ID: 1007107510

View in Genome Browser
Species Human (GRCh38)
Location 6:39293978-39294000
Sequence CTGTGGGGACAGTGGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007107510_1007107516 -10 Left 1007107510 6:39293978-39294000 CCCTTCTGCCACTGTCCCCACAG No data
Right 1007107516 6:39293991-39294013 GTCCCCACAGGCAAGGGCGACGG No data
1007107510_1007107523 13 Left 1007107510 6:39293978-39294000 CCCTTCTGCCACTGTCCCCACAG No data
Right 1007107523 6:39294014-39294036 GGTCTTCCTGGCCTCCTGCCTGG No data
1007107510_1007107517 -9 Left 1007107510 6:39293978-39294000 CCCTTCTGCCACTGTCCCCACAG No data
Right 1007107517 6:39293992-39294014 TCCCCACAGGCAAGGGCGACGGG No data
1007107510_1007107522 1 Left 1007107510 6:39293978-39294000 CCCTTCTGCCACTGTCCCCACAG No data
Right 1007107522 6:39294002-39294024 CAAGGGCGACGGGGTCTTCCTGG No data
1007107510_1007107524 14 Left 1007107510 6:39293978-39294000 CCCTTCTGCCACTGTCCCCACAG No data
Right 1007107524 6:39294015-39294037 GTCTTCCTGGCCTCCTGCCTGGG No data
1007107510_1007107519 -8 Left 1007107510 6:39293978-39294000 CCCTTCTGCCACTGTCCCCACAG No data
Right 1007107519 6:39293993-39294015 CCCCACAGGCAAGGGCGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007107510 Original CRISPR CTGTGGGGACAGTGGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr