ID: 1007093787

View in Genome Browser
Species Human (GRCh38)
Location 6:39200914-39200936
Sequence TGCCTGCCCATGTCTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 182}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007093787_1007093795 -9 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093795 6:39200928-39200950 GGGCAGGCAGGGCAAGGTGGGGG 0: 1
1: 0
2: 19
3: 124
4: 1050
1007093787_1007093801 12 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093801 6:39200949-39200971 GGCTTCCCCTTTACGGGGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 80
1007093787_1007093796 5 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093796 6:39200942-39200964 AGGTGGGGGCTTCCCCTTTACGG 0: 1
1: 0
2: 0
3: 10
4: 97
1007093787_1007093803 17 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093803 6:39200954-39200976 CCCCTTTACGGGGTGGGGTAAGG No data
1007093787_1007093805 18 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093805 6:39200955-39200977 CCCTTTACGGGGTGGGGTAAGGG No data
1007093787_1007093799 10 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093799 6:39200947-39200969 GGGGCTTCCCCTTTACGGGGTGG No data
1007093787_1007093800 11 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093800 6:39200948-39200970 GGGCTTCCCCTTTACGGGGTGGG No data
1007093787_1007093798 7 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093798 6:39200944-39200966 GTGGGGGCTTCCCCTTTACGGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1007093787_1007093797 6 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093797 6:39200943-39200965 GGTGGGGGCTTCCCCTTTACGGG 0: 1
1: 0
2: 0
3: 8
4: 126
1007093787_1007093794 -10 Left 1007093787 6:39200914-39200936 CCACCTTCAGACATGGGCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1007093794 6:39200927-39200949 TGGGCAGGCAGGGCAAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007093787 Original CRISPR TGCCTGCCCATGTCTGAAGG TGG (reversed) Intronic