ID: 1007094351

View in Genome Browser
Species Human (GRCh38)
Location 6:39204183-39204205
Sequence GATTTGCTCTGATATCTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007094351 Original CRISPR GATTTGCTCTGATATCTATC TGG Intronic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
907797847 1:57735261-57735283 GATTTGCTATGTGACCTATCTGG + Intronic
912686118 1:111766716-111766738 GAGTTTTTCTGATACCTATCAGG + Exonic
917535881 1:175874221-175874243 GATCTGCTCTGATGTGCATCAGG - Intergenic
918160480 1:181894254-181894276 GAGTTGCTTAGATACCTATCTGG + Intergenic
920058324 1:203209554-203209576 GATTTGCTGTAATAAATATCAGG + Intergenic
920157950 1:203970742-203970764 GATTTGATCTGATAATTAACTGG - Intergenic
1065809606 10:29429273-29429295 GATTTCCTCTGAATTCTATCTGG + Intergenic
1065880948 10:30037189-30037211 AATTTGCTCTGAAAGCTCTCTGG + Intronic
1066127903 10:32360601-32360623 GATTTGATCTCACATGTATCAGG + Intronic
1066226198 10:33386050-33386072 GATTTGTGCTGATATCTGTCAGG - Intergenic
1068113796 10:52713700-52713722 GGTTTCCTCTGATATCATTCTGG + Intergenic
1068738816 10:60446068-60446090 GATTTGCTGTGATTTCAAGCTGG - Intronic
1070731449 10:78831375-78831397 CCTTTGCTCTGCTACCTATCTGG + Intergenic
1074054653 10:109911567-109911589 ATTTTACTCTGATATCTTTCAGG + Intronic
1074193984 10:111163643-111163665 GATTCGCTTAGATATCTATATGG - Intergenic
1074859267 10:117497949-117497971 GATGTTCTCTGAGGTCTATCAGG - Intergenic
1079765144 11:24382714-24382736 GAATTACTCTGACCTCTATCAGG - Intergenic
1085268866 11:75257863-75257885 GATTTGATCTGAGATCAAACAGG - Intergenic
1086184264 11:83994820-83994842 GATTTACTCTTATAGCTTTCAGG - Intronic
1086903959 11:92397799-92397821 GAGTGTCACTGATATCTATCTGG - Intronic
1088144740 11:106662835-106662857 GTTTAGCTCTGTAATCTATCAGG + Intergenic
1090955560 11:131510478-131510500 GATTTGAACTGAAATCTGTCTGG - Intronic
1093349298 12:18077813-18077835 GATTTGCTTGTATATCTATCTGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1098228669 12:68350697-68350719 CATTGGCGCTGATATTTATCCGG + Intergenic
1098579992 12:72088181-72088203 GATTTAATTTGATATCTATGTGG - Intronic
1103958228 12:124591637-124591659 GAGTTGCTCTGAGATTTTTCAGG - Intergenic
1104652675 12:130547737-130547759 GCTTTGCTCTGAGATCTCCCTGG - Intronic
1108639758 13:52371988-52372010 GATTATCTCTGATACCTACCAGG + Intergenic
1114344748 14:21782591-21782613 GTTTTGCTCTGAGATAGATCAGG + Intergenic
1116452219 14:45079796-45079818 ATTTTGCTCTTATATCAATCAGG + Intergenic
1116523096 14:45872938-45872960 GATTTGTTCTCATATTTTTCTGG - Intergenic
1117358142 14:54946030-54946052 GATTTGTTCTGTTATTTTTCTGG - Intronic
1117602010 14:57385837-57385859 GATTTACTCTTATGTCAATCAGG - Intergenic
1118940060 14:70325884-70325906 AATTTTCTCTCATATCTATTAGG - Exonic
1120019095 14:79508043-79508065 GATTTGAACTCATATCTATTTGG + Intronic
1120373838 14:83674399-83674421 AATTTGGTCTGTGATCTATCTGG + Intergenic
1122181086 14:99955315-99955337 GTTTTGCTTTGATAACTTTCTGG - Intergenic
1124499747 15:30216916-30216938 GATTAGCTCTGAAGTCTCTCTGG + Intergenic
1124743832 15:32321751-32321773 GATTAGCTCTGAAGTCTCTCTGG - Intergenic
1131973190 15:97913296-97913318 GTTCTGCTCTGATATTTAACAGG - Intergenic
1135419575 16:22296924-22296946 GTTTTGCTCTAATACCTATTCGG + Intergenic
1139258647 16:65569212-65569234 AATTTGCTGAGATATCCATCAGG - Intergenic
1140818064 16:78638914-78638936 GTTTTACACTGATATCTCTCAGG - Intronic
1141092527 16:81139955-81139977 GATTTGCTCTGTTATTGCTCAGG + Intergenic
1146702488 17:34973448-34973470 AATTAGCTGTGATATCTACCTGG + Intronic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1156099905 18:33579969-33579991 GCCTTGCTCTGGTATGTATCTGG + Intronic
1156744892 18:40377913-40377935 GCATTGCTCTGCTATTTATCAGG - Intergenic
1162437080 19:10667577-10667599 TATTTGCTCTGAAATATACCAGG - Intronic
925212626 2:2062960-2062982 CATTTTCTCTGATCTCTTTCTGG + Intronic
931929262 2:67110720-67110742 TATTTGCCCTGAGATCTATTGGG - Intergenic
933365494 2:81348292-81348314 GATTTACATAGATATCTATCAGG - Intergenic
934669629 2:96202538-96202560 GATTTGCTCAGAGAACAATCAGG + Intronic
940687017 2:156864531-156864553 GATTTGCTTTGACATTTAGCTGG + Intergenic
941964040 2:171283214-171283236 GATTTGAACTTATGTCTATCTGG + Intergenic
1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG + Intronic
1177189194 21:17830902-17830924 TATATTCTCTGATATCTGTCAGG + Intergenic
1182764061 22:32745718-32745740 GTTTTTCTCTGCTCTCTATCTGG - Intronic
1184633591 22:45806647-45806669 GTTTAGATCTCATATCTATCTGG + Intronic
1184899369 22:47434704-47434726 GCTTTGCTCTGGAATTTATCAGG + Intergenic
951320727 3:21241411-21241433 CATTTGTTATGAAATCTATCTGG - Intergenic
951541016 3:23781912-23781934 GTTTTGCTCAGTTTTCTATCAGG - Intergenic
952455578 3:33468518-33468540 GATTTGCTCTCATAATTAACTGG - Intergenic
952785568 3:37151416-37151438 GAGTTGTTCTGATTTGTATCTGG - Intronic
953829886 3:46287220-46287242 CATTTGGTTTTATATCTATCTGG + Intergenic
956257090 3:67294740-67294762 GTTTTGGTCTGATTTATATCAGG - Intergenic
957554219 3:81745935-81745957 TATTTTCTTTGATATTTATCAGG - Intronic
958597515 3:96246858-96246880 TATTTGCTCTCATATCTCTCTGG + Intergenic
959969611 3:112394626-112394648 GATTTGCCCTGAATTCTTTCTGG - Intergenic
964512858 3:157472292-157472314 GCTTAGCTCTTAAATCTATCTGG + Intronic
965378966 3:167964151-167964173 GAGTTGATCTTATATATATCAGG + Intergenic
965736826 3:171829514-171829536 TTTTTGCAATGATATCTATCAGG + Intergenic
966704727 3:182899634-182899656 GATTTGAACTGAGATCTATCAGG - Intronic
966905637 3:184523518-184523540 TATTTGGTCTTACATCTATCTGG - Intronic
967265075 3:187683443-187683465 GATATGATCAGATATGTATCCGG - Intergenic
971428546 4:26539949-26539971 AATTTTCTCTCATATATATCAGG - Intergenic
971935237 4:33139022-33139044 GATTTTCTCTGAAAGCTACCTGG + Intergenic
973809110 4:54552920-54552942 GATTTGCACACATATCTTTCTGG - Intergenic
976030358 4:80744869-80744891 GATTTGCTGTCATATATATAAGG - Intronic
977407920 4:96623522-96623544 GATTGGCTCTGCTATCTCTTTGG + Intergenic
979453259 4:120898072-120898094 GATTTACCCTGTTTTCTATCAGG + Intronic
980717732 4:136649698-136649720 GATTTGCTCTGATGTTTTTAAGG + Intergenic
985862649 5:2486191-2486213 GATTTACTCAGAAAACTATCAGG - Intergenic
992916676 5:81461713-81461735 GATTTGCTCTGGCCACTATCTGG - Intronic
993538586 5:89119560-89119582 AATTTACTCTGATATATATTTGG + Intergenic
997153149 5:131521389-131521411 CAGTTTATCTGATATCTATCAGG - Exonic
999478377 5:151922852-151922874 AATTTGCTCTTAAATCTCTCTGG + Intronic
1001262850 5:170247012-170247034 TAGTTGCTTTGAAATCTATCAGG + Exonic
1002413181 5:179100620-179100642 GATTTTCTTTAATATCTCTCAGG - Intergenic
1003967162 6:11263904-11263926 GAGATGCTCTGATATCTACATGG - Intronic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1008883649 6:56408906-56408928 GAATTGAACTGATATGTATCAGG + Intergenic
1017274861 6:152554313-152554335 GATTTGCTCCTATTTCTATTTGG + Intronic
1021171469 7:17402947-17402969 GATTAGCTCTGATATCCACCGGG - Intergenic
1023218249 7:37888916-37888938 TTTTTGGTTTGATATCTATCAGG + Intronic
1023627945 7:42135426-42135448 GATTTGACCTGAGATATATCTGG - Intronic
1026473179 7:70711600-70711622 GATTTGCTCTGACATGAACCAGG - Intronic
1030620144 7:111780459-111780481 GATTTGCTCTAATAGCTTTCTGG + Intronic
1032658588 7:133957982-133958004 GATTGGCTGTGATTTCTACCTGG - Intronic
1033671314 7:143496116-143496138 GATTTCCTGTGATATCTGTGTGG + Intergenic
1037895978 8:22655967-22655989 GATTTGCTTTGCTAAGTATCAGG - Intronic
1038216910 8:25570118-25570140 GATTTGTTCTGATTTATCTCTGG + Intergenic
1040640012 8:49322076-49322098 AATTTCCTCTAATATCTATCAGG + Intergenic
1043462822 8:80478043-80478065 CATTTGCTTTGAGAACTATCTGG - Intergenic
1044195077 8:89366409-89366431 GATTTGCTCTGAGAAATAACTGG + Intergenic
1045680632 8:104655964-104655986 GATTTGCTCTCATTTGTATCGGG - Intronic
1052520662 9:29545051-29545073 AATTTGCTGTGGTATCTAGCAGG - Intergenic
1058480660 9:105390968-105390990 GATTTGCTCTCTCATCTATTTGG - Exonic
1185741620 X:2537716-2537738 GCGTTGCTCTGCTATCTATTAGG + Intergenic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1190336796 X:49267483-49267505 GAGTTCCTCAGATATCTAGCTGG - Intergenic
1190463923 X:50707080-50707102 GATTTGCTCTTAAATTTTTCAGG - Intronic
1191885548 X:65884257-65884279 GATTTTCTCTCATACCTCTCTGG + Intergenic
1193747213 X:85297366-85297388 GATTTGCTGTAATTTCTATGAGG + Intronic
1195746150 X:108120766-108120788 GACTTGCCCTGAAATTTATCAGG + Intronic
1197904108 X:131405590-131405612 CATTTGCTCTGATCTTTCTCTGG + Intergenic
1198439586 X:136650026-136650048 GAATAGCTCTGATTTCTACCTGG + Intronic