ID: 1007096305

View in Genome Browser
Species Human (GRCh38)
Location 6:39215311-39215333
Sequence CCTTCAGAGCAGCGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007096305_1007096314 3 Left 1007096305 6:39215311-39215333 CCTTCCACTCGCTGCTCTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 295
Right 1007096314 6:39215337-39215359 CAGGGATGCTGAGAAGAGAAGGG 0: 1
1: 1
2: 2
3: 52
4: 632
1007096305_1007096317 30 Left 1007096305 6:39215311-39215333 CCTTCCACTCGCTGCTCTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 295
Right 1007096317 6:39215364-39215386 CTTCCAAAGCTAACACTGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 135
1007096305_1007096313 2 Left 1007096305 6:39215311-39215333 CCTTCCACTCGCTGCTCTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 295
Right 1007096313 6:39215336-39215358 GCAGGGATGCTGAGAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007096305 Original CRISPR CCTTCAGAGCAGCGAGTGGA AGG (reversed) Intronic
902144368 1:14385464-14385486 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
902664131 1:17925762-17925784 CCTTCAGAGGAGCAAGTGTGGGG + Intergenic
905329954 1:37187542-37187564 CCTGCACAGCAGTGAGTGGGTGG - Intergenic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
909414077 1:75385047-75385069 CATTCAAAGCAGCGTGTAGAGGG + Intronic
910157128 1:84232072-84232094 CATTCAAAGCAGTGTGTGGAGGG - Intronic
912097734 1:106166136-106166158 CGTTCAAAGCAGTGTGTGGAGGG + Intergenic
913504168 1:119500639-119500661 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
913506628 1:119522640-119522662 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
914755905 1:150561504-150561526 CCTTGAGAGAAGCGAGTAGGAGG - Intergenic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
914996828 1:152550944-152550966 CATTCAAAGCAGTGTGTGGAGGG - Intronic
915317461 1:155037198-155037220 CCACCAGAGCACAGAGTGGAGGG - Intronic
915628892 1:157137080-157137102 CCTTCTGGCCAGTGAGTGGAAGG + Intronic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
918021924 1:180702088-180702110 CATTCAAAGCAGCGTGTAGAGGG - Intronic
918035717 1:180869967-180869989 CATTCAAAGCAGCGTGTAGAGGG - Intronic
922252798 1:223864878-223864900 GCTGCAGAGCAGCGAGGGCAAGG + Intergenic
924411463 1:243810022-243810044 CATTCAAAGCAGCGTGTAGAGGG + Intronic
1065230424 10:23592936-23592958 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1066749205 10:38635635-38635657 GCTTCGGAGCTGCGAGTGGGCGG - Intergenic
1066967453 10:42282157-42282179 GCTTCGGAGCTGCGAGTGGGCGG + Intergenic
1067236094 10:44451379-44451401 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
1067301248 10:45012324-45012346 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1069149404 10:64938290-64938312 TCTTCAGAGAATGGAGTGGATGG + Intergenic
1069862507 10:71480455-71480477 CCTTCAGAGCAGCCTGTGCTGGG - Intronic
1071210878 10:83340523-83340545 CATTTAGAGCAGCGTGTAGACGG - Intergenic
1072685145 10:97532140-97532162 CCGGGAGAGCAGCCAGTGGAGGG + Intronic
1073609843 10:104932264-104932286 ACTTCAGAGAAGAGAGTGGTAGG - Intronic
1074260448 10:111848396-111848418 CCTTCAGACCTGTGATTGGAGGG - Intergenic
1075484444 10:122810538-122810560 CATTCAGAGCAGTGTGTAGAGGG + Intergenic
1080983402 11:37432994-37433016 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
1081172867 11:39890229-39890251 CATTCAAAGCAGTGAGTAGAGGG + Intergenic
1082638181 11:55622286-55622308 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1082876824 11:57997315-57997337 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
1083150191 11:60787064-60787086 CCTTCAGTTCTGGGAGTGGAGGG - Intronic
1083234774 11:61344325-61344347 CCTTCAGGGAAACAAGTGGAAGG - Intronic
1084265910 11:68005002-68005024 CCTAAAGAGCAGTGGGTGGAGGG - Intergenic
1086687258 11:89747041-89747063 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1087252135 11:95914391-95914413 CCTGCAGGGCAGGGAGTGGTGGG + Intronic
1088490790 11:110385938-110385960 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089305174 11:117521963-117521985 AGTTCTGAGCAGCGAGTGGCTGG - Intronic
1090381005 11:126327890-126327912 CCCTCACAGCAGCAGGTGGATGG - Intronic
1092025113 12:5233283-5233305 CAGGCAGAGCACCGAGTGGAGGG + Intergenic
1092051505 12:5474035-5474057 CCTTCAGAGAAGAGAGAGCATGG + Intronic
1095104035 12:38210189-38210211 CGTTGAAAGCAGCGTGTGGAGGG + Intergenic
1096774024 12:53953319-53953341 CCTGCAGAGGAGAGAGGGGAGGG + Intergenic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1098062852 12:66581244-66581266 CATTCAAAGCAGCGTGTAGAGGG + Intronic
1099737517 12:86588892-86588914 CATTCAAAGCAGTGAGTAGAGGG + Intronic
1100206948 12:92360523-92360545 CCTGCAGAGCAGCTAGAGAAAGG + Intergenic
1104173137 12:126302166-126302188 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105892297 13:24690377-24690399 CCTTCAGAGCAGCTGGTGGTGGG + Exonic
1106083468 13:26519738-26519760 CCTGCAGAGCAGCCACTGGGAGG - Intergenic
1106357426 13:28997046-28997068 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1106801017 13:33255739-33255761 CCTCCAGGGCAGGGAGGGGACGG + Intronic
1109443137 13:62400363-62400385 CCTTCAGAGCTGACAGAGGAGGG - Intergenic
1111424267 13:88058595-88058617 CCTTCATAGCAGCGTGAGAACGG + Intergenic
1113264930 13:108606826-108606848 CCATGAAAGCAGGGAGTGGAAGG + Intronic
1113457475 13:110458749-110458771 CCTGCAGAGGAGGGAGAGGAGGG - Exonic
1114741793 14:25105093-25105115 CCCTCAGAGCACCGGGGGGAAGG + Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1114930534 14:27461887-27461909 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1115799565 14:36977278-36977300 CCTTCATAGCAGGAAGGGGAAGG - Intronic
1116618976 14:47174638-47174660 CATTCAAAGCAGTGAGTAGATGG + Intronic
1117465677 14:55991338-55991360 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1117468342 14:56017166-56017188 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1117913136 14:60653098-60653120 TTTTCAGAACAGCAAGTGGATGG - Intronic
1121340501 14:93102223-93102245 TCCCCAGAGCAGCGAGAGGATGG + Intronic
1121637183 14:95461818-95461840 CTTTCAGAGCAGGGACTGGGAGG + Intronic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1202846374 14_GL000009v2_random:180985-181007 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1202915838 14_GL000194v1_random:171587-171609 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1124911133 15:33921916-33921938 CCTTAAGAGCAGGGAGCGGAGGG + Intronic
1126966251 15:54057951-54057973 CATTCAGAGCAGTGTGTAGAGGG + Intronic
1127677722 15:61258953-61258975 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1128637680 15:69313726-69313748 CCTTCAGGGTGGCCAGTGGATGG + Intronic
1132240799 15:100255851-100255873 CCCTCAGGGCAGCCATTGGATGG - Intronic
1133031041 16:3011408-3011430 CCTCCAGAGTGGCGAGTGGCTGG + Intergenic
1133055643 16:3144288-3144310 CTTTGAGAGCTGCGAGAGGAGGG + Exonic
1135470012 16:22721876-22721898 CCTCCAGAGCAGCTGGTGAAAGG - Intergenic
1135583775 16:23651255-23651277 CCTTCAGAGAAGCAAATGAAAGG - Intronic
1137224778 16:46492830-46492852 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1139554408 16:67697731-67697753 CCCCCAGAGCAGACAGTGGAAGG - Intronic
1141154596 16:81588371-81588393 CCTTCAGAGAATCAACTGGAAGG - Intronic
1142761283 17:2043179-2043201 CACTCACAGCAGTGAGTGGAGGG - Exonic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1144521161 17:15953100-15953122 CCTGCAGAGCTGGGAGTGCAGGG + Intronic
1145414533 17:22703905-22703927 GCTTCAGACCAGCAAGGGGAGGG - Intergenic
1145984567 17:29036695-29036717 CCTTCAGACCAGGAGGTGGAGGG - Intronic
1147519985 17:41161437-41161459 CCCTCAGAGCAGAGAGCGGAGGG - Intergenic
1147885249 17:43679860-43679882 CCTTCAGAGAAGCAAATGGCTGG + Intergenic
1148821751 17:50364027-50364049 CCTTCAGAGCAGGGGTTGGGGGG - Intergenic
1149501933 17:57159438-57159460 CCTTCATAGCAGCGTGAGAATGG + Intergenic
1149549696 17:57531201-57531223 CCTTCACAGCAGCCCCTGGAGGG + Intronic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1151945429 17:77317197-77317219 CCTGCAGAGCTGTGAGAGGATGG - Intronic
1153089529 18:1328208-1328230 CCTTCTGAACAGCAAGGGGAAGG + Intergenic
1154194092 18:12253620-12253642 CCATGAGAGCAGGGTGTGGACGG + Intergenic
1158483795 18:57846509-57846531 CATTCAGAGCAGAGAGGAGAGGG + Intergenic
1159317538 18:66797778-66797800 CCTTCATAGCAGCGTGAGAATGG - Intergenic
1159349517 18:67253619-67253641 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1160509326 18:79444481-79444503 CCTCCAGAGCAGCGAGGGCTCGG - Intronic
1164307391 19:24016524-24016546 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1165600476 19:37051871-37051893 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1166440328 19:42808604-42808626 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
925448647 2:3950399-3950421 CCTGCAGAGCCGCCAGTGAAGGG + Intergenic
926225491 2:10964284-10964306 CCAGCAGAGCGGGGAGTGGATGG - Intergenic
926924855 2:17976972-17976994 CCTTCAGGACAGCAAGAGGAGGG + Intronic
928549118 2:32354641-32354663 CCTTCAGAGCCCCCAGTGGAGGG - Intergenic
928739637 2:34335494-34335516 CTTTCAGAGGAACAAGTGGACGG - Intergenic
929726217 2:44430461-44430483 CCTTCAGTGCAGAGAATAGATGG + Intronic
929897542 2:45975022-45975044 CCTTCAGAGCAGCGTGTGGGTGG + Intronic
930204295 2:48572853-48572875 CCCTCAGAGCAGGGAGAGCAGGG - Intronic
930276234 2:49314414-49314436 CATTCAGAGCAGTGTGTAGAGGG + Intergenic
930555051 2:52885089-52885111 CCTTCAGAATAGCAAGTGGAGGG + Intergenic
934983747 2:98869395-98869417 CCTTCAGGGCTTGGAGTGGAAGG - Intronic
935421775 2:102877178-102877200 CATTCAAAGCAGTGAGTAGAGGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
937659154 2:124410719-124410741 CATTCAGAGCAGTGTGTAGAGGG + Intronic
939838091 2:147153775-147153797 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
942784896 2:179689464-179689486 CGTGCAGAGCAGCGCATGGAGGG + Intronic
943145768 2:184043035-184043057 CCTTCATAGCAGCATGTGAACGG + Intergenic
943303680 2:186233291-186233313 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
944405367 2:199377922-199377944 CCATGAGAGCAGAGAGTGGAAGG + Intronic
945171757 2:207003752-207003774 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
946767891 2:223057003-223057025 CTTTCAGAGCTGCAACTGGAGGG + Intronic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
948821132 2:240547352-240547374 CATTCAAAGCAGCGTGTAGAGGG + Intronic
1170983290 20:21235823-21235845 CCACCAGAGCGGCCAGTGGAGGG + Intronic
1175503257 20:59465115-59465137 CCTTTATAGCAGTGTGTGGAGGG + Intergenic
1176350259 21:5788112-5788134 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1176357073 21:5908696-5908718 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1176544580 21:8186182-8186204 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1176563531 21:8369227-8369249 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1176635191 21:9186234-9186256 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1180414957 22:12700562-12700584 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1182004915 22:26951933-26951955 CCTTCAGGGAATAGAGTGGAAGG - Intergenic
1182132858 22:27870829-27870851 CCTCCACAGCAGCAAGTGGATGG + Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183847346 22:40553343-40553365 CCTTCACAGCAGCGCCTCGAAGG + Intronic
1184246370 22:43237807-43237829 CCTAGAGAGCAGGGCGTGGAGGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1203249449 22_KI270733v1_random:102419-102441 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
949889065 3:8718927-8718949 CATTCAAAGCAGCGTGTAGAGGG + Intronic
950354519 3:12395045-12395067 CCTTCAAAGCTGTGAGTGCATGG - Intronic
950831176 3:15877854-15877876 CCTTAAGGGGAGGGAGTGGATGG + Intergenic
952853191 3:37745745-37745767 CCTTCAGAGAAACAACTGGAAGG - Intronic
953787502 3:45922097-45922119 GCTTCAGAGCAGCCAGGTGAGGG - Intronic
954759217 3:52861878-52861900 CATTCAGAGCATTGAGAGGATGG - Intronic
954931646 3:54287916-54287938 CATTCAGAGCAGTGTGTAGAGGG + Intronic
958554802 3:95660459-95660481 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
959108919 3:102098337-102098359 CCTTCAGGGTAGAGAGTGCAGGG + Intergenic
959180326 3:102970869-102970891 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
959308009 3:104694122-104694144 CCTTCAAAGCAGTGGGTAGAGGG - Intergenic
960154057 3:114279736-114279758 CATTCAAAGCAGTGTGTGGAGGG + Intronic
962238138 3:133726809-133726831 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
962268897 3:133963584-133963606 CCTTCTGAGCAGGGAGGGGATGG - Intronic
965475457 3:169149612-169149634 CCTTCCGAGCTACGAGAGGAAGG + Intronic
965645951 3:170881713-170881735 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
966257084 3:177929384-177929406 CCTTCTGGCCAGTGAGTGGATGG + Intergenic
966484424 3:180451453-180451475 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
967017449 3:185495074-185495096 CCTTGAGAGAAGCGAGTGGCAGG - Intronic
967834512 3:193949754-193949776 TTTTCAGAGAAGCGTGTGGATGG - Intergenic
968023713 3:195419533-195419555 CCTTCAGACCAGCCAGGGGGAGG + Intronic
968388583 4:169004-169026 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
970323304 4:14897096-14897118 CTTTCACAGCAACAAGTGGAAGG + Intergenic
970431206 4:15990617-15990639 CACTCAGAGCAGAGGGTGGAAGG + Intronic
971115820 4:23644894-23644916 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
973124817 4:46570096-46570118 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
974530379 4:63099913-63099935 CCTTCAAAGCAGTGTGTAGAGGG + Intergenic
974680992 4:65161595-65161617 CATTCAGAGCAGTGTGTAGAGGG + Intergenic
974682296 4:65179441-65179463 CATTCAGAGCAGTGTGTAGAGGG + Intergenic
974690413 4:65291388-65291410 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
975179980 4:71333613-71333635 CCTTCAGGGCAGTGAGCTGAGGG + Intronic
977391191 4:96412349-96412371 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
977677952 4:99768592-99768614 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
977680714 4:99795788-99795810 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
977703451 4:100046677-100046699 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
980507021 4:133737086-133737108 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
981161742 4:141507041-141507063 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
981299368 4:143169421-143169443 CCTTCAAAGCAGTGTGTAGAGGG + Intergenic
982347579 4:154377878-154377900 CTTTGAGAGCAGCAAGGGGAGGG + Intronic
982960708 4:161833032-161833054 CATTCAAAGCAGCGTGTAGAGGG - Intronic
984320114 4:178185074-178185096 TCTTCATAGCAGCGAGAGAATGG - Intergenic
984994502 4:185416073-185416095 CCCTCAGACCAGCCAGTAGAAGG + Intronic
985500294 5:239649-239671 CCTTCACATCAGCGGGGGGAAGG - Intronic
989248306 5:39278890-39278912 CATTCAAAGCAGCGTGTAGAAGG - Intergenic
989655584 5:43744368-43744390 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
989804174 5:45583677-45583699 CATTCAGAGCAGTGTGTAGAGGG - Intronic
991507237 5:67337997-67338019 CCTTGAGAGGACTGAGTGGAGGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994031890 5:95152646-95152668 CCTTCAGGGCAGGGAGGTGAAGG + Intronic
994357680 5:98812408-98812430 CCTCCAGAGTAGCGAGTAGCGGG + Intergenic
994962724 5:106625934-106625956 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
995856814 5:116601168-116601190 CCCTCAGAGGAGGGAGAGGAGGG - Intergenic
996114423 5:119602296-119602318 CCTTCAAAGCAGTGTGTAGAGGG + Intronic
998178112 5:139914456-139914478 CCTGGAAAGCAGCGAGAGGAAGG - Intronic
998803450 5:145894123-145894145 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1003250885 6:4428458-4428480 TCGTCAGAGCAGCGCGTGGCAGG - Intergenic
1004322983 6:14647608-14647630 CCTTCAGAGATGAGAGTGGCAGG - Intergenic
1007096305 6:39215311-39215333 CCTTCAGAGCAGCGAGTGGAAGG - Intronic
1007431857 6:41781076-41781098 CCTTCAGGGCAGCGGGTGTTGGG + Intronic
1008090729 6:47291361-47291383 GCTTCAGAGCAGAGGGTGAAAGG + Intronic
1010599078 6:77801639-77801661 CATTCAAAGCAGCGTGTAGAGGG - Intronic
1010827858 6:80495424-80495446 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1010853015 6:80801318-80801340 CCTTCAAAGCAGTGTGTAGAGGG + Intergenic
1011376460 6:86692533-86692555 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1011962631 6:93110057-93110079 ACTTCAAAGCAGAGAGTGGCTGG + Intergenic
1012673914 6:102091049-102091071 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1013387672 6:109648079-109648101 CATTCAAAGCAGTGAGTAGAGGG + Intronic
1013886419 6:114973516-114973538 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1013898648 6:115124229-115124251 CATTCAGAGCAGTGTGTAGAGGG + Intergenic
1018802777 6:167236374-167236396 CCCCCAGGGCAGCGGGTGGAGGG + Intergenic
1019911951 7:4106149-4106171 CCTTCTGAGCAGCGAGTGTCTGG - Intronic
1020120723 7:5501767-5501789 CCAGCTGAGCAGCGAGTGCAAGG - Exonic
1021486616 7:21175171-21175193 CCTCCAGAGCAACGAGTGTGTGG + Intergenic
1021487121 7:21179799-21179821 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1023100555 7:36713816-36713838 CATTCAAAGCAGCGTGTAGAGGG + Intronic
1023792369 7:43763171-43763193 CCTTCAAACCAGAGAGGGGATGG - Intronic
1028275962 7:88857101-88857123 CATTCAAAGCAGTGCGTGGAGGG + Intronic
1030475904 7:110033284-110033306 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1030851562 7:114492563-114492585 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1031673594 7:124581700-124581722 CCTTCAAAGCAGTGTGTAGAGGG - Intergenic
1032535989 7:132664529-132664551 CCTTCAAAGCAGTGTGTAGAGGG + Intronic
1032537418 7:132676546-132676568 CCTTCAAAGCAGTGTGTAGAGGG - Intronic
1033624103 7:143091252-143091274 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1035155873 7:156912540-156912562 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1035367698 7:158359970-158359992 CCTTAAGAGCAGCGTGTGAAGGG + Intronic
1037780430 8:21864750-21864772 CCTTCAGAGCAGTGGGAAGAAGG + Intergenic
1038116512 8:24561679-24561701 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1038225952 8:25658092-25658114 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1039794444 8:40900299-40900321 CCAGCAGAGCAGAGTGTGGAGGG + Intergenic
1039850190 8:41358233-41358255 CCTTGAGAGCCCCCAGTGGAGGG + Intergenic
1040086414 8:43347589-43347611 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1040945164 8:52876702-52876724 CCTTCATAGCAGCGTGAGAATGG - Intergenic
1041286087 8:56263536-56263558 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1041949701 8:63487461-63487483 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1044279096 8:90336147-90336169 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1044284560 8:90396533-90396555 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1044410069 8:91872366-91872388 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1044539224 8:93391226-93391248 TCATCAGAGCAGGGTGTGGAGGG + Intergenic
1045186826 8:99846622-99846644 CATTCATAGCAGTGAGTGAAAGG + Intronic
1046251130 8:111633092-111633114 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1046894563 8:119459351-119459373 CATTCAAAGCAGCGCGTAGAGGG - Intergenic
1047069893 8:121331931-121331953 CATTCAGAGCAGTGCGTAGAGGG - Intergenic
1047837498 8:128710222-128710244 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1049932487 9:470333-470355 CCTGCTCAGCAGCGAGTGGTTGG + Intronic
1050451583 9:5787209-5787231 CCTTCAGAGCATCCAGTTGAGGG + Exonic
1051005364 9:12336857-12336879 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1052150147 9:25104973-25104995 CATTCAAAGCAGCGCGTAGAGGG + Intergenic
1052239350 9:26252623-26252645 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1052645366 9:31227662-31227684 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1052710796 9:32053035-32053057 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1055333224 9:75205783-75205805 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1055556692 9:77481200-77481222 CATTCAAAGCAGTGAGTAGAGGG - Intronic
1055969166 9:81894551-81894573 CTCTCAGAGCAGAAAGTGGAGGG - Intergenic
1059230605 9:112718017-112718039 CTTTAAGAGCAGCGATTGTAAGG - Exonic
1062109784 9:134775818-134775840 CCTTCAGACCAGGGAGGTGAGGG - Intronic
1062224818 9:135443950-135443972 TCGTCAGAGCAGCGCGTGGCAGG - Intergenic
1203757970 Un_GL000218v1:153541-153563 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1203440797 Un_GL000219v1:6530-6552 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1203465842 Un_GL000220v1:85680-85702 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1203511675 Un_KI270741v1:124913-124935 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1186599420 X:11021121-11021143 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
1187155538 X:16717658-16717680 CCTTCAGAGCAGGGAGTTCATGG - Intergenic
1188452703 X:30325346-30325368 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1188494656 X:30770916-30770938 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1189777689 X:44484877-44484899 GCTTAGGAGCAGCTAGTGGAGGG - Intergenic
1190601106 X:52093777-52093799 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1191118081 X:56871963-56871985 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191134781 X:57051894-57051916 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191138088 X:57088169-57088191 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1191681186 X:63841620-63841642 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191782264 X:64881505-64881527 CATTCAAAGCAGTGAGTAGAGGG + Intergenic
1191804663 X:65121794-65121816 CATTCAAAGCAGTGAGTAGAGGG - Intergenic
1191890847 X:65938766-65938788 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1192015390 X:67324465-67324487 CATTCAAAGCAGCGTGTAGACGG - Intergenic
1192666819 X:73097086-73097108 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1192669040 X:73119764-73119786 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1192712090 X:73601550-73601572 CATTCAAAGCAGTGTGTGGAGGG + Intronic
1192842913 X:74876142-74876164 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1192854725 X:74997183-74997205 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1192942567 X:75927990-75928012 CATTCAGAGCAGTGTGTAGAGGG + Intergenic
1192954046 X:76049946-76049968 CATTCAAAGCAGCGTGTAGAGGG - Intergenic
1192956091 X:76071658-76071680 CATTCAGAGCAGTGTGTAGAGGG + Intergenic
1193138718 X:78002697-78002719 GGTAGAGAGCAGCGAGTGGAGGG + Intronic
1193164056 X:78261795-78261817 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1193824744 X:86209682-86209704 CCTTCACATGAGTGAGTGGAAGG + Intronic
1194266156 X:91755651-91755673 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1194952025 X:100137793-100137815 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1195586966 X:106576293-106576315 CATTCAGAGCAGTGTGTAGAGGG - Intergenic
1195941257 X:110169796-110169818 CCTTCAGGGCAATGATTGGATGG + Intronic
1196349042 X:114703550-114703572 CTTTCAAAGCAGTGAGTAGAAGG + Intronic
1196479059 X:116124174-116124196 CATTCAAAGCAGCGTGTAGAGGG + Intergenic
1198643481 X:138781156-138781178 CATTCAAAGCAGCGTGTAGAGGG + Intronic
1198794281 X:140379140-140379162 GCTTCACAGCAGAGAGTAGATGG - Intergenic
1200011396 X:153123406-153123428 CCTTCAGAGCGGGGGGTGCAGGG + Intergenic
1200028204 X:153276516-153276538 CCTTCAGAGCGGGGGGTGCAGGG - Intergenic
1200072588 X:153536499-153536521 CCTTCAGAGGAGCGACCTGAAGG + Intronic
1200088891 X:153625329-153625351 GCTCCAGGGCAGTGAGTGGAAGG - Intergenic
1200142429 X:153908772-153908794 GCTTCAGAGCAGGGAGTGGCAGG - Intronic
1201570550 Y:15409094-15409116 CATTCAAAGCAGTGTGTGGAGGG + Intergenic