ID: 1007094594

View in Genome Browser
Species Human (GRCh38)
Location 6:39205496-39205518
Sequence GGCCATAGCCACCCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007094594_1007094607 27 Left 1007094594 6:39205496-39205518 CCCTGCCCAGGGTGGCTATGGCC 0: 1
1: 0
2: 4
3: 21
4: 198
Right 1007094607 6:39205546-39205568 CTGCCCTATCTGGGACACTGAGG 0: 1
1: 0
2: 2
3: 20
4: 193
1007094594_1007094602 -1 Left 1007094594 6:39205496-39205518 CCCTGCCCAGGGTGGCTATGGCC 0: 1
1: 0
2: 4
3: 21
4: 198
Right 1007094602 6:39205518-39205540 CCAGGTCCATGGTCCTGTGCTGG No data
1007094594_1007094606 18 Left 1007094594 6:39205496-39205518 CCCTGCCCAGGGTGGCTATGGCC 0: 1
1: 0
2: 4
3: 21
4: 198
Right 1007094606 6:39205537-39205559 CTGGTGTCTCTGCCCTATCTGGG No data
1007094594_1007094605 17 Left 1007094594 6:39205496-39205518 CCCTGCCCAGGGTGGCTATGGCC 0: 1
1: 0
2: 4
3: 21
4: 198
Right 1007094605 6:39205536-39205558 GCTGGTGTCTCTGCCCTATCTGG 0: 1
1: 0
2: 0
3: 19
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007094594 Original CRISPR GGCCATAGCCACCCTGGGCA GGG (reversed) Intronic
900470817 1:2854104-2854126 GGCCCTGGCCAGCCTGGGCCTGG - Intergenic
900546649 1:3233191-3233213 GGCCACCCCCACCCTGGGCAGGG - Intronic
901011670 1:6206000-6206022 GGCAGCAGCCACCCTGGGGAAGG + Intronic
902410476 1:16208819-16208841 GGCCATAGCAACCCTTGGAGAGG + Exonic
902533689 1:17106720-17106742 GGCGTGAGCCACCCTGGCCAAGG + Intronic
902672421 1:17983968-17983990 GGGCACAGCCTCCCTGGGTAAGG + Intergenic
903263025 1:22141658-22141680 GGTCAGAGCCACCCAGGGCTTGG - Intronic
903367651 1:22815013-22815035 GGCCGTCACCACGCTGGGCAGGG + Intronic
904773980 1:32895638-32895660 GACCTTTGCCACCCAGGGCAAGG - Exonic
904962780 1:34347831-34347853 GGCCTTGCCCACCATGGGCAGGG - Intergenic
905173432 1:36122578-36122600 GGCCACAGCCATCCAGTGCAAGG + Intronic
905466587 1:38158944-38158966 TGGCATAGGCACCATGGGCAAGG - Intergenic
905802867 1:40856601-40856623 GGCCAGATCCAGCCTGGGAAGGG + Intergenic
906678236 1:47708622-47708644 GGCCTTCCCCTCCCTGGGCACGG - Intergenic
907461342 1:54607497-54607519 AGCCTGAGCCACCCTGGGTAAGG - Intronic
908535781 1:65075831-65075853 GGCCTTCGCCATCCTGTGCATGG + Intergenic
914451995 1:147800682-147800704 GGTCATAGGCAGCCTGGGTAGGG - Intergenic
914975057 1:152353566-152353588 GGACATGGCCACTCTGGTCATGG - Exonic
916026912 1:160841065-160841087 GGCCAGGGCTACCCTGGGAAGGG + Intronic
918040837 1:180913028-180913050 GGCCAGACCCACCCGGGGCCCGG + Intergenic
919924716 1:202186377-202186399 GGCAAGGGCCACCCAGGGCATGG + Intergenic
920561665 1:206943086-206943108 AGCCCCAGCCACCCTGGGCTGGG - Intronic
920616890 1:207502418-207502440 GGCCATAGGCAGGCTGGGGAAGG + Intronic
1064107604 10:12513237-12513259 GGACACAGCCACCCTGGACGCGG + Intronic
1065033570 10:21613697-21613719 GTTCAGAGCCACCCTGGGCAAGG + Intronic
1065793456 10:29283065-29283087 GGTCTGAGCCACCCTGGGAATGG - Intergenic
1067041305 10:42954597-42954619 GGCCACAGCCACCGAGAGCATGG - Intergenic
1074861245 10:117512089-117512111 TCCCATAGGAACCCTGGGCAGGG - Intergenic
1075275008 10:121085506-121085528 GGCCACAGCCACAATGGGCGGGG - Intergenic
1076093679 10:127712921-127712943 GCCCATTGCCATCCTGTGCAGGG + Intergenic
1076625299 10:131818138-131818160 GGCCAGAGGCACCCGAGGCAGGG - Intergenic
1077369007 11:2172862-2172884 GCCAGAAGCCACCCTGGGCAGGG - Intergenic
1078354838 11:10625863-10625885 GGCCAGAGCTGCCCTGGCCAGGG + Intronic
1082001315 11:47395040-47395062 GGCCCTCGCCAGCCTGGGCCAGG + Intergenic
1082006732 11:47423438-47423460 GTCCATAGCCAGCCTGGGTGGGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085055521 11:73401366-73401388 GGCCTTACCCCCCCTGGGTAAGG + Intronic
1085315947 11:75545036-75545058 AGCCAGGGCCACCCTGGGAATGG + Intergenic
1088812235 11:113399634-113399656 GGCCGTAGCCGCTCTGGTCAAGG - Exonic
1089150230 11:116358451-116358473 GTACAGAGCCACCCAGGGCAGGG - Intergenic
1089443334 11:118533320-118533342 GTCCCCAGCCACCCTGGGCAAGG + Intronic
1090105856 11:123853292-123853314 GGACATCCCCACTCTGGGCAAGG + Intergenic
1091209195 11:133842211-133842233 GGCCGTGGCCACACTGGGCCTGG + Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1094497099 12:30995276-30995298 TCCCAGAGCAACCCTGGGCAGGG + Exonic
1095982819 12:47982597-47982619 GGCCAGATGCACCCTGGGGAGGG + Exonic
1096070618 12:48773686-48773708 GGCCACAGCACCCTTGGGCAGGG + Intronic
1096241442 12:49962170-49962192 GGCCATAGGCACGCTGGCCCAGG + Exonic
1097034184 12:56111812-56111834 GGCCAAAGCAAGGCTGGGCATGG - Intronic
1101122462 12:101597332-101597354 GGTCATGGCCTTCCTGGGCATGG - Intronic
1102591206 12:113958151-113958173 GGCCATGGACACGGTGGGCATGG - Intronic
1104946202 12:132415862-132415884 GGCCACAGCCAGGCTGGGGAGGG + Intergenic
1108744374 13:53376583-53376605 AGCCAGAGGGACCCTGGGCAAGG - Intergenic
1110261640 13:73491620-73491642 GTCCACAGCCACCCTGGGAGGGG - Intergenic
1110614385 13:77524757-77524779 AGCCATAGCCACCATGGGAAAGG - Intergenic
1112261290 13:97880616-97880638 GACCATACCCACCCTGCCCAAGG + Intergenic
1113484941 13:110646713-110646735 GCCCAAAGCCACTCTGAGCAGGG + Intronic
1115378202 14:32702731-32702753 GGCCAGAGCCAGCCAGGCCAGGG - Intronic
1117147170 14:52846987-52847009 GGCCACAGCGACCCGGGCCAGGG - Intergenic
1117736972 14:58777539-58777561 AGCCATGGGAACCCTGGGCAGGG - Intergenic
1117989546 14:61420245-61420267 GCCCAGAGCCACTCTGGGCCTGG + Intronic
1118470374 14:66069610-66069632 GGCAGCAGCCACCCTGGGCTTGG + Intergenic
1119485242 14:74982518-74982540 GGAGAGAGCCAGCCTGGGCAAGG - Intergenic
1119883878 14:78124002-78124024 TGCCCTAGCCACCCTGGCCTTGG + Intergenic
1120848391 14:89146750-89146772 GGCCATAGAGAACCTGGCCATGG + Intronic
1122363016 14:101178593-101178615 GTCCAAAGCGACCCTGTGCAGGG + Intergenic
1123026265 14:105425759-105425781 GGCCCCAGCCTCCCTGGGCTTGG - Intronic
1124371732 15:29108016-29108038 GGGCAGAGGCACCCTGCGCATGG + Intronic
1124937432 15:34186370-34186392 GGCTGTAGCCCACCTGGGCAGGG - Intronic
1125329029 15:38564610-38564632 GGCCATGGGCACCCTGGGCAAGG - Exonic
1129465953 15:75724323-75724345 AGCCATCCCCACCCTGGGCTTGG + Intronic
1132467191 16:82783-82805 GGCCACAGCCAGGCTGGGCTGGG - Intronic
1132954822 16:2585985-2586007 GGCCAGAGAGTCCCTGGGCAAGG - Intronic
1134518830 16:14908544-14908566 GGGCAGAGCCAGCCTGGGCAGGG - Intronic
1134555098 16:15157680-15157702 GGGCAGAGCCAGCCTGGGCAGGG + Intergenic
1134706501 16:16307199-16307221 GGGCAGAGCCAGCCTGGGCAGGG - Intergenic
1134961039 16:18404925-18404947 GGGCAGAGCCAGCCTGGGCAGGG + Intergenic
1134965341 16:18487528-18487550 GGGCAGAGCCAGCCTGGGCAGGG + Intronic
1135172043 16:20193393-20193415 GGCCACAGCCAACCTTGCCAAGG + Intergenic
1135400432 16:22162890-22162912 CGCCAGACCCACCCTGGACATGG - Intergenic
1136268301 16:29133439-29133461 GGCCAGCTCCAGCCTGGGCACGG - Intergenic
1138652125 16:58466559-58466581 GGCCTCATCCACCCTGGCCAGGG - Intronic
1139581463 16:67876392-67876414 GGACATAGCCAGACTGGGGAAGG - Intronic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1142071609 16:88093773-88093795 GGCCAGCTCCAGCCTGGGCAGGG - Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142118390 16:88373250-88373272 GGCCACAGTCACCCTGTGCCAGG + Intergenic
1142135116 16:88448414-88448436 TGCCTGGGCCACCCTGGGCAGGG - Intergenic
1143783382 17:9240747-9240769 GGCCAGCCCCACGCTGGGCAGGG - Exonic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1145260474 17:21351814-21351836 GGCCCCACCCACCCTGGGCGTGG - Intergenic
1145282534 17:21478326-21478348 GTCCATCACCCCCCTGGGCAGGG - Intergenic
1146546304 17:33741769-33741791 TGCCATAGCCTGCCTGAGCATGG - Intronic
1146705768 17:34999637-34999659 GGTCATACCCACTCTGGGCTGGG + Intronic
1147668529 17:42163712-42163734 GGCCCTGGCCAGCCAGGGCAGGG + Exonic
1150177385 17:63073993-63074015 CGCCAAAGCCGCTCTGGGCAAGG + Exonic
1151333322 17:73424055-73424077 GGACGGGGCCACCCTGGGCACGG - Exonic
1151422148 17:74005568-74005590 GGCCAAAGCCGCCCTGAGCCAGG + Intergenic
1151658273 17:75505779-75505801 GGCCCCAGGCCCCCTGGGCAGGG + Intronic
1151718398 17:75842982-75843004 GGCCAGGGTCCCCCTGGGCAAGG - Intronic
1151727315 17:75892545-75892567 GGCCCTAGCCTCCCTTGGTATGG - Intronic
1151908025 17:77061915-77061937 GGCCAGAGCCACCCTGAGCAGGG - Intergenic
1152278756 17:79372989-79373011 GGCCCCATCCACCCTGGGCTGGG - Intronic
1152491435 17:80637251-80637273 ACCCAGAGCCACGCTGGGCATGG - Intronic
1152499126 17:80696584-80696606 GGCCATGGCCTCCCGGGGCAAGG + Intronic
1152515660 17:80822319-80822341 GGCCATAGCCTCCCTCCCCAAGG - Intronic
1152600445 17:81259573-81259595 GGCAGTAGCCACCCAGGCCACGG + Intronic
1152765324 17:82134182-82134204 TGCAACAGCCACCCTGGGAATGG + Intronic
1154087945 18:11325660-11325682 GGACAGAGACACTCTGGGCAAGG - Intergenic
1155740404 18:29281881-29281903 TGCCAGAGCCTCCCTGAGCAGGG + Intergenic
1156687413 18:39666680-39666702 TGCCAGTGCCACCCTGGGCCTGG + Intergenic
1157583560 18:48787226-48787248 GGTCACAGCCATCCTGGGCTGGG - Intronic
1158543231 18:58375154-58375176 GGGCACAGCAAGCCTGGGCACGG - Intronic
1160156790 18:76441038-76441060 GGGCACAGGGACCCTGGGCAAGG + Intronic
1160870906 19:1277423-1277445 GGCCATGGCCCCACTGGGCAGGG + Intronic
1161063878 19:2228211-2228233 GGCCAGGGCCAGCCGGGGCAGGG - Intronic
1161513074 19:4682578-4682600 GGCCTGAGGCTCCCTGGGCAGGG + Intronic
1162324938 19:9993421-9993443 GGCCAAAGTCACCCTGGAGAGGG + Exonic
1163534475 19:17869281-17869303 GGCCATCACCACCCTGGGGTGGG + Intergenic
1166884868 19:45954218-45954240 GCCCACAGCAGCCCTGGGCAGGG + Intronic
1167240531 19:48340638-48340660 GGCAATAGTCACCGTGGGCTGGG + Intronic
1168325332 19:55536072-55536094 GGCCATAGCAACCCTGGCCCAGG + Exonic
925014051 2:508394-508416 GGCGAGAGCCAACCTAGGCAAGG + Intergenic
927252004 2:21004322-21004344 AGCCGTAGGCACCGTGGGCATGG - Exonic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
929545968 2:42855415-42855437 GGCCAGGGCCACTCTGGGTAGGG - Intergenic
930718888 2:54619830-54619852 TGCCTTAGTGACCCTGGGCAGGG + Intronic
935349850 2:102143399-102143421 GGCCTTAACCACACTGGGGAGGG + Intronic
935823330 2:106916080-106916102 GGCCATAGCCAGACTGGCCTTGG - Intergenic
937880535 2:126861179-126861201 GGCCATACCTGCCCTGAGCAGGG - Intergenic
942668531 2:178348482-178348504 GTCCATATCCAGCCTGGGCAAGG + Intronic
947851403 2:233291565-233291587 GCTAACAGCCACCCTGGGCAGGG - Intronic
948429762 2:237911974-237911996 GGCCACCGCCACCCTAGGAAGGG + Exonic
948660866 2:239505766-239505788 ACCCATGGTCACCCTGGGCATGG - Intergenic
948776773 2:240293296-240293318 GGCCCTTGCCTCACTGGGCAGGG - Intergenic
948776797 2:240293384-240293406 GACCACAGCCTCCCTGGACACGG - Intergenic
948789350 2:240369407-240369429 GGCCATAGTCACTCAGGGCTTGG - Intergenic
1170431458 20:16280421-16280443 GGCCAAGGCCAGCCTGTGCAAGG + Intronic
1176022369 20:62968297-62968319 CGCCATGGCCATGCTGGGCAGGG - Exonic
1176271621 20:64238271-64238293 GGGCAGAGCCCCTCTGGGCAGGG + Intronic
1176363755 21:6020063-6020085 GGCTCTAGCCAGCCTGGGCATGG - Intergenic
1176407621 21:6430079-6430101 GGCCATAGCCAGCCTGTGCATGG + Intergenic
1179617384 21:42590684-42590706 GGCCAGAGACACCTTTGGCAAGG - Intergenic
1179683112 21:43038410-43038432 GGCCATAGCCAGCCTGTGCATGG + Intergenic
1179759763 21:43518482-43518504 GGCTCTAGCCAGCCTGGGCATGG + Intergenic
1179922866 21:44516554-44516576 GGCCGAACCCACCCTGGGCGCGG - Intronic
1180103120 21:45599172-45599194 GGCCAGAGCCATCCTAGCCAGGG - Intergenic
1181689966 22:24553808-24553830 GGCCATCTCCAGCCTCGGCAAGG + Intronic
1183343585 22:37295010-37295032 GGCCACATCCACCCTGGGATGGG + Intronic
1183663738 22:39235622-39235644 GGCCACACCCATCCAGGGCAGGG - Intronic
1184728698 22:46361107-46361129 TTCCACGGCCACCCTGGGCATGG + Exonic
1184772747 22:46607506-46607528 GGCCATAGCCACACTTCGTAAGG - Intronic
1185244781 22:49767605-49767627 GTCCATAGGTTCCCTGGGCATGG - Intergenic
950476599 3:13219001-13219023 CGCCACAGCCACCCTGGTCCAGG + Intergenic
952234507 3:31464777-31464799 GGCCAGAGCCAGTCTGTGCATGG - Intergenic
953753438 3:45627103-45627125 GGCCCTTGGAACCCTGGGCATGG - Intronic
957146717 3:76434415-76434437 GGCCATAGCCACCCAGCCCAGGG - Intronic
961042797 3:123689175-123689197 GTCCCCAGCCACCCTGGCCAGGG - Intronic
961676977 3:128573600-128573622 GCCCCTAGGCACCCTGGGCCAGG - Exonic
962265610 3:133942397-133942419 GCACAGAGCCTCCCTGGGCAGGG + Intronic
964427017 3:156564428-156564450 TGCCTTAGCCACCCTTTGCAAGG + Intergenic
966191106 3:177272340-177272362 GGCCATTGCCACCCTCTTCAGGG + Intergenic
968006944 3:195249581-195249603 CGACCTAGTCACCCTGGGCAGGG - Intronic
968713373 4:2137035-2137057 GGACACAGCCTCCCGGGGCAGGG + Intronic
968830673 4:2931696-2931718 GGGCAGGGCCACCCAGGGCAGGG + Intronic
969436336 4:7191633-7191655 GGCCAGGGCCACCCTGCCCATGG - Intergenic
973274680 4:48294190-48294212 GGCCTTAGCCACCCAGTCCATGG + Intergenic
973734456 4:53856760-53856782 TTCCAAAGTCACCCTGGGCATGG + Intronic
975614377 4:76231823-76231845 GACCATAGGAACCCTGTGCAGGG + Intronic
977846994 4:101778372-101778394 GGCCATAGCCAGACTGGCCTTGG + Intronic
978317221 4:107451809-107451831 GGCCATATTCCCACTGGGCAGGG + Intergenic
982600699 4:157444444-157444466 GACCTTTGCAACCCTGGGCACGG - Intergenic
985969779 5:3365878-3365900 GGCCATGGCCCTTCTGGGCATGG - Intergenic
992199490 5:74369432-74369454 GGCCCTGGCCACACTGGGAACGG - Intergenic
1001052132 5:168422116-168422138 GGCCACTGCTCCCCTGGGCATGG + Intronic
1001426212 5:171624185-171624207 TGCCACAGCCACCCTGGGGTGGG + Intergenic
1001753289 5:174147664-174147686 GGCCAGACCCATGCTGGGCAGGG - Intronic
1003149948 6:3539988-3540010 GGCCCAAGGCACACTGGGCAGGG - Intergenic
1005363818 6:25057394-25057416 GGCAATAGCCAGCAGGGGCAGGG + Intergenic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1007383512 6:41505109-41505131 GGCCAAGGCCGCCCTGGGCAGGG + Intergenic
1007623054 6:43226465-43226487 GTCCATACCCACCCTGCTCAGGG + Intronic
1008096243 6:47342529-47342551 GACCATGGCCATCCTGGTCATGG + Intergenic
1009803593 6:68573555-68573577 GGGCAGAGCATCCCTGGGCAGGG + Intergenic
1013472608 6:110477949-110477971 GCCCATAGCCAACCCAGGCAGGG + Intergenic
1015603459 6:134932974-134932996 GGCCTCACCCACCCTGGGCCCGG + Exonic
1015897446 6:138030978-138031000 GGCCAAAGCCAGCCTGGGTGAGG + Intergenic
1019557457 7:1639853-1639875 GTCCAGAGCCACCCTGGTCTGGG + Intergenic
1020137833 7:5596422-5596444 GCCCAGAGCTGCCCTGGGCAGGG + Intronic
1022469085 7:30670934-30670956 GGCCTGGGCCACTCTGGGCATGG - Intronic
1023031702 7:36095390-36095412 TGCCACCGCCACCCTGGCCATGG + Intergenic
1023990553 7:45125970-45125992 GGCCCTAGCCAGTCTGGTCAGGG - Intergenic
1027320473 7:77006914-77006936 GGCCGGGACCACCCTGGGCAGGG - Intergenic
1031609009 7:123803131-123803153 GGCCACAGACTCCATGGGCAAGG + Intergenic
1032095654 7:128937537-128937559 GGCGAGAGCCACCCTCGCCAGGG + Intergenic
1035160757 7:156948907-156948929 GTCCAAACCCAGCCTGGGCAGGG + Intergenic
1035780476 8:2223661-2223683 GGCCAAAGCAACCCTGGGCTGGG - Intergenic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1037861989 8:22411997-22412019 GGCCAGCCCCACCCAGGGCAGGG - Intronic
1038051893 8:23821712-23821734 AGCCATAGCCACCATTGCCATGG - Intergenic
1038165932 8:25085096-25085118 GGCCAGAGCCAGTCTAGGCAGGG + Intergenic
1039989326 8:42474902-42474924 GGCCAGAGTCACGCTGGGCCTGG + Intronic
1041472856 8:58230598-58230620 GCCCTTAGCCACCCTGTTCAAGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1046762981 8:118040714-118040736 GGCAATAAGCTCCCTGGGCAGGG + Intronic
1049783731 8:144440637-144440659 GTCCATGGCCACCCTGAGAACGG + Intronic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1056167982 9:83956938-83956960 GGGCATCGCGACCCAGGGCAAGG - Intronic
1057035939 9:91811653-91811675 GGCCACAGACACCCAGGGCCGGG + Intronic
1057513055 9:95696984-95697006 GGACAAAGCCAGCCTGAGCAAGG + Intergenic
1057841116 9:98486190-98486212 GACCACACCCACCCGGGGCAAGG - Intronic
1060104574 9:120865818-120865840 AACCACATCCACCCTGGGCAAGG + Exonic
1060104733 9:120866529-120866551 TCCCACAGCAACCCTGGGCAGGG + Intronic
1062145585 9:134988013-134988035 GGCCTTCCCCACCCTGGGAATGG + Intergenic
1186107820 X:6226408-6226430 GGCCCGGGCCACCCTGGGAACGG - Intronic
1186374973 X:8988933-8988955 GACCTTTGCAACCCTGGGCATGG - Intergenic
1190291157 X:48993298-48993320 GTCCAAAGCCACACAGGGCATGG + Intronic
1190732553 X:53234922-53234944 GGCCATAGCCACGGTGGCCTGGG - Exonic
1191604979 X:63051223-63051245 GGCCACAGATTCCCTGGGCAGGG + Intergenic
1192340477 X:70259619-70259641 GGCCATGGCCCCCCTGGAGATGG + Exonic
1196736186 X:118982841-118982863 AGCCTTAGCCACCCTAGGCAAGG + Exonic
1198157927 X:133981161-133981183 CACAATAGCCAGCCTGGGCAAGG - Intronic
1200982337 Y:9273617-9273639 GGCAATTGCCACCCTGGAAAGGG + Intergenic