG - Intergenic
1200163148 X:154019385-154019407 GCCCGCCGGCCTCCCAGCCGTGG + Intronic