ID: 1007098634

View in Genome Browser
Species Human (GRCh38)
Location 6:39229543-39229565
Sequence CGACCGGGGAGGAGCCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 237}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007098617_1007098634 24 Left 1007098617 6:39229496-39229518 CCTCTTTAACCAGCGCCCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237
1007098623_1007098634 -5 Left 1007098623 6:39229525-39229547 CCCCCTTGCTCCGGGCTCCGACC 0: 1
1: 0
2: 2
3: 13
4: 152
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237
1007098620_1007098634 8 Left 1007098620 6:39229512-39229534 CCGGCGCGCTCTGCCCCCTTGCT 0: 1
1: 0
2: 0
3: 17
4: 229
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237
1007098624_1007098634 -6 Left 1007098624 6:39229526-39229548 CCCCTTGCTCCGGGCTCCGACCG 0: 1
1: 0
2: 1
3: 3
4: 80
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237
1007098618_1007098634 15 Left 1007098618 6:39229505-39229527 CCAGCGCCCGGCGCGCTCTGCCC 0: 1
1: 0
2: 5
3: 52
4: 383
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237
1007098627_1007098634 -8 Left 1007098627 6:39229528-39229550 CCTTGCTCCGGGCTCCGACCGGG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237
1007098619_1007098634 9 Left 1007098619 6:39229511-39229533 CCCGGCGCGCTCTGCCCCCTTGC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237
1007098625_1007098634 -7 Left 1007098625 6:39229527-39229549 CCCTTGCTCCGGGCTCCGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG 0: 1
1: 0
2: 0
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007098634 Original CRISPR CGACCGGGGAGGAGCCCAGG CGG Intergenic
900094765 1:935891-935913 CCGCCGGTGAGGAGCACAGGGGG + Exonic
900314336 1:2049687-2049709 TTTCAGGGGAGGAGCCCAGGAGG + Intergenic
900656942 1:3763149-3763171 CGACCTGGGAGGTGGCGAGGAGG + Exonic
900671360 1:3856965-3856987 GGCCCGGGGAGGCGGCCAGGCGG + Exonic
901014805 1:6222612-6222634 CCAGCTGGAAGGAGCCCAGGAGG - Exonic
901215213 1:7551137-7551159 AGACTGGGGTGGAGACCAGGAGG - Intronic
901750007 1:11400299-11400321 GGGCCTGGAAGGAGCCCAGGAGG + Intergenic
903800546 1:25964011-25964033 CAGCAGGGGAGGAGGCCAGGAGG + Intronic
904250906 1:29223652-29223674 AGACTGGGGAGGACCACAGGAGG - Intronic
905031166 1:34885451-34885473 GGAACGGGGAGGCGCCCACGAGG - Intronic
905328060 1:37171962-37171984 GGAGCCAGGAGGAGCCCAGGGGG - Intergenic
906105483 1:43289424-43289446 AGACCAGGGAGGGGCCCACGTGG + Intergenic
915316461 1:155031532-155031554 CCAGCGGGGAGGAGCCGATGTGG - Intronic
915506054 1:156357149-156357171 CGGAGGGGGAGGAGCCCAGCAGG + Intronic
915666020 1:157446193-157446215 CGACCAGTCAGGAGCCCAGCTGG + Intergenic
916422165 1:164647502-164647524 ATACCTGGGAGGGGCCCAGGGGG - Intronic
916517395 1:165532397-165532419 GGACAGGGGACGAGCCCATGTGG + Intergenic
917205950 1:172571815-172571837 CGGCCGGGGCGGTGCCCGGGCGG - Intronic
920614231 1:207473556-207473578 CGACCATGGTGGAGCCCAGGAGG - Exonic
924561200 1:245156941-245156963 CCACGGGGGAGGCCCCCAGGTGG + Intronic
1065186330 10:23173817-23173839 GGACCGGGCCGGAGGCCAGGGGG - Intergenic
1069877304 10:71571014-71571036 GGACTGCGGAGGAGCCAAGGAGG - Intronic
1070458375 10:76640830-76640852 CGAGCCGCAAGGAGCCCAGGAGG + Intergenic
1071502835 10:86215675-86215697 GGGCTGAGGAGGAGCCCAGGAGG - Intronic
1071602240 10:86964034-86964056 GGACTGGGCAGAAGCCCAGGTGG + Intronic
1072743115 10:97922198-97922220 CCACCAGGCAGGAGTCCAGGTGG + Intronic
1073076335 10:100827568-100827590 CGGCAGGGGCGGAGCCCCGGGGG - Exonic
1073150323 10:101306974-101306996 CCCCCGGGGAGGAACCCAGGAGG + Intergenic
1076544109 10:131232302-131232324 TGAGCTGGGAGGAGCCCAGCAGG + Intronic
1077369779 11:2176044-2176066 GTGCTGGGGAGGAGCCCAGGAGG + Intergenic
1077788480 11:5412297-5412319 CGAACCGGGAGGAGCCAAGATGG + Intronic
1078660189 11:13279101-13279123 TGACCGGGAAGGGGCCGAGGCGG - Intronic
1078930498 11:15908771-15908793 GGAACGGGGAGGAGCTCAGCAGG + Intergenic
1080363432 11:31544006-31544028 AGATCGGGGAGGAGCCAAGATGG + Intronic
1081775604 11:45674251-45674273 CAGTCAGGGAGGAGCCCAGGAGG - Intergenic
1081815539 11:45938118-45938140 CAACAGGGGAGGGGCCGAGGAGG - Intronic
1082711160 11:56555034-56555056 AGACAGGGGAGGAGCCAAGATGG - Intergenic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1088947836 11:114533297-114533319 CGAGCGGGGTGGAGCCAAGATGG + Intronic
1092276654 12:7066642-7066664 GGACTGGGGAGAAGCCAAGGTGG - Intronic
1095553284 12:43470969-43470991 CTATCGGGGAGGAGCCAAGATGG + Intronic
1095782176 12:46072239-46072261 AGACCTGGGAGGAAGCCAGGAGG + Intergenic
1097838087 12:64293360-64293382 CCACAGGGGAGGAGCCAAGATGG - Intronic
1100873037 12:98932110-98932132 AGACCAGGGAAGAGACCAGGGGG + Intronic
1102063314 12:109951977-109951999 GGACTGGGCAGGAGGCCAGGCGG + Intronic
1104896648 12:132168143-132168165 TGACCTGGGAAGAGCCCAGAAGG - Intergenic
1105054035 12:133080888-133080910 CGCCCGCGGAGGGGCCCTGGGGG + Exonic
1105851896 13:24342391-24342413 AGACCGGGGAGGAGCCAAGATGG + Intergenic
1107604113 13:42041073-42041095 CGCGCGAGGAGGAGCCCGGGCGG - Intronic
1108678922 13:52762857-52762879 CACCCCAGGAGGAGCCCAGGAGG + Intergenic
1109223540 13:59664959-59664981 GGACCGGGGAGCAGCCACGGGGG - Intergenic
1110598134 13:77341372-77341394 CAGCCTGGAAGGAGCCCAGGTGG - Intergenic
1113469767 13:110536107-110536129 CCCCCGGGGAGGAGACCATGGGG + Intronic
1113664859 13:112134454-112134476 GGCCTGTGGAGGAGCCCAGGAGG + Intergenic
1115689229 14:35826386-35826408 GGGGCGGGGAGGAGCCAAGGGGG + Exonic
1119163708 14:72474973-72474995 GGACAGTTGAGGAGCCCAGGAGG + Intronic
1119189431 14:72670361-72670383 CGGAGGAGGAGGAGCCCAGGAGG + Exonic
1119438196 14:74611630-74611652 CCACCGAGGCGGAGGCCAGGAGG - Exonic
1121644082 14:95506002-95506024 GGTCCAGGGTGGAGCCCAGGTGG + Intergenic
1122549269 14:102541002-102541024 CTACCGGGAAGGTGCTCAGGTGG - Intergenic
1122975492 14:105169058-105169080 ACACCCGGCAGGAGCCCAGGCGG - Intergenic
1123700867 15:22913977-22913999 CGACTGGGGAGCCGCCCAGCCGG - Intronic
1124286370 15:28403201-28403223 CGGCAGGGGAGGAGGCCTGGCGG + Intergenic
1124296333 15:28508435-28508457 CGGCAGGGGAGGAGGCCTGGCGG - Intergenic
1126100820 15:45117241-45117263 TGAGCGCGGAGGAGCCTAGGCGG - Exonic
1127117620 15:55743298-55743320 CGGCCGGGTCGGAGCCCTGGGGG + Intergenic
1128153557 15:65377888-65377910 CGGCCGGGGCCGAGCCCAGGCGG + Exonic
1128944007 15:71809494-71809516 GGACCTGGGAGCAGCGCAGGGGG + Intronic
1131119785 15:89814949-89814971 GGACGGGGGAGGAGCCCGGGCGG - Intronic
1132378416 15:101348184-101348206 CCACCGGGGAGGAGCAGCGGAGG - Intronic
1132726108 16:1339038-1339060 GGAGCGGGGAGGAGCAAAGGGGG - Intronic
1133876128 16:9736304-9736326 GGACCAGGGAGGGGCCTAGGAGG - Intergenic
1135016015 16:18925897-18925919 CGCCCGAGGCGGAGCCCGGGAGG + Intronic
1135321636 16:21501724-21501746 CGCCCGAGGCGGAGCCCGGGAGG + Intergenic
1135437326 16:22437523-22437545 CGCCCGAGGCGGAGCCCGGGAGG - Intergenic
1135470943 16:22730099-22730121 CGACAGGGACGGAGCTCAGGTGG - Intergenic
1136333111 16:29594834-29594856 CGCCCGAGGCGGAGCCCGGGAGG + Intergenic
1136399325 16:30009344-30009366 GGACCCTGGAGGAGCCCAGAAGG + Intronic
1136447807 16:30334922-30334944 CGCCCGAGGCGGAGCCCGGGAGG + Intergenic
1139354819 16:66361212-66361234 TGGCTGGGGAGGAGGCCAGGTGG - Intergenic
1142128351 16:88421159-88421181 CGTGGGGGCAGGAGCCCAGGTGG + Intergenic
1142239593 16:88939176-88939198 CGGCAGGGGAAGAGCTCAGGGGG + Intronic
1142566863 17:845828-845850 AGGCCGAGGAGGAGGCCAGGCGG + Intronic
1143135866 17:4711917-4711939 TGACCAGGGAGGTGCCCAGTGGG - Intronic
1143747672 17:9005494-9005516 CGTCTGGGGAGGGGCCCAGAAGG + Intergenic
1143822410 17:9575587-9575609 GGCCCGGGAAGGAGACCAGGTGG - Intronic
1145724497 17:27105158-27105180 CCACGGGGGAGGAGCCAAGATGG - Intergenic
1145969656 17:28949681-28949703 CGGCCGGGCAGGAGCCCCGAGGG + Intronic
1146946549 17:36877503-36877525 CCACTGGGGAGGGGCCCTGGGGG + Intergenic
1147371827 17:39997736-39997758 CGGCTGGGGAGGAGCCCTGGGGG - Exonic
1147393311 17:40122783-40122805 CGCCCTGGGAGGAGGCCAGCGGG - Intronic
1147879766 17:43646115-43646137 CGCCCGGGGAGCAGGGCAGGGGG + Intronic
1147967186 17:44199653-44199675 CGCCCGGTGAGGCGGCCAGGCGG - Intronic
1148577637 17:48722926-48722948 CGAACTGGGAGGTGCACAGGGGG - Intergenic
1149024152 17:52005421-52005443 TGGCCAGGGAGTAGCCCAGGTGG - Intronic
1151290129 17:73143901-73143923 CAACCTGTGAGGATCCCAGGAGG - Intergenic
1151578158 17:74963159-74963181 GGACAGGGGCTGAGCCCAGGCGG + Intronic
1152095097 17:78268104-78268126 AGAGCAGGGAGGTGCCCAGGTGG + Intergenic
1152657358 17:81526194-81526216 AGGCTGAGGAGGAGCCCAGGCGG - Intergenic
1152765305 17:82134127-82134149 AGCCAGGCGAGGAGCCCAGGAGG - Intronic
1152923853 17:83079030-83079052 TGACCGGGGGGGAGGCCCGGCGG - Intergenic
1154188565 18:12208441-12208463 CCAGCGGGGAGGAGCCAAGATGG - Intergenic
1154347289 18:13552533-13552555 CAACCAGAGAGGAGGCCAGGGGG - Intronic
1158546122 18:58398876-58398898 TGCCCGGGGAGTAGCCCTGGGGG + Intronic
1158930969 18:62325123-62325145 CGCTCGGGGAGGGGCCCCGGGGG - Intergenic
1158954018 18:62523171-62523193 GAACCGGCGAGGAGCCCAGGGGG + Exonic
1160210447 18:76873951-76873973 CGACAGGAGAGGAGGACAGGCGG - Intronic
1160753434 19:746325-746347 CCACCTCGGAGGAGCTCAGGGGG - Exonic
1161118365 19:2511917-2511939 GGTCCGGGAAGGTGCCCAGGTGG + Exonic
1161392516 19:4028739-4028761 AGCCCGGGGTGGAGCCCAAGAGG + Exonic
1161702699 19:5804172-5804194 CCGTCGGGGAGGAGCCCGGGTGG + Intergenic
1163281310 19:16319706-16319728 CGTCTGGGGAGGAAGCCAGGCGG + Intergenic
1163386223 19:17001929-17001951 CCACAGGGGAGGAGCCCAGCAGG + Intronic
1163673792 19:18645181-18645203 CGAGCTGGGAGGAGGCCAGCTGG - Intronic
1165862367 19:38915950-38915972 AGCCCGGGGAGGAGCCAAGGTGG + Intronic
1165867863 19:38949943-38949965 TGACGGGGGCGGGGCCCAGGAGG - Intronic
1166104321 19:40589946-40589968 AGCCCAGGGAGGAGGCCAGGAGG + Intronic
1166106762 19:40601483-40601505 CGACCGGGGTGAAGCGCACGCGG - Intronic
1166112054 19:40628422-40628444 CTACTCGGGAGGAACCCAGGAGG + Intronic
1166230074 19:41421508-41421530 GGAGCTGGGAGGAGCCCAGAGGG + Intronic
1166361176 19:42253672-42253694 GGACCGAGGAGGGGCCCTGGGGG - Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1167649928 19:50723618-50723640 AGGCTGGGGAGGTGCCCAGGAGG + Exonic
924993992 2:340507-340529 GGACAGGGGAGGAGCCCACCTGG - Intergenic
925128219 2:1476834-1476856 CCACCGGTGAGCAGGCCAGGGGG + Intronic
925303260 2:2831926-2831948 AGCACGGGGAGGAGCCCAGAGGG + Intergenic
925390395 2:3490336-3490358 GGTCCTGGGAGGAGCCCTGGGGG - Intergenic
925404541 2:3597364-3597386 TGACCCCGGAGCAGCCCAGGTGG - Intronic
927168796 2:20351065-20351087 CCGCCGCGGCGGAGCCCAGGAGG - Intronic
927472512 2:23386179-23386201 CGGCCGGGCAGGAGACCTGGAGG + Intronic
927982176 2:27380907-27380929 CGGCCAGGGAGCAGCGCAGGAGG + Intergenic
928135313 2:28683406-28683428 CTACCGAGGAGGAGCCCATGTGG - Intergenic
932577645 2:72971581-72971603 CGATCTTGGAGGAGCCCACGAGG + Exonic
933849908 2:86357736-86357758 TGACCGCTGAGGAGCCCTGGAGG + Intergenic
933897339 2:86823911-86823933 AGACTGAGGAGGAGCCCTGGGGG + Intronic
934678247 2:96265323-96265345 CGCCGGCGGAGGAGCCCGGGAGG - Exonic
935144861 2:100388769-100388791 CCACCGGGAAAGAGCCCAGTGGG + Intergenic
935692594 2:105744796-105744818 CGGCCGGGGAGGAGCGCGGGAGG + Intergenic
936070903 2:109370579-109370601 TGACCAGAGAGGAGCCCTGGGGG - Intronic
936155190 2:110042558-110042580 TGCTCAGGGAGGAGCCCAGGAGG - Intergenic
936189492 2:110328856-110328878 TGCTCAGGGAGGAGCCCAGGAGG + Intergenic
936556755 2:113503360-113503382 CGACCCGCGAGAGGCCCAGGCGG - Intergenic
938534853 2:132231322-132231344 CGAAGGGGGAGGAGCCAAGATGG + Intronic
938727453 2:134120680-134120702 GGACCGCGGAGGAGCCCGGTGGG + Intronic
943776547 2:191772767-191772789 TGACAGGGGCGGAGCTCAGGTGG - Intergenic
945602686 2:211888532-211888554 CGACAGGGGAGGAGCCAAGATGG + Intronic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
948077185 2:235174045-235174067 GGACTGGGGAGGAGGTCAGGAGG + Intergenic
948402192 2:237692238-237692260 CGACAGGGGCGGGGCGCAGGTGG - Intronic
948709902 2:239819065-239819087 CCACAGGGGAGGAGCCCAGCCGG - Intergenic
948815930 2:240510312-240510334 GGACGGGGGAGGAGGGCAGGAGG - Intronic
948855432 2:240728108-240728130 AGACCGCGGTGGAGCACAGGTGG + Intronic
1171558138 20:26096633-26096655 GGTCCGGGGAGGAGTCCTGGGGG - Intergenic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1173622365 20:44446230-44446252 GGAACAGGGAGGAGCCCAAGGGG - Intergenic
1173803918 20:45911870-45911892 CGCCCGGGGAGGAGAGGAGGTGG + Exonic
1174126052 20:48307462-48307484 GGGGCGGGGCGGAGCCCAGGCGG - Intergenic
1175462261 20:59160367-59160389 GGGCCGTGCAGGAGCCCAGGGGG + Intergenic
1177013611 21:15757322-15757344 TGATCGGGGAGAAGGCCAGGTGG - Intronic
1178623224 21:34194318-34194340 AGAGCCTGGAGGAGCCCAGGAGG - Intergenic
1179988375 21:44933117-44933139 GGGCGGGGCAGGAGCCCAGGTGG + Intronic
1181094219 22:20495115-20495137 CGCCCAGTGAGGAGCCCAGGCGG + Intronic
1181669816 22:24420834-24420856 GGGCCAGGGAGGAGCCCAGTAGG + Intronic
1182111521 22:27727090-27727112 GGACCCGGGAGGAGCCAGGGCGG - Intergenic
1183354735 22:37352042-37352064 CTACCTGGGATGAGGCCAGGTGG - Intergenic
1183484484 22:38081859-38081881 CCAGCGGAGAGGAGACCAGGGGG + Intronic
1184258553 22:43301388-43301410 TGAGCGAGGAGGAGCCCGGGGGG - Intronic
1185077625 22:48691762-48691784 CATCCGGGGAGGGCCCCAGGCGG + Intronic
1185272689 22:49936080-49936102 CGGCGGGGGAGGAGCGCGGGCGG - Intergenic
950335146 3:12187480-12187502 CGGCCGCTGAGGAGCCGAGGAGG - Exonic
953513296 3:43565818-43565840 GGAGCGGGGAGGAGCCAAGAGGG + Intronic
960605272 3:119498509-119498531 CGACCGGGGCAAAGGCCAGGGGG - Intergenic
961071215 3:123929398-123929420 AGAAGTGGGAGGAGCCCAGGAGG - Intronic
961575762 3:127834948-127834970 CACACAGGGAGGAGCCCAGGAGG + Intergenic
962744129 3:138384895-138384917 AGACCGGCCAGGAGCCCAGCAGG + Intronic
965596723 3:170418509-170418531 CGAGCAGGGAGGAGCTGAGGAGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
968393728 4:213788-213810 CTACCCGGGAGGAGACCTGGAGG - Intergenic
968736786 4:2301481-2301503 GGAAAGGGAAGGAGCCCAGGTGG - Intronic
968953886 4:3708482-3708504 AGAACGGGGAGGTGGCCAGGGGG + Intergenic
969945721 4:10781403-10781425 ATACCGGGGAGGAGCCAAGATGG - Intergenic
970441462 4:16083812-16083834 CGGCCGCGGAGGGGCTCAGGCGG + Intronic
970984926 4:22146423-22146445 CTACTGGGGAGGAGCCAAGATGG + Intergenic
975965347 4:79966903-79966925 CGTCCGGGGAGGAGCCAAGATGG + Intronic
976282074 4:83335120-83335142 CGCCCGGGGAGGAGCGCCCGGGG + Exonic
978859408 4:113430685-113430707 CGACCAGGGTGGAGCCAAGATGG - Intergenic
979224231 4:118265841-118265863 CCGCCGCGCAGGAGCCCAGGTGG - Intergenic
984999875 4:185471904-185471926 TGTGCGGGGAGGCGCCCAGGTGG - Intronic
985908414 5:2860369-2860391 CGACCGAGGAGGACACCAGGAGG - Intergenic
992330963 5:75717191-75717213 GGTCTGGGGAAGAGCCCAGGGGG + Intronic
992597520 5:78360927-78360949 CGACCGGGCACGAGCTGAGGAGG - Intronic
994198793 5:96949301-96949323 TGACAGGAGAGGCGCCCAGGCGG - Intronic
995203078 5:109447626-109447648 TGACTGGGGAGGAGCCAAGATGG - Intergenic
1002167603 5:177358114-177358136 CACCCAGGGTGGAGCCCAGGAGG + Intronic
1003037992 6:2661801-2661823 TGGCCAGGGAGGTGCCCAGGGGG + Intergenic
1005338138 6:24817689-24817711 CCACCGAGGAGGAGCCAAGATGG - Intronic
1006572514 6:35017555-35017577 ACACCGGGGAGGAGCCGTGGAGG - Exonic
1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG + Intergenic
1012145058 6:95670330-95670352 CGGCCGAGCAGGAGCCCATGGGG - Intergenic
1012425386 6:99108506-99108528 TGACGGGGGTGGAGCTCAGGCGG + Intergenic
1015750179 6:136550770-136550792 GGTCCGAGGAGCAGCCCAGGTGG + Intronic
1017005401 6:150025229-150025251 CCGGCGGGAAGGAGCCCAGGAGG + Intronic
1017013791 6:150083777-150083799 GGTCCAGGGAGGAGCACAGGAGG + Intergenic
1018204596 6:161425611-161425633 TGACTGGGGAGTAGCCAAGGGGG - Intronic
1018851735 6:167645225-167645247 GGACCGAGGAGGAGGCCAGCTGG - Intergenic
1018872656 6:167795473-167795495 CGGCCTGGGAGGAGCCCACGAGG - Intronic
1019261866 7:86355-86377 AGGCTGGGGAGGAGCTCAGGAGG - Intergenic
1019413507 7:916961-916983 CTACCGGGGAGGTGCACAGGAGG + Intronic
1019413518 7:917001-917023 CTACCGGGGAGGTGCACGGGAGG + Intronic
1019413531 7:917041-917063 CTACCGGGGAGGTGCACGGGAGG + Intronic
1019413544 7:917081-917103 CTACCGGGGAGGTGCACGGGAGG + Intronic
1019413569 7:917161-917183 CTACCGGGGAGGTGCACGGGAGG + Intronic
1019413583 7:917202-917224 CTACCGGGGAGGTGCACGGGAGG + Intronic
1019413608 7:917282-917304 CTACCGGGGAGGTGCACGGGAGG + Intronic
1019413622 7:917323-917345 CTACCGGGGAGGTGCACGGGAGG + Intronic
1020224734 7:6271895-6271917 CGAACGGGGAGGGGGCCAGCTGG - Intronic
1022019185 7:26382220-26382242 CGAGTGGGGAGGAGCCGAGAGGG - Intergenic
1022638037 7:32155704-32155726 CTACCTGTGAGGAGTCCAGGAGG - Intronic
1023638832 7:42238040-42238062 AGACCGGGGAGGGGCGGAGGAGG - Intergenic
1024748166 7:52431314-52431336 CGGCCGTGCAGGAGCCCACGGGG + Intergenic
1025210509 7:57017495-57017517 CCCCCGGGGATGAGCACAGGAGG - Intergenic
1025661447 7:63559352-63559374 CCCCCGGGGATGAGCACAGGAGG + Intergenic
1029536929 7:101162773-101162795 TGACCGGGGGCCAGCCCAGGAGG - Exonic
1029694132 7:102202024-102202046 CGATCGGGGAGGATGGCAGGGGG - Exonic
1030980656 7:116182055-116182077 CGGCCGCGCAGGAGCCCACGGGG + Intergenic
1033153155 7:138934186-138934208 GGACCAGCGAGGAGCCCATGGGG + Intronic
1036754243 8:11461884-11461906 CGAACGTGGAGGTGCCCAGTTGG - Intronic
1040452439 8:47561665-47561687 AGATGGGGGAGGATCCCAGGAGG - Intronic
1040976452 8:53198850-53198872 AGAGCAGAGAGGAGCCCAGGAGG + Intergenic
1041950031 8:63490318-63490340 CAACGGGGGAGGAGCCAAGATGG - Intergenic
1042306983 8:67343140-67343162 TGAGCGGGGAGGAGGCCCGGGGG - Intronic
1042341317 8:67683063-67683085 AGACCGGGGGGAAGCCCGGGTGG - Intronic
1046464759 8:114586355-114586377 GGACCCGGGAGGAGCCAAGATGG - Intergenic
1046468567 8:114637298-114637320 TGACAGGGGAGGAGCCAAGATGG - Intergenic
1048741426 8:137564594-137564616 AGACGGGGGAGGAGCCAAGATGG - Intergenic
1049250850 8:141588256-141588278 TGAGCCAGGAGGAGCCCAGGTGG + Intergenic
1049896262 9:113978-114000 CGACCCGCGAGAGGCCCAGGCGG + Intergenic
1052373309 9:27690515-27690537 TTACCGGGGAGGAGCCAAGATGG + Intergenic
1058290707 9:103237481-103237503 CGACTGGGGAGGAGCCAAGATGG + Intergenic
1060521960 9:124299058-124299080 CCACTGGGGAGGAGCCTAGCGGG - Intronic
1060667328 9:125439653-125439675 AGGCCTGAGAGGAGCCCAGGAGG - Intronic
1061008904 9:127943811-127943833 CCACCCGAGAGCAGCCCAGGAGG + Intronic
1061559466 9:131393787-131393809 GGATCGGGGAGGAGACCCGGAGG - Intergenic
1061929479 9:133825052-133825074 CGGCCAAGGAGAAGCCCAGGTGG + Intronic
1061955843 9:133960923-133960945 CGGCCTTGGAGAAGCCCAGGAGG + Intronic
1062465452 9:136678848-136678870 TGAGGTGGGAGGAGCCCAGGAGG - Intronic
1062645009 9:137543406-137543428 AGAGCGGGGATGAGCCCCGGGGG - Intronic
1185586663 X:1246287-1246309 AGACAGGGGAGGAGGCCACGTGG + Intergenic
1185621464 X:1453352-1453374 CGGCCGGGGCGGTGCCCGGGGGG - Intronic
1185986999 X:4845807-4845829 TTTCTGGGGAGGAGCCCAGGTGG + Intergenic
1187173953 X:16878803-16878825 CCACATGGGAGGATCCCAGGTGG - Intergenic
1191708169 X:64116014-64116036 AGTCCGGGGAGGAGCCAAGATGG - Intergenic
1191764429 X:64681988-64682010 TGACCGGGGCGCAGCTCAGGTGG + Intergenic
1192050212 X:67717794-67717816 CCAACTGGCAGGAGCCCAGGAGG + Intronic
1192950124 X:76007832-76007854 CGACTGGGGAGGAGCCAAGATGG - Intergenic
1193319909 X:80109118-80109140 AGAAGTGGGAGGAGCCCAGGAGG - Intergenic
1195249235 X:103026599-103026621 TGACAGGGGAGGAGCCAAGATGG - Intergenic
1197370079 X:125614951-125614973 TGATGGGGGAGGAGCCAAGGTGG - Intergenic
1200751224 Y:6945723-6945745 GGACCAGGGAGTGGCCCAGGAGG + Intronic