ID: 1007108021

View in Genome Browser
Species Human (GRCh38)
Location 6:39296701-39296723
Sequence CTCACCGGTCAGAGAGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007108013_1007108021 3 Left 1007108013 6:39296675-39296697 CCCAGCGATGTTGAGTCTGATCT No data
Right 1007108021 6:39296701-39296723 CTCACCGGTCAGAGAGGGTGGGG No data
1007108014_1007108021 2 Left 1007108014 6:39296676-39296698 CCAGCGATGTTGAGTCTGATCTT No data
Right 1007108021 6:39296701-39296723 CTCACCGGTCAGAGAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007108021 Original CRISPR CTCACCGGTCAGAGAGGGTG GGG Intergenic
No off target data available for this crispr