ID: 1007108021 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:39296701-39296723 |
| Sequence | CTCACCGGTCAGAGAGGGTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1007108013_1007108021 | 3 | Left | 1007108013 | 6:39296675-39296697 | CCCAGCGATGTTGAGTCTGATCT | No data | ||
| Right | 1007108021 | 6:39296701-39296723 | CTCACCGGTCAGAGAGGGTGGGG | No data | ||||
| 1007108014_1007108021 | 2 | Left | 1007108014 | 6:39296676-39296698 | CCAGCGATGTTGAGTCTGATCTT | No data | ||
| Right | 1007108021 | 6:39296701-39296723 | CTCACCGGTCAGAGAGGGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1007108021 | Original CRISPR | CTCACCGGTCAGAGAGGGTG GGG | Intergenic | ||
| No off target data available for this crispr | |||||