ID: 1007103931

View in Genome Browser
Species Human (GRCh38)
Location 6:39270415-39270437
Sequence TTGAATATTCAGAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007103924_1007103931 17 Left 1007103924 6:39270375-39270397 CCTTTTCTCCAATTAATCTCCTT No data
Right 1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG No data
1007103925_1007103931 9 Left 1007103925 6:39270383-39270405 CCAATTAATCTCCTTTTGTGAGT 0: 5
1: 7
2: 6
3: 30
4: 247
Right 1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG No data
1007103926_1007103931 -2 Left 1007103926 6:39270394-39270416 CCTTTTGTGAGTCCATTTCCATT No data
Right 1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007103931 Original CRISPR TTGAATATTCAGAGGGAGAA AGG Intergenic
No off target data available for this crispr