ID: 1007096878

View in Genome Browser
Species Human (GRCh38)
Location 6:39218739-39218761
Sequence CCTGCACCACTCCAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007096878_1007096887 10 Left 1007096878 6:39218739-39218761 CCTTCCCCCTGGAGTGGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 202
Right 1007096887 6:39218772-39218794 GCCAAAGGTGCCCCCAGCTAGGG No data
1007096878_1007096884 -5 Left 1007096878 6:39218739-39218761 CCTTCCCCCTGGAGTGGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 202
Right 1007096884 6:39218757-39218779 GCAGGCTCCAGTCATGCCAAAGG No data
1007096878_1007096886 9 Left 1007096878 6:39218739-39218761 CCTTCCCCCTGGAGTGGTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 202
Right 1007096886 6:39218771-39218793 TGCCAAAGGTGCCCCCAGCTAGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007096878 Original CRISPR CCTGCACCACTCCAGGGGGA AGG (reversed) Intronic
900145788 1:1158175-1158197 CCAGCACCGTCCCAGGGGGAAGG + Intergenic
900415534 1:2532810-2532832 GCTGCTCCAGTCCAGGGGGAGGG - Intergenic
900427030 1:2585620-2585642 CCTTCACCACCCCAGGGCGAGGG + Intergenic
900579937 1:3403875-3403897 CCCGCACCGCTCCCTGGGGACGG + Intronic
901220347 1:7580231-7580253 CCTCCACAGCCCCAGGGGGAGGG - Intronic
902377514 1:16036782-16036804 TCTGCACCACCCCTGGGGCATGG + Intergenic
902382688 1:16060040-16060062 TCTGCACCACCCCTGGGGCATGG + Exonic
902515181 1:16986215-16986237 CCTGCACTACCTCAGGGGGCCGG + Exonic
903166608 1:21524829-21524851 CCTGCGCGATTCCTGGGGGAAGG + Intronic
903693780 1:25192924-25192946 CCGGCGCCACGCCAGTGGGATGG + Intergenic
904325466 1:29724873-29724895 CCTGCTCCCCTCAAAGGGGATGG + Intergenic
904533490 1:31183960-31183982 CCTGCACCGCTCCTGGTGGATGG - Exonic
905205222 1:36339522-36339544 CCTGCACCACTCAGCTGGGATGG + Intergenic
909774543 1:79467426-79467448 CCTGCCCTATACCAGGGGGAAGG - Intergenic
911176995 1:94826971-94826993 CCTGCAGCTCCCCAGGGGCAGGG - Intronic
912521552 1:110249063-110249085 CCTGCAGCACCCCAGGTGGGTGG - Intronic
913195601 1:116453993-116454015 CCATCACCACACCAGGGGGAGGG - Intergenic
914422179 1:147539364-147539386 CCTGGACTACTCCAGTGAGAAGG + Intergenic
915645428 1:157268624-157268646 CCTTCCCCAGTCCATGGGGATGG + Intergenic
917810408 1:178653040-178653062 CCAGAAGCACTCCAGGGGGCTGG - Intergenic
918011634 1:180592412-180592434 CCTGCACCAATTCAAGGGAAGGG - Intergenic
920681046 1:208072972-208072994 CCTCCACCACACCATGGTGAGGG - Intronic
920751647 1:208683561-208683583 CCAGGAGCACTCAAGGGGGAAGG - Intergenic
920914681 1:210250783-210250805 GCAGGAGCACTCCAGGGGGAGGG - Intergenic
923440643 1:234016861-234016883 CTAACACCACTCCAGGAGGAAGG + Intronic
924038115 1:239956402-239956424 TCTCCTCCACTCCAGGGGGATGG - Intergenic
1065740144 10:28790263-28790285 CCTGCAGTGCTCCATGGGGAAGG + Intergenic
1067140879 10:43655553-43655575 CCTTCCTCACTCCATGGGGAGGG + Intergenic
1067476984 10:46573852-46573874 TCTCCACCCCTCCAGGGGCAGGG + Intergenic
1067617755 10:47767929-47767951 TCTCCACCCCTCCAGGGGCAGGG - Intergenic
1070553943 10:77513959-77513981 CCTGCACTCCTCCAGCGGGCGGG + Intronic
1070668495 10:78362024-78362046 CCTTCCCCACTCCAAGGAGACGG - Intergenic
1071389623 10:85159096-85159118 CCTGTACCACGTCAGAGGGAAGG - Intergenic
1072041181 10:91608411-91608433 CCTGCTCTACTCCAGGGCCAGGG - Intergenic
1072152012 10:92690860-92690882 CGTGCACTACTCCGGGGGAAGGG - Intronic
1073323171 10:102627941-102627963 CCCGCAGCACCCCAGTGGGATGG + Intronic
1074405880 10:113180117-113180139 TCAGCACCACTCCTGGGGAATGG + Intergenic
1074768900 10:116720549-116720571 CCTGCAGCACCCCAGCAGGATGG - Intronic
1076403267 10:130196897-130196919 GCTGCCCCTCTCCAGGTGGAGGG + Intergenic
1076604993 10:131683592-131683614 ACTGCTCCACAACAGGGGGAGGG - Intergenic
1076610511 10:131723165-131723187 CCTGCTCCGCACCAGGGAGAGGG - Intergenic
1076646840 10:131959499-131959521 CCTTCACCTCCACAGGGGGATGG - Intronic
1077497089 11:2891616-2891638 CCTCCTCCACTGCAGGAGGAGGG + Intronic
1081565984 11:44261600-44261622 CCAGCACTACTCCTGGGGCATGG - Exonic
1081668241 11:44929050-44929072 CCTGGCCCACTCCAGGGGAAGGG - Intronic
1084501985 11:69540393-69540415 CCTGCTCCAGTTCATGGGGAGGG - Intergenic
1085726045 11:78955519-78955541 CCTACACCACTCCCCGAGGAAGG - Intronic
1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG + Intergenic
1089396231 11:118137780-118137802 GCTGTGCCACGCCAGGGGGAGGG + Intronic
1090334049 11:125950996-125951018 CCTGCCCAACTGCAGTGGGAAGG + Intergenic
1091754532 12:3042929-3042951 TCTGCACCACACCACAGGGAAGG - Intergenic
1092016471 12:5163128-5163150 TCTGGAGCACTCCAGGAGGAAGG + Intergenic
1094168059 12:27463014-27463036 TCTGCTCCACTCCAGCAGGAGGG - Intergenic
1096262640 12:50102742-50102764 CCAGCAACAGCCCAGGGGGATGG + Intergenic
1096977588 12:55708135-55708157 CCTCCACCACTCCCGGGGTGGGG - Intronic
1096994811 12:55831790-55831812 CCTGCAGCTCTTCAGGGTGAGGG - Intergenic
1097156912 12:57018632-57018654 CCTGCCCCACACCAGAAGGAAGG + Intronic
1098371699 12:69767408-69767430 CCTGCTCAGCTCCAGGGGGATGG + Intronic
1099723776 12:86398840-86398862 CCTGCCCCATACCAGAGGGAAGG + Intronic
1099960459 12:89392152-89392174 CCTCCCCCACTCCAGGGTCAGGG + Intergenic
1102188895 12:110970955-110970977 ACTGCTCAACTCCAGTGGGAGGG + Intergenic
1102571917 12:113831901-113831923 CCTGCACTGCTGCAGGGAGAAGG + Intronic
1103437451 12:120937756-120937778 CCTGACCCACACCATGGGGAGGG - Intergenic
1103901825 12:124307375-124307397 GCTGCCCCACTCCTGGGGGTGGG - Intronic
1104064255 12:125293821-125293843 CCAGCCCCAATTCAGGGGGAGGG - Intronic
1104679992 12:130743428-130743450 CCTGTACCTCACCAGGGAGAGGG - Intergenic
1105413647 13:20192045-20192067 CCTGCCCCACTGGAGGAGGAAGG - Intronic
1105444727 13:20443221-20443243 ACTGGACCACTCCCAGGGGAAGG + Intronic
1105531166 13:21221844-21221866 CCTGCATCATCCCAGGAGGAAGG + Intergenic
1108396466 13:49996342-49996364 CCCGCACCCCACAAGGGGGAGGG - Intronic
1110412917 13:75223033-75223055 CCTGCCCCATTCCAGTGGGCAGG + Intergenic
1112332376 13:98486298-98486320 CCTGCAGCACTGCACTGGGAAGG + Intronic
1121997017 14:98610660-98610682 CCAGCAACACTCCAGGGGGTGGG + Intergenic
1122205693 14:100146847-100146869 GCAGCACCACTCCTGGGTGAAGG - Exonic
1122496294 14:102158232-102158254 CATGCACCCCTCCAAGGTGATGG - Intronic
1122997539 14:105273439-105273461 CCTGCACCTGCCCAGAGGGAGGG + Intronic
1125908647 15:43416405-43416427 CTTTCACCACTCCTGGGGGGTGG + Exonic
1127666811 15:61155854-61155876 CTTGCCACACTCCAGGTGGAAGG + Intronic
1130028791 15:80293741-80293763 CCTGCAACACTCAAGGTGCATGG - Intergenic
1130653793 15:85777701-85777723 CCTTCTCCACTCCAGAGGAACGG + Intronic
1131403877 15:92147588-92147610 CCTGCTCCACTGCAGGAGGCAGG - Intronic
1132341059 15:101078858-101078880 CCTTCCCCATTCCAGGGTGAAGG - Intergenic
1132792575 16:1700320-1700342 CCTGCAGCCCTTGAGGGGGATGG - Exonic
1133480805 16:6168678-6168700 CCTCTGCCACTCCTGGGGGAGGG + Intronic
1133735823 16:8614938-8614960 CATGCACCACTCTAGGGGGTAGG + Intergenic
1135733008 16:24910006-24910028 CCTGCAATACTCTAGGGTGAGGG + Intronic
1136272493 16:29156726-29156748 CCTCCACCTCTGCAGAGGGAGGG + Intergenic
1137420593 16:48330280-48330302 ACTGCACAATTCCAGTGGGAAGG + Intronic
1138653397 16:58474755-58474777 CCTGGGCCACTCCTGGGGTATGG + Intronic
1139654425 16:68378670-68378692 CCTGCTGCACTCCACAGGGAGGG + Intronic
1141672332 16:85498846-85498868 CCTGCCACTCTGCAGGGGGAAGG - Intergenic
1141891071 16:86926755-86926777 CCTGCCCCTCTCCACGGGCAAGG + Intergenic
1203145720 16_KI270728v1_random:1796582-1796604 CCACCAACACTCCCGGGGGAGGG + Intergenic
1143621187 17:8081010-8081032 CGTGCACCACCCCAGGGCAAAGG + Exonic
1143890620 17:10099472-10099494 CCAGAACCACTCCAGGGCGGTGG - Intronic
1144666611 17:17106437-17106459 CCTCCACCACTTCAGAGAGAGGG + Intronic
1144951403 17:18996365-18996387 CCTCCTCCCCTCCAGGGGGCTGG + Intronic
1145138629 17:20433503-20433525 ACAGCACCAGTCCCGGGGGATGG + Intergenic
1146271585 17:31488697-31488719 CCTCCACCATCCCAGAGGGACGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1149204220 17:54225295-54225317 CCTGCACCAACCCAGGTGGAAGG + Intergenic
1151540215 17:74760968-74760990 CCTGCACCAGGCCTGGAGGAGGG + Intronic
1151727162 17:75891942-75891964 CCTCCACCCCCCCAGCGGGAGGG + Intronic
1152209695 17:78996504-78996526 CCTGAACCCCAGCAGGGGGAGGG - Intronic
1152558246 17:81065305-81065327 CCTGGACCCCTGCAGGGGGCCGG - Intronic
1152559171 17:81069376-81069398 CCTCCAGCACTCCATGGAGATGG - Intronic
1152750034 17:82058447-82058469 CCAGCACCACTCCCGGGGCCAGG + Intronic
1156493848 18:37512904-37512926 CCTGCAGAACTCCCGGGAGAAGG - Intronic
1157724200 18:49951142-49951164 CCTGTATGACTCCAGGTGGAAGG + Intronic
1158980904 18:62760597-62760619 CCACAACCACTCCAGGGGGTGGG - Intronic
1159937862 18:74382891-74382913 CCTGCACCTCCCCAGGGGAGTGG - Intergenic
1160373250 18:78391411-78391433 CTTCCTCCACCCCAGGGGGACGG + Intergenic
1160567448 18:79795953-79795975 CCTTCCCCACTCCAGGCTGACGG + Intergenic
1163474180 19:17515556-17515578 CCTGCCCCACTACAGGGAGTGGG - Intronic
1163721481 19:18900121-18900143 CCAGCGCCTCTCCAGGGGGCAGG - Intronic
1168099451 19:54133531-54133553 CCTTAACCTCTCCAGGGAGACGG - Intergenic
925790209 2:7476897-7476919 CCTGCATGACTCCAGAGGCAGGG - Intergenic
926198473 2:10777402-10777424 CCTTCACCACTCCAGGAGCCCGG + Intronic
927443123 2:23133807-23133829 CCTGCTCCACTTCAGTGAGATGG + Intergenic
927508019 2:23627053-23627075 CCAGCACCGCTCCTGGGGAAGGG + Intronic
928206471 2:29288152-29288174 CCTGCACTACTCCAGGACTAGGG + Intronic
929291274 2:40194827-40194849 CCTGCACTACTCCAGTGGGCGGG - Intronic
929810138 2:45182770-45182792 ACTGCACCACTCCACGGAAATGG - Intergenic
930247910 2:49003782-49003804 TCTGCACTACTCCAAGGGGTGGG - Intronic
931509280 2:62972662-62972684 CCTGAAGCTCTCCAGTGGGATGG - Intronic
932716893 2:74107220-74107242 CCTGCAGCTCTGCAGGAGGAAGG - Exonic
935265746 2:101392429-101392451 CCTGCCCCACACCTGGGGGAAGG + Intergenic
936315730 2:111422720-111422742 CAGGCAGGACTCCAGGGGGATGG - Intergenic
937347097 2:121132863-121132885 CCTGCCACACTACACGGGGATGG - Intergenic
938104724 2:128521932-128521954 TCTGCAGCACTCCAGGGTCAGGG - Intergenic
941129187 2:161625506-161625528 CCTGCACCAAACCAGACGGAGGG + Intronic
946373828 2:219296637-219296659 GCCCCACCACTCCAGGGGGTTGG + Intronic
946413444 2:219527060-219527082 CCTGGGCCAGTCCATGGGGAGGG + Intronic
946729413 2:222694015-222694037 ACTGAACAACTCCAGGGGCAGGG + Intronic
947470560 2:230397638-230397660 CTTGCACAACTCCAGGGGGCAGG + Intronic
1169343574 20:4813462-4813484 CCAGCTCCACCCCAGTGGGAGGG + Intronic
1170095288 20:12639271-12639293 CCTTCAACACTCCAGGGGGAAGG - Intergenic
1170523985 20:17218280-17218302 CCTCCAGTACTCTAGGGGGAGGG + Intergenic
1174589643 20:51635025-51635047 CCAGCTCCACTCCAGGGGGGTGG - Intronic
1175145684 20:56894530-56894552 GCTGCACCATCCCGGGGGGAAGG + Intergenic
1175268244 20:57715305-57715327 CCTCCACTGCTCCAGGGGGCAGG + Intergenic
1175907706 20:62389463-62389485 CCTGCACCACTGCTGGGGTCGGG + Exonic
1176670411 21:9728812-9728834 CCTGCTTCATTCCAGGTGGATGG - Intergenic
1179454436 21:41489126-41489148 TCTGCACCACCCCAGGCTGATGG + Intronic
1179492033 21:41746876-41746898 CCCACACCACCCCAGGGAGACGG + Intronic
1180984562 22:19896870-19896892 CCTGCACCCCTCCAGAGGCCTGG + Intronic
1182061692 22:27402932-27402954 CCTGCCCCATTTCAAGGGGATGG - Intergenic
1182597921 22:31436447-31436469 CCTGGACCAAGCCATGGGGAGGG - Intronic
1184189340 22:42884618-42884640 CCTGAGACACTCCAGGGGCAGGG - Intronic
1184648264 22:45907872-45907894 CCTGCCCCACCCCAGGGCCAGGG - Intergenic
1185097975 22:48821973-48821995 CCCCCACCACCCCAGGAGGATGG - Intronic
949546744 3:5079652-5079674 CCAGAACCACTCATGGGGGAGGG - Intergenic
950438102 3:12992745-12992767 CCTGGACAAGGCCAGGGGGAGGG + Intronic
950707065 3:14789438-14789460 ACTGCACCACTCTAGTGGGGAGG - Intergenic
950870297 3:16222617-16222639 CCTGCAGCACACCAGCAGGAAGG + Exonic
954385534 3:50241977-50241999 CCTCCAGCACTGCAGGGGGTGGG + Intronic
956384691 3:68704068-68704090 CCTGCTCCTGTCCAAGGGGAGGG + Intergenic
961613605 3:128161164-128161186 TCTGAACCACTACAGGGGGCTGG - Intronic
962080512 3:132134533-132134555 TCTGCACTACTGAAGGGGGAGGG + Intronic
963133354 3:141877356-141877378 CCTGCCCCACTCCAGGGGAGAGG + Intronic
963453347 3:145513922-145513944 CCTGCCCCATGCTAGGGGGAAGG - Intergenic
964817774 3:160735375-160735397 CCTGCACCATCCCAGGAGCAAGG + Intergenic
965027694 3:163324415-163324437 CCCGTATCACTCCAGGGGGTTGG + Intergenic
968624643 4:1621656-1621678 ACTGCCCCAGTCCAGTGGGAGGG - Intronic
969207157 4:5655597-5655619 CCTGCACCACCCAAGGGACAGGG + Intronic
969457183 4:7306783-7306805 CCTGCACCCCTCCAGGGACGGGG - Intronic
974386190 4:61203015-61203037 GCTGCGCCTCTCCAGGGGAAGGG - Intronic
975359680 4:73453556-73453578 CCTGCACAACTCCAGGCTGGTGG + Intronic
981840902 4:149110640-149110662 AGTGCACCACTCCAAGGGAATGG - Intergenic
981917394 4:150049824-150049846 TCTGCACCACTCCTGGAGGCTGG - Intergenic
982080698 4:151786822-151786844 CCTGCCCCACACCAGGGGTTGGG + Intergenic
985276816 4:188245532-188245554 CCTGCCCCACACGAGGAGGAAGG - Intergenic
985361461 4:189179829-189179851 CCTGCCCCACACCAGAGGGGAGG - Intergenic
985404363 4:189622728-189622750 CCTGCTTCATTCCAGGTGGATGG + Intergenic
985552475 5:540631-540653 GCTGCCCCGCTCCAGGGCGAAGG - Intergenic
991711111 5:69409347-69409369 CCTGCTGCACTCCAGTAGGAAGG + Intronic
995395098 5:111678787-111678809 CCTGCAATCCTCCAGGAGGAAGG + Intronic
996713748 5:126569257-126569279 CATGGACCACGGCAGGGGGATGG - Intronic
997372066 5:133368366-133368388 TCTGCACAACTCCACTGGGAGGG + Intronic
997780668 5:136654728-136654750 CCTACATCAATCCAGGGGAATGG - Intergenic
999101705 5:149030693-149030715 CCTGCTCTACTCCTGGGAGATGG + Intronic
999700282 5:154221395-154221417 CCTGCACCGCTCCGGGGGTTAGG + Intronic
999854579 5:155580200-155580222 CCTGCAGCATTCCAGGTGCAAGG - Intergenic
1000350290 5:160347434-160347456 CCTGCAGCACCCCTGTGGGAAGG - Intergenic
1000512540 5:162201327-162201349 CCTGGACAACTCCAGGGTTAAGG + Intergenic
1001203920 5:169744692-169744714 ATGGCAGCACTCCAGGGGGAAGG - Intronic
1003391491 6:5717077-5717099 CCTGCCTCATCCCAGGGGGAAGG - Intronic
1006029861 6:31170731-31170753 CCTCCACCCATCCAGGGGGCGGG - Intronic
1006301666 6:33196598-33196620 CCTGTACCGCTGCAGGGGGAAGG + Exonic
1006899700 6:37492007-37492029 CCTGCCCAGCTCCAGGGGTAAGG - Intronic
1007096878 6:39218739-39218761 CCTGCACCACTCCAGGGGGAAGG - Intronic
1013445832 6:110225611-110225633 CCTGCAGCAATGCAGGTGGATGG - Intronic
1017004517 6:150020349-150020371 GCTGCCCCACACCAGGGGGGAGG - Intronic
1024388547 7:48781221-48781243 CCTGTACCACTTAAGGGGAAGGG - Intergenic
1027459701 7:78436889-78436911 GCTGGTCCACTGCAGGGGGATGG + Intronic
1028716773 7:93979917-93979939 TCTGCACCAAGCCAGGTGGAGGG - Intronic
1028838413 7:95399755-95399777 CCTGCAACTCACCATGGGGAAGG + Intergenic
1033922556 7:146412181-146412203 CCTGCAGGGCTCCAGGGGGAAGG - Intronic
1034346575 7:150389052-150389074 GCTGCTCCACTCCAGGCGCAGGG - Intronic
1035035088 7:155889630-155889652 CCTGAACCAATCCAGGGCAATGG + Intergenic
1035752684 8:2007611-2007633 CCCGACCCACTCCAGGGGCAGGG - Intergenic
1038613722 8:29074613-29074635 CCGGCACCATTCCCAGGGGAGGG + Intronic
1039443419 8:37611457-37611479 CCTGCTCTGCTCCAGGGTGAAGG - Intergenic
1041051738 8:53940976-53940998 CCTGCACATCTCTAGGAGGATGG - Intronic
1047418672 8:124687301-124687323 CCTGGACCACTGCAGGAGGTTGG + Intronic
1048927052 8:139280769-139280791 CCTGCACTATTCCAGGTGCAAGG + Intergenic
1049519353 8:143080311-143080333 CCTGCCCCACCCCAGGGAAAGGG + Intergenic
1056571580 9:87821152-87821174 CCTGCAGCATTCCAGGAAGAAGG + Intergenic
1057644230 9:96858239-96858261 CAGGCAACACTCCTGGGGGAGGG - Intronic
1058737541 9:107907612-107907634 CATCCACCATTCCAGGGTGAAGG + Intergenic
1060442840 9:123657321-123657343 CCTGCACCAATCCAGGTGGCTGG + Intronic
1060980104 9:127786622-127786644 CCTCCCCCACTACAGGAGGAGGG - Intronic
1062314280 9:135958405-135958427 CCTTCTCCACTCCAGGGCAATGG + Intronic
1185477756 X:425430-425452 CCTGAGCCATTCTAGGGGGAGGG + Intergenic
1185831814 X:3310208-3310230 CCTGCACCCCTCCCGGGGCTGGG - Exonic
1185836087 X:3346730-3346752 CCTGCCCCACCCCGGGGAGACGG + Intergenic
1186201397 X:7158573-7158595 CCTGCTACTCTCCAGGTGGAGGG + Intergenic
1190038340 X:47047969-47047991 TCTGCACCACTCCACTGGCAGGG - Intronic
1191252318 X:58265513-58265535 CCAGCACGCCCCCAGGGGGAAGG - Intergenic
1198672216 X:139093205-139093227 TCTGCAACACACCAGGTGGAGGG + Intronic
1199622382 X:149712679-149712701 CCTGGATCACCCCATGGGGATGG + Intronic
1199628825 X:149762248-149762270 CCTGGATCACCCCATGGGGATGG - Intergenic
1201240601 Y:11954071-11954093 CCTGCCCCACCCCGGGGAGACGG - Intergenic