ID: 1007105189

View in Genome Browser
Species Human (GRCh38)
Location 6:39279015-39279037
Sequence CTGGGGAAATAGGTGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007105189_1007105196 8 Left 1007105189 6:39279015-39279037 CCTGGCACCACCTATTTCCCCAG No data
Right 1007105196 6:39279046-39279068 GCATTTTGTAACTTATCCAGAGG No data
1007105189_1007105197 9 Left 1007105189 6:39279015-39279037 CCTGGCACCACCTATTTCCCCAG No data
Right 1007105197 6:39279047-39279069 CATTTTGTAACTTATCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007105189 Original CRISPR CTGGGGAAATAGGTGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr