ID: 1007109769

View in Genome Browser
Species Human (GRCh38)
Location 6:39306330-39306352
Sequence CACCGCACCCGGCCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1111
Summary {0: 1, 1: 6, 2: 40, 3: 209, 4: 855}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007109762_1007109769 9 Left 1007109762 6:39306298-39306320 CCTACCAAAGTGCTGGGATTACA 0: 1441
1: 300795
2: 267272
3: 151222
4: 133181
Right 1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG 0: 1
1: 6
2: 40
3: 209
4: 855
1007109758_1007109769 18 Left 1007109758 6:39306289-39306311 CCGCCTTGGCCTACCAAAGTGCT 0: 325
1: 58307
2: 148867
3: 160325
4: 98009
Right 1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG 0: 1
1: 6
2: 40
3: 209
4: 855
1007109760_1007109769 15 Left 1007109760 6:39306292-39306314 CCTTGGCCTACCAAAGTGCTGGG 0: 434
1: 83503
2: 207090
3: 234927
4: 154556
Right 1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG 0: 1
1: 6
2: 40
3: 209
4: 855
1007109764_1007109769 5 Left 1007109764 6:39306302-39306324 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG 0: 1
1: 6
2: 40
3: 209
4: 855
1007109757_1007109769 19 Left 1007109757 6:39306288-39306310 CCCGCCTTGGCCTACCAAAGTGC 0: 311
1: 59564
2: 176866
3: 229997
4: 183223
Right 1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG 0: 1
1: 6
2: 40
3: 209
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007109769 Original CRISPR CACCGCACCCGGCCTGGGAC TGG Intronic
900288309 1:1912633-1912655 CACCGCACTCGGCCTGGAATAGG - Intergenic
900419262 1:2548524-2548546 CATCGCACCCGGCCAGGGCCTGG - Intergenic
900463905 1:2814699-2814721 CACAGCACCGAGCCGGGGACAGG + Intergenic
900663661 1:3799266-3799288 CACCGCGCCCGGCCTGTAAATGG - Intergenic
901026135 1:6279666-6279688 CAGCCCACCCGACCTGGGAGAGG + Intronic
901292240 1:8133163-8133185 CACTGCACCCGGCCTGGGGATGG + Intergenic
901315792 1:8307230-8307252 CACCGCACCTGGCCTGTTTCTGG + Intergenic
901487931 1:9578204-9578226 CACCGCACCCGGCCTCTGGATGG + Intronic
901489206 1:9588236-9588258 CACCGCGCCCTGCCTGGATCTGG + Intergenic
901500299 1:9648811-9648833 CACTGCGCCCGGCCTGGTCCAGG - Intergenic
901504322 1:9675095-9675117 CACCGCGCCCGGCCTCAAACAGG - Intronic
901555237 1:10026556-10026578 CACCGCGCCCGGCCAGAAACGGG + Intergenic
901702995 1:11055395-11055417 CACCGCACCTGGCCTGGGGAGGG + Intronic
901900075 1:12353243-12353265 CACCGCACCCGGCCTATGTCTGG - Intronic
902238251 1:15071541-15071563 CACCGCACCCAGCCTGGGTATGG + Intronic
902316104 1:15619735-15619757 CACCGCACCCGGCCCGATAGTGG + Intronic
902450565 1:16494321-16494343 CACCGCACCTGGCCAGTGGCTGG - Intergenic
902863347 1:19261314-19261336 CACCGTGCCCGGCCTGAGCCTGG - Intergenic
902990807 1:20186022-20186044 GACCGGAACCGGCCTGGGTCGGG - Intergenic
903174277 1:21571382-21571404 CACTGCACCCGGCCTGCACCTGG - Intronic
903188565 1:21643269-21643291 CACCACACCCAGCCTCGGAGGGG - Intronic
903193691 1:21669903-21669925 CCCCACACCCGCCCTGGGCCCGG - Intergenic
903313043 1:22475435-22475457 CACCGCACCTGGCTTTGGAAAGG - Intronic
903476815 1:23625150-23625172 CACCGCGCCTGGCCAGGGGCTGG + Intronic
903542639 1:24105566-24105588 CCCCGCAGCCAGCCTGGGGCTGG - Intronic
903834684 1:26195788-26195810 CACCGCGCCCGGCCTATGCCAGG + Intronic
903844498 1:26270062-26270084 CACCGCGCCCGGCCAGGAAGCGG + Intronic
904135979 1:28312886-28312908 CATCGCGCCCGGCCTGGAATGGG + Intergenic
904201688 1:28823887-28823909 CACCGCACCCGGCCTGAATGGGG - Intronic
904209757 1:28879231-28879253 CACCGTGCCCAGCCTGGGACTGG - Intergenic
904495022 1:30881695-30881717 CCCAGCACCTGGCCTGGGGCAGG - Intronic
904511107 1:31008883-31008905 CACCGCGCCCGGCCTTGCAGGGG - Intronic
904555244 1:31358040-31358062 CACCGCGCCTGGCCTGGGCCAGG + Intronic
904664641 1:32110351-32110373 CACCGCGCCTGGCCTGGAATTGG + Intronic
904739156 1:32659270-32659292 CACCGCACCCGGCCAGGGAAAGG - Intronic
904840458 1:33368856-33368878 CCCTGCACCCAGCCTGGGTCAGG - Intronic
904939234 1:34153303-34153325 CAGCGCACCTGGCCTGTAACTGG + Intronic
905077283 1:35283623-35283645 CACTGCACCCGGCCTTGAAGTGG + Intronic
905190572 1:36230549-36230571 CACCGCGCCCGGCCTAGAAAAGG + Intronic
905208616 1:36357901-36357923 CACCGTGCCTGGCCTGGGCCCGG + Intronic
905511491 1:38524908-38524930 CACCGCACCCAGCCTGGGAAAGG - Intergenic
905535607 1:38719551-38719573 CACCGCGCCCGGCCTCAGTCTGG - Intergenic
905564786 1:38955357-38955379 CACCGCACCCGGCTTAAGACAGG + Intergenic
905680099 1:39864319-39864341 CACCGCGCCTGGCCTGGGGATGG - Intronic
905999142 1:42408707-42408729 CACTGCACCTGGCCTGGGACTGG + Intronic
906040933 1:42787310-42787332 CACCGCGCCCGGCCAGGCAAGGG - Intronic
906104320 1:43282909-43282931 CACCGCCCACTGCCTGAGACAGG - Exonic
906115021 1:43350718-43350740 CACCGCACCCGGCCAGAACCTGG - Intronic
906135776 1:43499782-43499804 CACCGCACCCGGCCAGTACCAGG + Intergenic
906213134 1:44023352-44023374 CACCGCACCCGGCCTGGGTGAGG - Intronic
907033414 1:51194787-51194809 CACCGCTCCCAGCCTGAGATGGG + Intergenic
907052765 1:51340881-51340903 TACCGCACCCGGCCTTAGGCTGG - Intronic
907156121 1:52335843-52335865 CACCGCACCCGGCCTAAGAAAGG - Intronic
907657591 1:56359951-56359973 CACTGCACCCGGCCAGGCTCAGG + Intergenic
907747930 1:57233470-57233492 CACCGCACCTGGCCTGCAGCAGG - Intronic
907768555 1:57436738-57436760 CACCGCACCCAGCCTATGCCAGG - Intronic
908121069 1:60986380-60986402 CACTGCACCCTGCCTGGAATAGG + Intronic
908344076 1:63213644-63213666 CACCGCACCCGGCCTGTAGATGG - Intergenic
908387721 1:63658462-63658484 CACCGCACCCGGCCTAATACAGG - Intronic
910945270 1:92584933-92584955 CACCACACCCGGCCTTGGGCTGG - Intronic
910965336 1:92802681-92802703 CAACGCGCCCAGCCTGGAACTGG + Intergenic
911548839 1:99255080-99255102 CACCGCGCCCGGCCTGGGCTGGG - Intergenic
912246316 1:107965050-107965072 CGGCGCACCCGGGCCGGGACCGG - Exonic
912408248 1:109460568-109460590 CATGGCACCCGGCCTAGGTCAGG - Intergenic
912488153 1:110045716-110045738 CTCCCCACACTGCCTGGGACTGG - Intronic
912831764 1:112959055-112959077 CACCGTGCCCGGCCGGGGCCAGG - Intergenic
912950938 1:114119781-114119803 CACCGTGCCCGGCCTGAGAGAGG - Intronic
913256566 1:116959683-116959705 CACCGCACCCGGCCTATAAAGGG - Intronic
913450196 1:118987872-118987894 CACCGGGCCCGGCCCGGGAGAGG + Intronic
914245253 1:145880995-145881017 CACCGCACCCAGCCATGGCCTGG - Intronic
914434143 1:147645375-147645397 CACCGCGCCCGGCCTCAAACTGG + Exonic
914861131 1:151387039-151387061 CACCGCACCCAGCCGAGAACAGG + Intergenic
914862350 1:151397258-151397280 CACCGCGCCCGGCCTGAGGTGGG + Intergenic
915316641 1:155032603-155032625 CACCGCACCCGGCCAGGACTGGG + Intronic
915393498 1:155564203-155564225 CACCGCGCCCGGCCTTGCATGGG - Intergenic
915471232 1:156126867-156126889 CACAGCACCCGGCCTGGGGCAGG + Intronic
915505585 1:156353975-156353997 CACTGCACCCGGCCTAGTTCTGG + Intronic
915807639 1:158871155-158871177 CACCGCGCCCGGCCTCTTACTGG + Intergenic
915971668 1:160359473-160359495 CACCGCGCCCGGCCATGAACAGG + Intergenic
916044373 1:160988152-160988174 CACTGCACCCGGCCTAGGATAGG - Intergenic
916046944 1:161006874-161006896 CACCGCACCCAGCCTAGAGCTGG - Intronic
916096489 1:161356248-161356270 CACTGCACCCGGCCTTGAAAAGG - Intronic
916152858 1:161812678-161812700 CACCGCGCCCGGCCAGGAGCAGG + Intronic
916184890 1:162121405-162121427 CACCGTGCCCGGCCTTGGAGAGG + Intronic
916231325 1:162544167-162544189 CACCGCACCCGGCCTTTCATTGG + Intergenic
917098776 1:171425606-171425628 CACCGCGCCCGGCCAACGACCGG - Intergenic
917150807 1:171942821-171942843 CACTGCACCCAGCCTTGCACTGG - Intronic
918383893 1:183985559-183985581 CACCGCACCCGGCCAGGACACGG + Intronic
918445414 1:184612435-184612457 CACCACACCCGGCCTCAGCCAGG - Intronic
918552405 1:185758345-185758367 CACCACACCTGGCCTGGAAGAGG - Intronic
918629491 1:186699257-186699279 CACCGCGCCCGGCCGGGCCCAGG - Intergenic
919202116 1:194368557-194368579 CACCACGCCCGGCCTAGGACAGG + Intergenic
920082613 1:203386192-203386214 CACCGCGCCCGGCCAGGGAAAGG + Intergenic
920319012 1:205103017-205103039 CACTGCACCCGGCCTTAGAAAGG - Intronic
921729571 1:218562311-218562333 CACCGCGCCCGGCCTGGGAAGGG - Intergenic
922316744 1:224449250-224449272 CACCGCACCCGGCCAGAAACTGG + Intronic
922939551 1:229449657-229449679 CACCTCGCCCGGCCTGAGAGGGG + Intronic
923235674 1:232030823-232030845 CACCGCACCTGGCCAGGCTCTGG - Intronic
923562994 1:235055609-235055631 CACCGCACCTGGCCTGGAGATGG - Intergenic
923617689 1:235551253-235551275 CACCACACCCGGCCGTGGAATGG - Exonic
924098003 1:240574206-240574228 CACTGCACCCAGCCTGAGATAGG + Intronic
924110761 1:240697195-240697217 CACCGCGCCCGGCCTGGTAAGGG + Intergenic
924111196 1:240701490-240701512 CACCATGCCCGGCCTGGTACTGG + Intergenic
924327162 1:242907450-242907472 CACCGCACCTGGCCAGGACCTGG - Intergenic
924370839 1:243348336-243348358 CACCGCGCCCGGCCTGGGGCGGG + Intronic
924483633 1:244459363-244459385 CACCGCGCCCAGCCTGGGCTTGG + Intronic
924570067 1:245229844-245229866 CACCGAACCCGGCCTCTGAGTGG - Intronic
924653300 1:245949519-245949541 CACCGCATCCGGCCTTGGTTGGG - Intronic
924744904 1:246822722-246822744 CAGCACACCTGGCCTGGTACTGG - Intergenic
924837609 1:247668326-247668348 CACCGCGCCCAGCCTAAGACAGG - Intergenic
1062847882 10:721830-721852 CACCGCGCCCGGCCCAGGACAGG + Intergenic
1063034765 10:2275768-2275790 CACTGCACCAAGCCTGAGACTGG - Intergenic
1063517926 10:6714463-6714485 CACTGCACCCGGCCTGAGGAAGG + Intergenic
1063575293 10:7256747-7256769 CACCAACCCCAGCCTGGGACTGG + Intronic
1064021405 10:11812339-11812361 CACTGCACCTGGCCTGTGACTGG - Intergenic
1064081486 10:12311419-12311441 CACCGCGCCCGGCCTCAAACAGG - Intergenic
1064135098 10:12743732-12743754 CACTGCACCTGGCCCGGAACAGG - Intronic
1064483946 10:15766169-15766191 CACCGCGCCCGGCCCCGGGCAGG + Intergenic
1064505613 10:16026997-16027019 CACCGCGCCCGGCCTGGAGATGG - Intergenic
1064609794 10:17086250-17086272 CACCGCGCCTGGCCTGTGACTGG + Intronic
1064670311 10:17707119-17707141 CACCGCACCCGGCCAGTATCTGG - Intronic
1064672636 10:17732155-17732177 CACCGCGCCCGGCCTAGATCTGG - Intergenic
1064786512 10:18903138-18903160 CACCGCGCCCGGCCTGGCATGGG + Intergenic
1065029220 10:21568104-21568126 CACCGCACCCGGCCTTGTTGGGG + Intronic
1065189252 10:23195251-23195273 AACCACACCCCGCCTGGGCCAGG - Intergenic
1065338953 10:24684925-24684947 CACCGCGCCCGGCCTAGGAATGG + Intronic
1065549386 10:26855680-26855702 CACCGCACCCGGCCCTAAACAGG - Intronic
1065657140 10:27963293-27963315 CACTGCACCCGGCCTGTCCCAGG + Intronic
1065771914 10:29085772-29085794 CACCGCACCTGGCCTGAGAGAGG + Intergenic
1066245427 10:33578713-33578735 CACCGCACCCGGCCCTGAAATGG + Intergenic
1066369265 10:34806475-34806497 CACCACACCCGGCCTATGCCTGG + Intronic
1066460879 10:35611206-35611228 CACCACACCTGGCCATGGACTGG - Intergenic
1066997386 10:42576842-42576864 CACGGCGCCCGGCCCTGGACTGG - Intronic
1067444209 10:46330490-46330512 CATTGCACCCAGCCTGGGCCTGG - Intergenic
1067924810 10:50497502-50497524 CACCGCGCCCGGCCAGGATCTGG - Intronic
1069717846 10:70532351-70532373 CACCTCCCCCGTCCTGGCACTGG + Intronic
1069889187 10:71642686-71642708 CACCGCACCCGGCCTGGGCCCGG + Intronic
1069929562 10:71873428-71873450 CACCACGCCCGGCCTGAGATAGG + Intergenic
1070257712 10:74825829-74825851 GCCTGCACCCGGCCTGGGGCTGG + Intronic
1070606875 10:77904838-77904860 CACCGCGCCCGGCCGGAGCCAGG - Intronic
1070620729 10:78008719-78008741 CACCTCACCCAGCCAGGGAAAGG - Intronic
1071338514 10:84621608-84621630 CACCGCTCCCGGCCTGGACTTGG + Intergenic
1071692936 10:87841905-87841927 CACCGCACCCGGCCTATCAGTGG - Intergenic
1071893707 10:90041335-90041357 CACCGTGCCCGGCCAGGAACAGG - Intergenic
1073175277 10:101552480-101552502 CACCGCACCCGGCCTGTCTCTGG + Intronic
1073233481 10:101992980-101993002 CACCGCGCCTGGCCTGATACTGG - Intronic
1073261157 10:102191423-102191445 CACCACACCTGGCCAGGAACTGG + Intergenic
1073740401 10:106399821-106399843 CACCGCTCCCGGCCTGTGGTAGG - Intergenic
1073792882 10:106957458-106957480 CACCGCACCTGGCCTAGCATAGG + Intronic
1074569390 10:114610863-114610885 CACCGCACCCGGCCAGTATCAGG - Intronic
1074724680 10:116296011-116296033 CACCGCACCCAGCCAGTGACAGG + Intergenic
1074976768 10:118587468-118587490 CACCCCACCAGGGCTGGGGCAGG - Intergenic
1075032437 10:119032912-119032934 CACCACACCCGGCCTGAAAATGG - Exonic
1075619488 10:123915267-123915289 CACCGCACCCGGCCTACGTGGGG - Intronic
1075636450 10:124034152-124034174 CACAGCACCCAGCCTGTGGCAGG + Intronic
1075790113 10:125077990-125078012 CACCGCGCCCGGCCTGAGAAAGG - Intronic
1076048825 10:127315985-127316007 CACTGCACCCCGCTGGGGACAGG + Intronic
1076647200 10:131961504-131961526 CACAGCACCCGGCTGGGCACTGG + Intergenic
1076897679 10:133321541-133321563 CACCGCACCTGGCCCGAGAATGG + Intronic
1076932595 10:133543111-133543133 CACCGCGCCCGGCCTACTACTGG + Intronic
1077051006 11:566924-566946 CACCACACCCGGCCTCTCACTGG + Intergenic
1077075838 11:701695-701717 CACCGCGCCCGGCCGGAGACAGG + Intronic
1077349847 11:2087634-2087656 CGCCGCGCCTGGCCGGGGACTGG - Intergenic
1077369575 11:2175279-2175301 CACTGCGCCCGGCCTGACACTGG + Intergenic
1077519270 11:3022100-3022122 CACTGCACCTGGCCAGTGACCGG - Intronic
1077678308 11:4216655-4216677 CACCGCGCCCGGCCAGGCTCAGG + Intergenic
1077978184 11:7271862-7271884 CACCGCACCTGGCCTGTGCTTGG + Intronic
1077982102 11:7310732-7310754 CACTGCACCCGGCTTGTGATTGG + Intronic
1078257822 11:9675007-9675029 CACTGCACCTGGCCTAGGAGTGG - Intronic
1078471671 11:11592536-11592558 CACAGCACACGCCCTGGGTCTGG + Intronic
1078985751 11:16594978-16595000 CACCGCGCCCGGCCTGGTTTTGG + Intronic
1079076508 11:17388291-17388313 CACCGCGCCCGGCCTGAGGCTGG - Exonic
1079240537 11:18719453-18719475 CACTGCACCCAGCCTAGAACTGG + Intronic
1079248345 11:18769690-18769712 CACCGCGCCCGGCCAGGGACTGG + Intronic
1079250851 11:18786488-18786510 CACCGCACCCGGCCTAGAATAGG + Intronic
1079281348 11:19089795-19089817 CACCGCGCCCGGCCAGAGCCTGG - Intergenic
1080513545 11:32999478-32999500 CACCGCACCCGGCCGGGTCTTGG + Intergenic
1080658874 11:34279940-34279962 CACCACACCTGGCCAGAGACAGG + Intronic
1081410067 11:42747280-42747302 CACCGCACCCGGCCACTCACTGG - Intergenic
1081503426 11:43689835-43689857 CACCGCACCCGGCCTGAACAAGG + Intronic
1081645698 11:44788733-44788755 CACCGCACCCGGCCTGGAGGAGG + Intronic
1082068701 11:47921250-47921272 CACCACGCCCGGCCTGCCACTGG + Intergenic
1082805509 11:57446939-57446961 CACCGCGCCCGGCCAGGGCTGGG + Intergenic
1083098456 11:60278205-60278227 CACTGCACCCGGCCTTGAGCTGG - Intergenic
1083251588 11:61471442-61471464 CACCGCACCCGGCCCCCAACAGG - Intronic
1083255440 11:61492571-61492593 CACCGCACCCAGCCGGGAGCAGG - Intergenic
1083598890 11:63933946-63933968 CACCGCACCCAGCCTAGGCAAGG - Intergenic
1083605364 11:63975463-63975485 CACTGCGCCCGGCCTGGGAGGGG + Intronic
1083867912 11:65467990-65468012 CACCACACCCGGCCTGAGATGGG - Intergenic
1083917304 11:65756509-65756531 CACCGCGCCCGGCCAAGTACGGG + Intergenic
1084016225 11:66383976-66383998 CACCGCACCCGGCCGGCAAGAGG + Intergenic
1084098327 11:66928097-66928119 CACCATACCCGGCCTGCCACAGG - Intronic
1084119875 11:67062751-67062773 GGCCGCACCCGGCATGGGAAGGG + Intronic
1084130391 11:67129444-67129466 CACCGCGCCCGGCCTATGCCCGG - Intronic
1084281277 11:68096073-68096095 CACCGCACCCGGCCAGGTTGAGG - Intronic
1084384189 11:68832158-68832180 CACCGCACCTGGCCTGGGCCTGG - Intronic
1084421746 11:69063861-69063883 CACGGCACTCAGCCTGGGCCAGG - Intronic
1085281507 11:75334041-75334063 CACCGCGCCCGGCCTGGGATGGG - Intronic
1085559093 11:77453790-77453812 CACCGCACCCAGCCTGGTGTTGG - Intronic
1085678817 11:78551560-78551582 CACCGCGCCCAGCCTGGAGCAGG - Intronic
1085736981 11:79047499-79047521 CACCACACTCTGCCAGGGACTGG + Intronic
1087913673 11:103782329-103782351 CACCGCGCCCTGCCTGGATCTGG + Intergenic
1088044035 11:105425717-105425739 CACCACACCCAGCCTCTGACTGG - Intergenic
1088075674 11:105845592-105845614 CACCGTGCCCGGCCTGGGATAGG - Intronic
1088556838 11:111070617-111070639 CACTGCTCCCGGCCTGGCATGGG - Intergenic
1089227155 11:116934789-116934811 CACCGCGCCCGGCCTATGCCTGG - Intronic
1089697107 11:120222623-120222645 CACTGCACCCGGCCTCTGCCAGG - Intronic
1089711727 11:120319730-120319752 CACCGCGCCTGGCCTGGGCTGGG + Exonic
1090782279 11:130018187-130018209 CACTGCACCCGGCCTTGGGTGGG - Intergenic
1091455479 12:604347-604369 CACCGCACCCGGCCAGGCTGTGG - Intronic
1091686285 12:2565178-2565200 CACCGCGCCCGGCCGGGGTTGGG - Intronic
1092133560 12:6130035-6130057 CACCGCGCCCGGCCTTGTTCTGG - Intergenic
1092250911 12:6895892-6895914 CACCACCCCTGGCCTGAGACAGG - Intronic
1092338436 12:7654918-7654940 CACCGCACCCGGCCTCTAAGAGG - Intronic
1092864271 12:12746205-12746227 CACTGCACCCGGCCTGGAACAGG - Intronic
1092892064 12:12978489-12978511 CACCACGCCCGGCCTGGAAAGGG + Intronic
1095773612 12:45989993-45990015 CCCTGCACCCGGACGGGGACAGG + Intronic
1095868921 12:47003927-47003949 CACCGCACCCGGCCAGAAAGTGG + Intergenic
1096241160 12:49961242-49961264 GGCCGCTCCCGGCCTGGGCCGGG - Intergenic
1096666786 12:53171441-53171463 CACCGCCCCCTCCCTGTGACAGG - Exonic
1096678634 12:53240446-53240468 CACCGCACTCGGCCCGAGAAAGG - Intergenic
1096729271 12:53594597-53594619 CACCGCACTTGGCCTGGGACTGG - Intronic
1096769845 12:53928158-53928180 CCACGCTCCCAGCCTGGGACGGG - Intergenic
1096872834 12:54604870-54604892 CACCACACCCAGCCTGGGAGTGG - Intergenic
1097097697 12:56562832-56562854 CACCGCACCCGGCCAGTAGCAGG - Intronic
1097215912 12:57412861-57412883 CACTGCACCCGGCCCGTGCCTGG - Intronic
1098769391 12:74535037-74535059 CACCGCGCCCCGCCTGAGGCAGG - Intergenic
1099276193 12:80578679-80578701 CACCGCACCCGGCCAAGAATGGG + Intronic
1099481227 12:83169084-83169106 CACCACACCCGGCCTGACAATGG - Intergenic
1100160874 12:91859289-91859311 CACCACACCCAGCCTAGTACAGG + Intergenic
1100487289 12:95042499-95042521 CACCGCACCTGGCCTGTCAAAGG + Intronic
1100585107 12:95972212-95972234 CACTGCACCCAGCCTGTGATGGG + Intergenic
1101400097 12:104379640-104379662 CAACGCGCCCGGCCTGGGGCTGG + Intergenic
1101982320 12:109418102-109418124 CACCGCGCCCGGCCTAAGATTGG + Intronic
1102128697 12:110507121-110507143 CACTGCACCTGGCCTGAGCCAGG + Intronic
1102545824 12:113654661-113654683 CACTGCCCCTGGCCTTGGACAGG + Intergenic
1102689931 12:114752415-114752437 CACCTCACCCTGGCTGGAACTGG + Intergenic
1102976247 12:117209009-117209031 CACCACGCCTGGCCTGGGAGGGG + Exonic
1103541259 12:121668156-121668178 CACCACACCCAGCCTGGAACTGG + Intronic
1103706613 12:122878070-122878092 CACCGCACCCGGTCTAGCAGTGG - Intronic
1103762805 12:123263814-123263836 CACCGTGCCCGGCCTGGGAGAGG - Intronic
1103785661 12:123430985-123431007 CACCGCGCCCGGCCTACGCCTGG + Intronic
1103960592 12:124606865-124606887 CGCCGCACCTGGCCTGAGAAGGG - Intergenic
1104121574 12:125805055-125805077 CACTGCACCTGGCCTGAGCCTGG + Intergenic
1104127124 12:125858384-125858406 CACCGCACCCGGCCAGTCTCAGG + Intergenic
1104873429 12:132016658-132016680 CACCGCACCCGGCCTTGGTTGGG + Intronic
1105030451 12:132879281-132879303 CACCGCACCTGGCCTGCGATAGG + Intronic
1105895054 13:24710343-24710365 CACCTCACCCGGACTGAGAATGG - Intronic
1106170547 13:27284596-27284618 CACTGCACCCAGCCTGTGTCAGG - Intergenic
1106526230 13:30543414-30543436 CACTGCACCCGGCCTGTTCCAGG + Intronic
1107036266 13:35905655-35905677 CACCACACCTGGCCTGGCTCTGG - Intronic
1107339488 13:39390704-39390726 CTCTGCACCCGGCCTTGGATTGG - Intronic
1107413195 13:40176625-40176647 CACCGCACCCGACCTGGCAAAGG - Intergenic
1107515506 13:41124923-41124945 CACCGCACCCGGCCAAAAACTGG + Intergenic
1108454790 13:50602145-50602167 CACTGCACCTGGCCTGGGAGAGG + Intronic
1110417742 13:75270432-75270454 CACCGCGCCCGGCCAGAGAGTGG + Intergenic
1111122121 13:83866496-83866518 CACCGCGCCCGGCCTGGTGGGGG + Intergenic
1111147966 13:84209777-84209799 CACCGCACCCGGCCGGGACGGGG - Intergenic
1111338726 13:86855763-86855785 CACCGTGCCTGGCCAGGGACAGG + Intergenic
1111720947 13:91944382-91944404 CACCGCGCCCGGCCTGTGGCAGG + Intronic
1111772467 13:92615764-92615786 CACCGCGCCCAGCCTGGTAGGGG - Intronic
1114190059 14:20434256-20434278 CACTGCACCCGGCCTGGCCATGG - Intronic
1114477585 14:23007862-23007884 CACCGCGCCCGGCCAGTTACGGG - Intronic
1114671231 14:24412149-24412171 CACCCAACCAGGCCTGGGAAGGG + Intronic
1115269350 14:31534510-31534532 CACCGCGCCCAGCCTGAGAGTGG + Intronic
1115567105 14:34634339-34634361 CACCGCGCCCAGCCTGGGCAGGG - Intergenic
1115621392 14:35143934-35143956 CACCGCGCCCGGCCAAAGACAGG + Intronic
1115742567 14:36403834-36403856 CAGCGCACCCGGCCTATGGCAGG - Intergenic
1115987956 14:39122007-39122029 CACCGCACCCGGCCTAAGGTTGG + Intronic
1116000660 14:39239255-39239277 CACCACACCTGGCCTTAGACTGG - Intronic
1116172668 14:41422923-41422945 CACCACATCCAGCCTGGGTCAGG + Intergenic
1116257972 14:42581945-42581967 CACCGCGCCCGGCCTGTAATAGG + Intergenic
1116261720 14:42636788-42636810 CACCGCACCCGGCCTACACCTGG + Intergenic
1116422768 14:44752195-44752217 CACCGCGCCCGGCCTGAGGTAGG - Intergenic
1117196997 14:53350205-53350227 CACCACACCCGGCCTGGCACTGG + Intergenic
1117351562 14:54886322-54886344 CACCGCGCCCGGCCTATAACTGG - Intronic
1117598117 14:57344466-57344488 CACTGCACCCAGCCTGGTAAAGG - Intergenic
1117865338 14:60142691-60142713 CACCGCTCCCGGCCTGTGTATGG - Exonic
1118404126 14:65406824-65406846 CACAGCGCCTGGCCTGGGCCAGG + Intergenic
1119146511 14:72319627-72319649 CACCGCACCCGGCCTGAAGGGGG + Intronic
1119740947 14:77013418-77013440 CACCGCGCCCGGCCTACCACAGG - Intergenic
1119865610 14:77971045-77971067 CACCGCACCCGGCCTGGTCAAGG - Intergenic
1119875320 14:78054413-78054435 CACCGCGCCCGGCCTGTTCCAGG + Intergenic
1119907720 14:78320827-78320849 CACCGCACCCAGCCAGGGCTGGG - Intronic
1120365592 14:83564296-83564318 CACCACACCCGGCCCGAGATGGG - Intergenic
1120857210 14:89223055-89223077 CACCGCAACTGGCCTGGGCTTGG + Intronic
1120887619 14:89464070-89464092 CACCGCGCCCGGCCTGGTAGTGG + Intronic
1120913592 14:89689951-89689973 CACTGCACCTGGCCTGGGTTAGG + Intergenic
1121181015 14:91928768-91928790 CACTGCGCCCGGCCTGAGACAGG - Intronic
1121183877 14:91949823-91949845 CACCGCGCCTGGCCAGAGACTGG + Intergenic
1121184890 14:91958189-91958211 CACCGTATCTGGCCTGGTACAGG - Intergenic
1121363284 14:93282617-93282639 CACCGCACCCGGCCTATGCTTGG + Intronic
1121622335 14:95359211-95359233 CACCGCACCCGGCCCCTGAGTGG + Intergenic
1121994085 14:98588485-98588507 CACCACACCCGGCCTAGGTTTGG - Intergenic
1122433935 14:101679432-101679454 CACCGCACCCGGCCAAGTCCTGG - Intergenic
1122635033 14:103125832-103125854 CACCAGAACCGGCCTGAGACTGG - Intronic
1122709503 14:103645259-103645281 CACTGCGCCTGGCCTGGGGCTGG + Intronic
1122878016 14:104677736-104677758 CACCCCACTCGGTCTGGGACAGG + Intergenic
1122914373 14:104850792-104850814 CACCACACCTGGCCTGTGCCTGG - Intergenic
1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG + Intronic
1202880345 14_KI270722v1_random:52827-52849 CACTGCACCCGGCCTGTAAAGGG - Intergenic
1202892166 14_KI270722v1_random:168858-168880 CACCGCACCCGGCCAAGATCTGG - Intergenic
1123505625 15:20939890-20939912 CACTGCCCTTGGCCTGGGACGGG - Intergenic
1123562859 15:21513598-21513620 CACTGCCCTTGGCCTGGGACGGG - Intergenic
1123599105 15:21950881-21950903 CACTGCCCTTGGCCTGGGACGGG - Intergenic
1123628655 15:22245474-22245496 CACCATACCCGGCCTGGGAGTGG - Intergenic
1124082595 15:26515799-26515821 CACCGCGCCCGGCCTGTGCTGGG - Intergenic
1124385266 15:29203112-29203134 CACCGTGCCCGGCCTAGGAACGG - Intronic
1124555413 15:30720341-30720363 CACCGCACCCAGCCAGTAACTGG + Intronic
1124602482 15:31146696-31146718 CACCGCACCCGGCCTTGAATTGG - Intronic
1124611588 15:31213436-31213458 CACCGCGCCTGGCCTAGGACTGG - Intergenic
1124641155 15:31397389-31397411 CACCGCCCCAGGCCTGAGAATGG - Intronic
1124675846 15:31685355-31685377 CACCGCACCCAGCCAGTAACTGG - Intronic
1124994254 15:34707633-34707655 CACCGCACCCAGCCTCAGAAAGG + Intergenic
1125285965 15:38092818-38092840 CACGGCACCCAGCCTGGTATAGG - Intergenic
1125482398 15:40089565-40089587 CAGGGCACCCAGCCTGGGCCTGG + Exonic
1125571169 15:40719345-40719367 CACCGCACCCGGCCAGAAAAAGG + Intronic
1125576950 15:40762819-40762841 CACCGCATCCGGCCTGTGATTGG - Intergenic
1125609274 15:40959872-40959894 CCCCGCACCTGGCCTGGGAAGGG + Intergenic
1125693622 15:41616835-41616857 CACCGCACCTGGCCTATTACAGG + Intergenic
1125722630 15:41852498-41852520 CACCGCAGCTGGCCAGGGAAAGG + Intronic
1125847269 15:42868566-42868588 CACCACACCCAGCCTGAGACAGG - Intronic
1125960989 15:43829792-43829814 CACCGCGCCTGGCCTAGCACGGG + Intronic
1126609968 15:50519424-50519446 CACCGCACCCGGCCTCAGGGTGG - Intronic
1127149366 15:56057637-56057659 CACCGCGCCCGGCCTAACACAGG - Intergenic
1127600049 15:60526368-60526390 CACAGCACCTGGCTTGGGGCAGG - Intronic
1127993158 15:64135386-64135408 CACCGCGCCCGGCCGAGGTCAGG + Intronic
1128238415 15:66082950-66082972 CCCTGCCCCTGGCCTGGGACAGG - Intronic
1128634504 15:69294395-69294417 CACCGCACCCGGCCTGGCCATGG - Intergenic
1128882744 15:71258465-71258487 CACCGCACCCAGCCTGTAAATGG + Intronic
1128906303 15:71470921-71470943 CACCGCGCCCGGCCTGAGTGAGG + Intronic
1129345162 15:74912843-74912865 CACTGCGCCCGGCCTGGGGCTGG - Intergenic
1129369757 15:75083768-75083790 CACCGCACCCGGCCAACGATGGG + Intronic
1129436665 15:75547005-75547027 CACCGTGCCTGGCCTGGCACAGG - Intronic
1129443991 15:75603333-75603355 TACCGCACTCGGCCTGGCCCAGG + Intronic
1129483024 15:75843123-75843145 CCCCGCCCCCGGCCTGGAGCCGG - Intergenic
1129668869 15:77595895-77595917 CACAGCACCCTCCATGGGACAGG - Intergenic
1130020746 15:80229215-80229237 CCCCGCACCCTGACTGGGGCTGG + Intergenic
1130565157 15:84987763-84987785 CACCGCGCCCGGCCTTGGATTGG + Intronic
1130688582 15:86060616-86060638 CACCGCGCCTGGCCTGATACTGG + Intergenic
1130722714 15:86405221-86405243 CACCGCGCCCGGCCAGGCATAGG - Intronic
1130969868 15:88723945-88723967 CACCGCACCTGGCCCGATACTGG - Intergenic
1131243436 15:90769012-90769034 CACCGCACCCGGCCTTATAGAGG + Intronic
1131545264 15:93310422-93310444 CACCGCACCCAGCCTGGAACGGG + Intergenic
1202971211 15_KI270727v1_random:240731-240753 CACTGCCCTTGGCCTGGGACGGG - Intergenic
1132903222 16:2269426-2269448 CACCGCCCCCGGCCGAGGGCGGG + Intergenic
1133075820 16:3280466-3280488 CACTGCACCCGGCCAGGGCCAGG - Intronic
1133139825 16:3735581-3735603 CACCGCGCCTGGCCAGGGATGGG + Intronic
1133142454 16:3757160-3757182 CACCACACCCGGCCTGAAATTGG + Intronic
1133209543 16:4255791-4255813 CACCGTGCCTGGCCTGGGCCCGG - Intergenic
1133927596 16:10205709-10205731 CACCGCGCCCGGCCTTTAACCGG + Intergenic
1133942377 16:10320268-10320290 CACCGCGCCCGGCCAAGGTCAGG + Intergenic
1134476819 16:14581338-14581360 CACTGCGCCCGGCCTGTGAAAGG + Intronic
1134833671 16:17344204-17344226 ACAGGCACCCGGCCTGGGACAGG - Intronic
1134896150 16:17888623-17888645 CACCACACCCGGCCAAGGCCAGG + Intergenic
1135111228 16:19692162-19692184 CACTGCACCCGGCCTGGACCTGG + Intronic
1135143878 16:19944714-19944736 CACCATGCCCGGCCTGGGGCAGG + Intergenic
1135285485 16:21189259-21189281 CACCGCACCCGGCCAGAATCTGG - Intergenic
1135292538 16:21252219-21252241 CACTGCACCTGGCCTAGGACTGG + Exonic
1135302210 16:21340373-21340395 CACCGCGCCCGGCCTCGACCTGG - Intergenic
1135342216 16:21658769-21658791 CACCGCGCCCGGCCCATGACTGG + Intergenic
1135465950 16:22684907-22684929 CACCACACCTGGCTTGGGAGCGG + Intergenic
1135700148 16:24625323-24625345 TGCCGCACCCGGCCTGGCATGGG - Intergenic
1135794114 16:25424968-25424990 CACCGTGCCCGGCCTGGCATGGG + Intergenic
1136244000 16:28962893-28962915 CCCCGCACCCAGCCTGGGACTGG - Intronic
1136353774 16:29729892-29729914 CACCGCACCCGGCCTGTTGGCGG - Intergenic
1136387522 16:29938763-29938785 CACCGCACCCGGCCAGGAAGAGG - Intergenic
1136457685 16:30390910-30390932 CACCGCGCCTGGCCAGAGACAGG + Intronic
1136481877 16:30547153-30547175 CACCGCGCCCAGCCCAGGACAGG + Intronic
1136507504 16:30714350-30714372 CACCGCGCCCGGCCTACGCCCGG + Intronic
1136608738 16:31353582-31353604 CACCGCGCCCGGCCGGGGCATGG - Intergenic
1137255822 16:46774511-46774533 CACCGCACTTGGCCTGGGAGGGG - Intronic
1137276755 16:46939686-46939708 CACCGCACCTGGCCTAGAACAGG - Intergenic
1137609083 16:49807141-49807163 CACCGCCCCCGGCCTGGCTTGGG - Intronic
1137922550 16:52505120-52505142 CACCGCACCCGGCCAAGAAGAGG + Intronic
1138077931 16:54061104-54061126 CACCCCACCCAGGCTGGGAATGG - Intronic
1138372781 16:56540546-56540568 CACCACACCCAGCCTGGGCTGGG - Intergenic
1138397778 16:56719257-56719279 CACTGCGCCCGGCTTAGGACTGG - Intronic
1138783808 16:59821888-59821910 CACAGCACCCGGCCGAGGCCAGG - Intergenic
1139266903 16:65648464-65648486 CACCGCCCCGGCCATGGGACAGG - Intergenic
1139470223 16:67174426-67174448 CGCCGGACCCCGCTTGGGACTGG + Exonic
1139571812 16:67817566-67817588 CACCGCGCCCGGCCAAGGACTGG + Intronic
1139598208 16:67969976-67969998 CACCGCGCCAGGCCTGGATCAGG - Intergenic
1139751445 16:69111358-69111380 CACCGCACCTGGCCTAGGCCAGG + Intronic
1139754098 16:69129140-69129162 CACCGCACCCGGCCTCTGCCTGG - Intronic
1139806730 16:69572048-69572070 CACCGCACCTGGCCTGCGCTTGG + Intronic
1140086348 16:71800511-71800533 CCCCGCACCCGACCCGAGACGGG - Intronic
1140202990 16:72909597-72909619 TACCGCACCCGGCCTGAGCCTGG - Intronic
1140505738 16:75471070-75471092 CACTGCACCCAGCCTAGGGCAGG + Intergenic
1140798782 16:78465466-78465488 CACCACACCCAGCCTGGGGGAGG + Intronic
1141081600 16:81057741-81057763 CACCACACCCGGCCTGTTTCAGG - Intronic
1141089598 16:81121180-81121202 CACCGCACCCGGCCGGGAAAGGG - Intergenic
1141149810 16:81556200-81556222 CACCCCACCCGGGCTAGAACAGG - Intronic
1141556105 16:84837703-84837725 CACCGCCCCCGGCCAGCCACAGG + Intronic
1141640367 16:85337591-85337613 CACCGCGCCCGGCCAGGCTCAGG + Intergenic
1141694533 16:85613406-85613428 CGCCGCACCCGGCCGGGGACGGG + Intronic
1141718087 16:85738617-85738639 CACCGCGCCGGGCCCGGCACTGG + Intronic
1141974545 16:87506800-87506822 CAACGCACCCTACCTGGGGCAGG - Intergenic
1142015608 16:87745227-87745249 CACAACACCCGCCCTGGGGCCGG + Intronic
1142018642 16:87766133-87766155 CACCGCGCCCAGCCCGGGGCCGG - Intergenic
1142020645 16:87780105-87780127 CACCGTGCCCGGCCTGAGACAGG + Intergenic
1142183582 16:88683842-88683864 CACTGCGCCCGGCCTGGGCAAGG + Intronic
1142194708 16:88734042-88734064 CACTGCATCCTGCCTGGGAGAGG + Exonic
1142201769 16:88764462-88764484 CACCGCGCCCGGCCTGGCAGGGG - Intronic
1142297547 16:89235868-89235890 CACCGCCCCCGGCCTGGGCTTGG - Exonic
1203141556 16_KI270728v1_random:1770628-1770650 CACCGCACCTGGCCAGGGTTTGG + Intergenic
1142637579 17:1267769-1267791 CACCGCTCCCGGCCCTGAACTGG - Intergenic
1142646151 17:1315170-1315192 CACCGTGCCCGGCCGGGGAGAGG - Intergenic
1142657045 17:1400990-1401012 CGCCGCGCCCGGCCAGGGCCCGG - Intergenic
1142706490 17:1698198-1698220 CACCGCACCCAGCCGGAGATGGG - Intergenic
1142861164 17:2762688-2762710 CACTGCACCCAGCCTGGGTTAGG + Intergenic
1142866275 17:2793440-2793462 CACTGCACCCGGCCTGCAACAGG + Intronic
1142922496 17:3201700-3201722 CACCGCACCCGGCCTCAGTGTGG - Intergenic
1143064871 17:4239044-4239066 CACCACGCCCGGCCTAGGGCAGG + Intronic
1143146024 17:4776135-4776157 CACCGCGCCTGGCCTGTGTCTGG + Intronic
1143217472 17:5235666-5235688 CACCGCACCCAGCCAGAGCCCGG - Intergenic
1143249308 17:5511140-5511162 CACCGTGCCCGGCCTGGATCTGG - Intronic
1143304753 17:5937513-5937535 CACCGCACCTGGCTTGTGAATGG + Intronic
1143506170 17:7366805-7366827 CACTGCGCCCGGCCAGGGATAGG + Intergenic
1143665143 17:8353434-8353456 CACCGCACCCAGCCTAGGATTGG + Intergenic
1143771553 17:9172207-9172229 CACCGCACCCCGCCTAGAAAGGG - Intronic
1143878476 17:10011686-10011708 CACCGCACCCGGCCTTGAGATGG - Intronic
1144608164 17:16686184-16686206 CACCACACCTGGCCTGTGATTGG + Intergenic
1144700947 17:17339013-17339035 CACCGCACCTGGCCTGTCATTGG + Intronic
1144817538 17:18046314-18046336 CACAGCACCCAGCCTGGAGCAGG - Intronic
1144869166 17:18358122-18358144 CACCGCGCCCAGCCTGGGCTAGG + Intronic
1145089706 17:19976803-19976825 CACCGCGCCCGGCCTCTGTCTGG + Intronic
1145127875 17:20316786-20316808 CACCACACCTGGCCTGTGATTGG + Intronic
1145196673 17:20900036-20900058 CACCACACCTGGCCTGTGATTGG - Intergenic
1145209219 17:21000772-21000794 CACCGCACCTGGCCTATGAGTGG - Exonic
1145225357 17:21123796-21123818 CACCGCGCCCGGCCGAGGGCTGG - Intronic
1145228408 17:21151216-21151238 CACCGCACCCAGCCTAGAAGTGG - Intronic
1145360509 17:22208188-22208210 CACTGCACCTGGCCAGGGAAAGG + Intergenic
1145750181 17:27349605-27349627 CACCCCTCGCGGCCTGGGGCGGG - Intergenic
1145828844 17:27898640-27898662 CACCGCGCCCAGCCAAGGACCGG - Intergenic
1145832143 17:27924979-27925001 CACCGAACCCGGCCGAGGTCAGG + Intergenic
1145950610 17:28813832-28813854 CACCGCGCCCGGCATGGAATAGG + Intronic
1146001873 17:29135388-29135410 CACCGCGCCCGGCCAAGAACTGG + Intronic
1146033063 17:29383067-29383089 CACCGCGCCCGGCCTAGGTCAGG - Intergenic
1146115276 17:30131958-30131980 CACCGCGCCTGGCCTTGCACTGG - Intronic
1146228589 17:31089203-31089225 CACCGCACCCGGCCTAAGTTGGG + Intergenic
1147310714 17:39594748-39594770 CACCGCACCCGGCCCAGTTCAGG + Intergenic
1147685129 17:42282626-42282648 CACCGCACCGGGCCTGTGACTGG + Intergenic
1148119731 17:45201405-45201427 CACCACACCCGGCCTGGTCCTGG + Intergenic
1148392196 17:47280643-47280665 CATCGCACCCGGCCGGTTACAGG + Intronic
1148592454 17:48826748-48826770 CACCGCACCCGGCCCGAGATGGG + Intergenic
1148682479 17:49482722-49482744 CACAGCACCCAGCCTGTGCCTGG - Intergenic
1148813014 17:50306759-50306781 CACCGCACCCGGCCTGAGTTGGG - Intergenic
1149529481 17:57383366-57383388 CACCGCACCCAGCCTAGAAATGG - Intronic
1149912867 17:60582242-60582264 CACCGCACCTGGCCTGGATATGG + Intronic
1150103516 17:62444566-62444588 CACCGCACCCGGCCAGGAGCAGG + Intronic
1150273095 17:63879345-63879367 CACCGCGCCCTGCCTGAGGCTGG + Intronic
1150789423 17:68189610-68189632 CACCGCGCCCGGCCTTGTCCTGG + Intergenic
1150824825 17:68465218-68465240 CACCGCGCCCGGCCCCGGCCGGG + Intergenic
1151251979 17:72843235-72843257 CACCGCGCCCGGCCTGGGGAGGG + Intronic
1151488717 17:74419044-74419066 CACCGCGCCCGGCCTGAGTATGG - Intergenic
1151639352 17:75378095-75378117 CACTGCACCTGGCCTGGGTTTGG - Intronic
1151720165 17:75850531-75850553 CACCGCACCCGGCCCCAGCCAGG + Intronic
1151913213 17:77098208-77098230 CACTGCACCGGGCCTAGAACAGG - Intronic
1152280166 17:79380467-79380489 CAGCGCCCCTGGCCTGGGAGAGG + Intronic
1152496919 17:80679879-80679901 CACCTCACCCAGCCTGGGAGTGG - Intronic
1152968007 18:134338-134360 CACCGCACCCGGCCTGATTGTGG - Intergenic
1153174617 18:2356993-2357015 CACTGCATCCCACCTGGGACGGG + Intergenic
1153272501 18:3336366-3336388 CACCGCGCCCGGCCTATGAATGG + Intergenic
1154152819 18:11920117-11920139 CACCGCAGCCGGCCTGTTTCAGG + Intergenic
1154209559 18:12367878-12367900 CACCGCGCCCGGCCAGAGGCAGG - Intronic
1155156154 18:23159251-23159273 CACTGCACCCGGCCTGGTCAGGG + Intronic
1155276887 18:24197057-24197079 CACCACACCCGGCCAGCAACTGG - Intronic
1155967289 18:32048121-32048143 CACTGCACCCGGCCTGAGACAGG - Intronic
1156168312 18:34450768-34450790 CACCGCACCCAGCCTACTACTGG + Intergenic
1156469001 18:37365772-37365794 CACCGCACCCGGCCTGGGATGGG + Intronic
1156472758 18:37387900-37387922 CATCTCACCTGGCCTGGGGCTGG + Intronic
1157336190 18:46739251-46739273 CACCACACCCGGCCAGTGAAGGG - Intronic
1157375425 18:47159905-47159927 CACCGCGCCCGGCCAAGGATGGG - Intronic
1157515396 18:48307559-48307581 CACCGCACCCGGCCAGAGGTGGG - Intronic
1157883179 18:51341403-51341425 CACTGCACTGGGCCTAGGACTGG + Intergenic
1158127963 18:54122695-54122717 CACCGCACCCGGCCAGAAAGAGG - Intergenic
1158139965 18:54244938-54244960 CACCGCGCCCGGCCTGAGGTGGG + Intergenic
1158255018 18:55536844-55536866 CACCACACCCGGCCAGAAACTGG - Intronic
1158805345 18:60964946-60964968 CACCGTGCCCGGCCTCTGACTGG + Intergenic
1159030278 18:63223626-63223648 CTCAGCTCCCAGCCTGGGACAGG + Intronic
1160231045 18:77049205-77049227 CACCGCACCCGGCCGAGGGCAGG + Intronic
1160515859 18:79478843-79478865 AACAGCACCAGGCATGGGACGGG + Intronic
1160700773 19:506315-506337 CACCGCGCCCGGCCTACCACAGG + Intergenic
1160705681 19:529082-529104 CACCGCGCCCGGCCTGGGTTGGG - Intergenic
1160724142 19:610207-610229 CACCGCCCCCGGCCTGCAGCGGG - Intronic
1160770883 19:830566-830588 CACCGCACCCGGCCCCTGCCGGG + Intronic
1160794094 19:936076-936098 CACCGCGCCCGGCCCGTGATGGG + Intronic
1160936897 19:1600499-1600521 CACCGCGCCCGGCCGGGCACAGG + Intronic
1160993110 19:1868929-1868951 CACCGCACCCGGCCGATGAGGGG + Intergenic
1161123369 19:2542402-2542424 CACCGCGCCTGGCCTGGGGTGGG + Intronic
1161190483 19:2952133-2952155 CACCACACCCGGCCTTAGGCAGG - Intergenic
1161267978 19:3373801-3373823 CTCGGCACCCTACCTGGGACCGG + Intronic
1161271395 19:3391506-3391528 CACCGCGCCTGGCCTACGACTGG - Intronic
1161417025 19:4153081-4153103 CACCGCACCCGGCCAGTTACAGG - Intergenic
1161545067 19:4875669-4875691 CACCGCGCCTGGCCAGGGCCTGG + Intergenic
1161660207 19:5541152-5541174 CACCGCACCCAGCCTGATAATGG - Intergenic
1161756017 19:6134971-6134993 CACCGCGCCTGGCCTGGGAGTGG - Intronic
1161756810 19:6139933-6139955 CACCGCACCCAGCCTATGCCTGG - Intronic
1161932495 19:7350113-7350135 CACCACCGCCTGCCTGGGACTGG + Intronic
1162090888 19:8279321-8279343 CACCGCACCCGGCCCAGAGCTGG + Intronic
1162093121 19:8294159-8294181 CACCGCACCCGGCCCAGAGCTGG + Intronic
1162137340 19:8563798-8563820 CACCGCGCCTGGCTTGAGACAGG + Intronic
1162200351 19:9015467-9015489 CACCGCACCCGGCCAGGGAGTGG + Intergenic
1162256718 19:9496510-9496532 CACCGCACCAGGCCTGGCTTTGG + Intronic
1162353083 19:10163253-10163275 CACCACACCTGGCCTAGAACAGG + Intronic
1162375533 19:10303126-10303148 CACCACACCCGGCCTGAGTCGGG + Intergenic
1162445932 19:10722629-10722651 CACCGCGCCTGGCCTGAGATAGG + Intronic
1162518005 19:11161419-11161441 CACCACGCCCGGCCAGAGACAGG + Intergenic
1162555939 19:11385601-11385623 CACCGCGCCCGGCCTACGCCTGG - Intronic
1162579456 19:11519677-11519699 CACCGCGCCTGGCCAGGTACAGG - Intronic
1162592269 19:11599615-11599637 CACCGCGCCCGGCCTAAGTCAGG - Intronic
1162772255 19:12956307-12956329 CACCGCCCCCGGCCTGGGACAGG + Intronic
1162888843 19:13717359-13717381 CACCTCACCCGGCCCAGGGCAGG - Intergenic
1163037277 19:14577808-14577830 CACCGCACCTGGCCAGGACCCGG + Intergenic
1163041692 19:14607489-14607511 CACCGCGCCCGGCCAGGAGCTGG + Intronic
1163102645 19:15107556-15107578 AGCCCCACCCGGCCTGGGAGCGG + Intronic
1163239071 19:16048065-16048087 CACCGCACCCAGGCTGAGACTGG - Intergenic
1163313659 19:16528663-16528685 CACCGCACCCGGCCTAGCAAAGG - Intronic
1163315759 19:16539433-16539455 CACCGCGCCCGGCCTAGCAACGG + Intronic
1163430722 19:17265660-17265682 CACCGCACCCGGCTAGGGATGGG + Intronic
1163435597 19:17293383-17293405 CACCGCGCCCGGCCTGGAGGAGG + Intronic
1163448959 19:17364371-17364393 CACCACACCCAGCCTGGGGTGGG + Intronic
1163555469 19:17989924-17989946 CACGGCTCCCTGCCAGGGACGGG + Intronic
1163614279 19:18317633-18317655 CACCGCACCCGGCCCTGAACTGG + Intronic
1163716762 19:18877460-18877482 CACTGCAGCCGGCCTGAGTCGGG - Intronic
1163766140 19:19164523-19164545 CACCGCACCCGGCCTGGAACAGG - Intronic
1163868828 19:19800870-19800892 CACCGCTCCCAGCCTGAAACAGG - Intronic
1163938715 19:20473889-20473911 CACCGCACCCAGCCAGGAAGGGG - Intergenic
1164276374 19:23722330-23722352 CACTGCGCCCTGCCTGAGACTGG + Intergenic
1164471981 19:28543863-28543885 CACTGCACCCGGCCTTCTACTGG + Intergenic
1164632979 19:29773818-29773840 CACCGCACCCGGCCTACTACTGG + Intergenic
1165012711 19:32860266-32860288 CACTGCACCCGGCCAGCGAATGG - Intronic
1165044735 19:33095688-33095710 CACCGCGCCCGGCCTGGTCGGGG + Intronic
1165058635 19:33194454-33194476 CGCCGCGGCCGGCCTGGGCCCGG - Intronic
1165191707 19:34069095-34069117 CACCGCGCCCGGCCTGTAATTGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165407293 19:35638622-35638644 CACCGCACCCAGCCGGTCACAGG - Intergenic
1165453329 19:35897530-35897552 CACCACGCCCGGCCTGGAAAAGG + Intronic
1165532581 19:36416782-36416804 CACCGCCCCCAGCCTAGAACAGG - Intronic
1165556070 19:36633324-36633346 CACCGCACCCGGCCTATAATCGG + Intergenic
1165620882 19:37246480-37246502 CACCGCGCCCAGCCTCAGACTGG - Exonic
1165682394 19:37789155-37789177 CACAGCCCCCGGCCTGGAATAGG - Intronic
1165752624 19:38269895-38269917 CACCGCGCCCGGCCTGAGATGGG + Intronic
1165759889 19:38314968-38314990 CACCGCACCCGGCATGGAAGAGG - Intronic
1165935282 19:39385091-39385113 CACCCCACCCAGCCCGGCACTGG - Intronic
1166282882 19:41806973-41806995 CACCGCACCCGGCCTTGTCTTGG + Intronic
1166489884 19:43249631-43249653 CACCGCACCCGACCTGGATGTGG - Intronic
1166793967 19:45415043-45415065 CACCGCGCCCGGCCTAGTATTGG - Intronic
1166823169 19:45592901-45592923 CACTGCACCCGGCCTGAGTTGGG - Intronic
1166832166 19:45645368-45645390 GACCGGGCCCGGGCTGGGACCGG - Exonic
1166868957 19:45859060-45859082 CATCGCCCCCGGCCTAGAACAGG + Intronic
1166954737 19:46455832-46455854 CACCGCGCCTGGCCTGGAACGGG - Intergenic
1167158464 19:47753153-47753175 CACCGCACCCGGCCAAGGGAGGG - Intronic
1167225483 19:48236500-48236522 CACCGCACCCAGTCTGGGATAGG + Intronic
1167471291 19:49677660-49677682 CCCCGCCCCCGGCCGGGGAGGGG + Intronic
1167478440 19:49714011-49714033 CACCGCGCCCGGCCTGGAGATGG - Intergenic
1167479030 19:49717895-49717917 TACCGCACCCGGCCCGAGACTGG - Intergenic
1167633768 19:50641455-50641477 CACCGCGCCCGGCCTAGCCCAGG + Intronic
1167683582 19:50941447-50941469 CACTGCGCCCTGCCTGGGGCTGG + Intergenic
1168028137 19:53658591-53658613 CACCGCACCCAGCCATGGAGAGG - Intergenic
1168217075 19:54934227-54934249 CACCGCACCCGGCCTGTTTTTGG + Intronic
1168535451 19:57165515-57165537 CACCGTGCCCGGCCAGGGTCTGG - Intronic
1168678906 19:58299479-58299501 CACCGCGCCTGGCCTGACACGGG - Exonic
925576752 2:5368229-5368251 CACTGCACCCGTCCTGGGATGGG + Intergenic
925625412 2:5837906-5837928 CACCGCGCCCGGCCTAGGCTTGG + Intergenic
926086094 2:10021257-10021279 CACCGCACCCAGCCGGGTTCAGG - Intergenic
926144852 2:10390767-10390789 CCCACCCCCCGGCCTGGGACTGG + Intronic
927141748 2:20135719-20135741 CACCGCGCCTGGCCTGAGAAAGG + Intergenic
927516802 2:23676468-23676490 CACCGCACCTGGCCGAGGATGGG + Intronic
927709095 2:25314196-25314218 CACCCCACCCTCCCTGGGTCAGG + Intronic
927775225 2:25897579-25897601 CACCGCACCCTGCCTGCTTCTGG + Intergenic
927995701 2:27484301-27484323 CACCACGCCCGGCCTGGAAGTGG - Intronic
928136042 2:28688165-28688187 CACTGCACCTGGCCCGGGGCAGG - Intergenic
928138648 2:28708519-28708541 CACTGCACCCGGCCAGGTCCTGG - Intergenic
929169845 2:38920694-38920716 CACCACACCTGGCCTGTGAATGG + Intronic
929465461 2:42139995-42140017 CACCGCACCCGGCCTAGCAGTGG + Intergenic
929549037 2:42877597-42877619 CACGGCACCCGGCCTATGGCTGG + Intergenic
929715011 2:44301450-44301472 CACTGTGCCCGGCCTGGAACTGG - Intronic
929742722 2:44620978-44621000 CACCGCACCCGGCCTGCTCCAGG - Intronic
929848869 2:45562518-45562540 CACCGCGCCCGGCCTGTCACTGG + Intronic
930045108 2:47163947-47163969 CACCGCGCCCGGCCTGAGACGGG - Intronic
930070043 2:47358901-47358923 CACCGCACCCGGCCTACGCCTGG - Intronic
930109420 2:47665858-47665880 CAGCGCACCCGGCCTGCAAATGG + Intergenic
930141347 2:47954117-47954139 CACCGCGCCCGGCCTGGAGGAGG - Intergenic
930203551 2:48566569-48566591 CACCGCACCCGACCTGTGACTGG + Intronic
930204730 2:48576765-48576787 CACCGCGCCCGGCCTGCAAACGG - Intronic
930836506 2:55799577-55799599 CACCGCACCCGGCCCCTGATAGG - Intergenic
931383300 2:61773726-61773748 CACCGCACCCGGCCTGATTCAGG - Intergenic
931763119 2:65433449-65433471 CACCGCACCCGGCCAAGGAACGG + Intergenic
931773067 2:65516170-65516192 CACCGCACCCGGCCCGAAGCAGG - Intergenic
932184931 2:69686456-69686478 CACCGCACCTGGCCTGAGACAGG + Intronic
932467176 2:71931414-71931436 CACCGCGCCTGGCCTGCCACTGG + Intergenic
933270838 2:80231273-80231295 CACCACACCCGGCCTGTTCCTGG + Intronic
933785801 2:85840655-85840677 CACCGCACCTGGCCTAGAAGGGG - Intronic
934650786 2:96090249-96090271 CACCAGCCCCGGCCTGAGACAGG + Intergenic
934989909 2:98913844-98913866 CAAGGCACCTGGCCTGGGGCAGG + Intronic
935006020 2:99077848-99077870 CACCGCACCCGGCCTGCACGCGG + Intronic
935239142 2:101163329-101163351 CACCGCGCCTGGCCTGGGTTCGG - Intronic
936456336 2:112677337-112677359 CACCGCACCCGGCCTAGCTCTGG - Intergenic
936463761 2:112729408-112729430 CACCGCGCCTGGCCTTGGCCTGG + Intronic
936698974 2:114987066-114987088 CACTGCACCCGGCCTAGGATAGG + Intronic
937124717 2:119466461-119466483 CAACGCACCCGACCTGACACAGG - Intronic
937966881 2:127518856-127518878 CACCGCACCCGGCCCAAGACAGG + Intronic
937981336 2:127617788-127617810 CACCGCGCCCGGCCTTGTAACGG + Intronic
938322717 2:130375712-130375734 CACTGCTCCCGGCCTTGGTCTGG + Intergenic
938627443 2:133126306-133126328 CACATCACCCAGCCTGGGCCAGG + Intronic
938976795 2:136486457-136486479 CACCGCACCCGGCCTGCTAAGGG - Intergenic
939275735 2:139993725-139993747 CACCGTGCCCGGCCTAGCACAGG - Intergenic
940228243 2:151422803-151422825 CACCGCACCTGGCCTTGGGTGGG + Intronic
940342712 2:152598398-152598420 CACCGCACCCAGCCTGAGAATGG - Intronic
940955872 2:159726548-159726570 CACCGCCCCCGGCCAGATACAGG + Intronic
940960131 2:159776139-159776161 CACTGCGCCCGGCCTGTGCCTGG + Intronic
941147235 2:161863911-161863933 CACTGCGCCCGGCCTAGAACTGG - Intronic
941430744 2:165411006-165411028 CACCGCGCCCGGCCCGGGTCTGG - Intergenic
941856210 2:170233881-170233903 CACCGCGCCCGGCCAGAAACAGG - Intronic
941934424 2:170972058-170972080 CACCGCGCCTGGCCCGGAACAGG - Intergenic
941955694 2:171202165-171202187 CACCGCGCCCGGCCTGAGCCGGG - Intronic
943936231 2:193919885-193919907 CACTGCACCCAGCCTGAGACTGG - Intergenic
944702855 2:202261168-202261190 CACTGCACCCAGCCTGTGCCAGG - Intergenic
945097283 2:206231605-206231627 CACCGCGCCCGGCCCTGGTCAGG + Intergenic
945452927 2:210014375-210014397 CACCGCGCCCGGCCTGGAGTAGG + Intronic
945735038 2:213588512-213588534 CACCGCGCCCGGCCATGGATAGG - Intronic
945863943 2:215155803-215155825 CACCGCACCCGGCCTATCAGGGG - Intergenic
946390196 2:219410476-219410498 CACCGCACCCGGCCAAGGAAAGG + Intergenic
947198871 2:227596928-227596950 CACCGCACCTGGCCTGAAGCTGG + Intergenic
947253460 2:228134984-228135006 CACTGCACCCGGCCTTGAAGTGG - Intronic
947718077 2:232351741-232351763 CACCCCACCCGGCCTTGGCTGGG - Intergenic
947797321 2:232902710-232902732 CACCGCACCCGGCCTCGTTGTGG - Intronic
948552888 2:238786426-238786448 GACAGCACCCGGCCTTGGAAAGG - Intergenic
948942748 2:241204312-241204334 CAGGACACCAGGCCTGGGACTGG + Intronic
1168829797 20:839640-839662 CACCGCAGCCGTCCAGAGACTGG - Intronic
1168936291 20:1668568-1668590 CACCGCACCCAGCCTTTCACAGG + Intergenic
1168944093 20:1736957-1736979 CACCGCACCCGGCCAGGATATGG + Intergenic
1169078615 20:2779432-2779454 CACCGCGCCCGGCCTGGACAAGG - Intergenic
1169541702 20:6606652-6606674 CACCACACCCAGCCTGAGACTGG + Intergenic
1170574701 20:17653545-17653567 CACCGCGCCTGGCCAGGGCCAGG - Intronic
1170674296 20:18464961-18464983 CACCGCACCCGGCCAGCACCGGG + Intronic
1170935945 20:20809645-20809667 CACCGCACCTGTCTTGGGAAAGG + Intergenic
1171030294 20:21670498-21670520 CACCGCGCCCGGCCTGCAGCTGG - Intergenic
1171457524 20:25280467-25280489 CCCCCCACCTGGCCTGGGAGAGG + Intronic
1172072210 20:32266258-32266280 CACCGCTCCCAGCCCGTGACTGG + Intergenic
1172135342 20:32682943-32682965 CACCGCACCCGGCCAGGGGGAGG - Intergenic
1172149071 20:32778048-32778070 CACCACACCCGGCCTGAAGCGGG - Intronic
1172247810 20:33457924-33457946 CACCGCACCCAGCCCAGGCCTGG + Intergenic
1172609912 20:36242679-36242701 CACCGCACCCAGCCTTTAACAGG + Intronic
1172648540 20:36486898-36486920 CACCTCACCCGGCCTGGAATGGG + Intronic
1172836621 20:37877426-37877448 CTCAGCACCCAGCCTGGGCCTGG - Intergenic
1172849348 20:37949505-37949527 CACCGCACCCGGCTGGGGGAAGG + Intergenic
1172958340 20:38778449-38778471 CACCGCGCCCGGCCTGCATCAGG + Intergenic
1173179991 20:40799016-40799038 CACCGCACCCGGCCAGCTGCCGG - Intergenic
1173564404 20:44028723-44028745 CACAGCACCAGGACTGGGAGGGG - Intronic
1173565700 20:44036858-44036880 GACAGCACCCAGCCTGGCACAGG - Intronic
1173609761 20:44358319-44358341 CACTGCACCCAGCCTGGGAGAGG - Intronic
1173662155 20:44742322-44742344 CCCAGCACCCAGCCTGGGACTGG + Intergenic
1174369563 20:50077490-50077512 CACCGCACCCGGCCCCTGCCTGG - Intergenic
1174505176 20:51013013-51013035 CACCGCACCCGGTCGAGGGCTGG - Intronic
1175429336 20:58891156-58891178 GCCCGCGCCCGGCCGGGGACGGG - Intronic
1175865065 20:62171188-62171210 CACCGCACCCGGCCACAAACTGG + Intronic
1175873603 20:62219591-62219613 CAGGGGACCCGGCCTGGGAAGGG - Intronic
1176888270 21:14282648-14282670 CACCGCGCCGGGCCCGAGACTGG - Intergenic
1177202633 21:17975037-17975059 CACTGCACCAGGCCTGTCACTGG - Intronic
1177484737 21:21742716-21742738 CACCGCGCCCGGCCAGGCAGAGG + Intergenic
1177727667 21:24990366-24990388 CACCGCACCTGGCCTAGCAAGGG - Intergenic
1177775180 21:25559677-25559699 CACCGCGCCTGGCCTGGAGCAGG + Intergenic
1178325381 21:31641414-31641436 CACCGCGCCCGGCCGTGGAGTGG + Intergenic
1178330893 21:31690194-31690216 CACTGCACCTGGCCTGGTATTGG - Intronic
1178350706 21:31871623-31871645 CACCGCGCCCGGCCTCAGAGTGG + Intergenic
1178557318 21:33604077-33604099 CACCACGCCCGGCCAGAGACGGG - Intronic
1178662542 21:34519683-34519705 CACCGCGCCCGGCCTGTGCTTGG + Intronic
1178846114 21:36175501-36175523 CACCATACCCGGCCGGAGACAGG - Intronic
1178858857 21:36272694-36272716 CACCGCGCCCGGCCTGAGATGGG - Intronic
1178959691 21:37053511-37053533 CACCGTACCTGGCCTGTGAAGGG + Intergenic
1179725783 21:43340607-43340629 CACAGCTCCTGGCCTGGGAAGGG - Intergenic
1179731980 21:43373130-43373152 CACCACACCCGGCCGGCGACCGG - Intergenic
1179815714 21:43904727-43904749 CACAGCAGCGGGCCTGGGAACGG - Intronic
1179821325 21:43939051-43939073 GGCCGCACCAGGGCTGGGACGGG + Intronic
1180222428 21:46367593-46367615 CACCGCACCCGGCCTGAGCTGGG + Intronic
1180633068 22:17243294-17243316 CACCGTGCCCAGCCTCGGACTGG - Intergenic
1180660461 22:17462625-17462647 CACTGCAGCTGGCCTAGGACAGG - Intronic
1180756160 22:18163353-18163375 CACCGCGCCCAGCCTGGGAGAGG - Intronic
1181369140 22:22402729-22402751 CACTGCACCCGGCCTAAGATGGG + Intergenic
1181652686 22:24269539-24269561 CGCCGCAGCCGTCCAGGGACTGG - Intergenic
1181781748 22:25198725-25198747 CACCGCGCCCGGCCTGTAACTGG + Intergenic
1182268264 22:29136283-29136305 CACCGCACCCGGCCAGGGCTAGG - Intronic
1182312348 22:29418214-29418236 CACCGCACCCAGCCTCGAATGGG + Intronic
1182414717 22:30213828-30213850 CACCGCACCCGGCCCAGAAATGG - Intergenic
1182486505 22:30642293-30642315 CACCACACCCAGCCTGAGATAGG + Intronic
1182729029 22:32472733-32472755 CACCGCGCCTGGCCTGTGTCTGG - Intergenic
1182763502 22:32741983-32742005 CACCGCGCCCGGCCAGGGCTTGG - Intronic
1182775488 22:32828448-32828470 CACAGCACCCAGCCAGGGATTGG - Intronic
1183087574 22:35495870-35495892 CACCGCACCCAGCCTGGAACTGG - Intergenic
1183257862 22:36774517-36774539 CACTGCGCCCGGCCAGGTACTGG - Intronic
1183301113 22:37059610-37059632 CACTGCTCCCAGCCTGGGCCTGG - Intronic
1183401757 22:37609007-37609029 CCCCGCCCCCGGCCCGGGAGGGG + Intronic
1183470640 22:38004269-38004291 CACCACACCTGGCCAGGGGCTGG + Intronic
1183684388 22:39353148-39353170 CACCGCACCCGGCCTGGACCTGG + Intronic
1183973141 22:41493651-41493673 CACCGCACCCAGCCAAGGAATGG - Intronic
1184220357 22:43096027-43096049 CACCGCACCCGGCCCGGCTGGGG - Intergenic
1184346112 22:43914179-43914201 CACCGCGCCTGGCCTGGAAAGGG + Intergenic
1184720748 22:46311364-46311386 CACTGCACCCGGCCGAGTACAGG + Intronic
1185095199 22:48802666-48802688 CACCGCAGCCGGCCTTGCAGGGG + Intronic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
1185306760 22:50122077-50122099 CACTGCACCCGGCCTGTCATTGG + Intronic
1185376033 22:50482927-50482949 CACAGCACCCTGGCTGGGATGGG - Exonic
949997747 3:9632051-9632073 CACCATGCCCGGCCTGGGATTGG - Intergenic
950512422 3:13439120-13439142 CACCGCACCTGGCCGGAGAGGGG - Intergenic
950536008 3:13578764-13578786 CACCACACCCGGCCTCAGGCTGG - Intronic
951170942 3:19541014-19541036 CACCGCACCCGGCCTTGTTCAGG - Intergenic
951696520 3:25450795-25450817 CACCGCACCCGGCCGGGTAGGGG - Intronic
951880305 3:27474831-27474853 CACCGCGCCTGGCCTGATACTGG - Intronic
952399422 3:32949778-32949800 CACCGCACCCAGCCTGCTACTGG - Intergenic
952418484 3:33110413-33110435 CACTGCACCCGGCCTGCACCTGG - Intergenic
952457290 3:33485231-33485253 CACCGCACCCGGCTCAGGAAGGG - Intergenic
952636501 3:35538650-35538672 CACCGCACCCGGCCTGTAGTAGG + Intergenic
952712798 3:36448507-36448529 CACCGCACCCAGCCTGGTCACGG + Intronic
952804848 3:37339148-37339170 CACCGTGCCCGGCCTGTGTCGGG + Intronic
953315476 3:41922881-41922903 CACCGCACCTGGCCTGGTTCAGG - Intronic
953617786 3:44507600-44507622 CACCACGCCCGGCCTGGGGCTGG + Intronic
953977670 3:47394625-47394647 CACCTCACCCGGCCAGGAACAGG + Intronic
954102061 3:48381308-48381330 CATCGCACCCGGCCAGGAGCAGG + Intronic
954144096 3:48625812-48625834 CAGCGCTCCAGGTCTGGGACAGG - Exonic
954383696 3:50233244-50233266 CACAGGACCTGGCCTGGGGCTGG + Intronic
954404636 3:50338566-50338588 CACCGCACCCGGCCCTTCACTGG + Intronic
954559534 3:51544887-51544909 CACTGCGCCTGGCCTGGGAATGG + Intronic
955278819 3:57574225-57574247 CACTGCACCCGGCCTGCAATAGG + Intronic
955332168 3:58056387-58056409 CACCGCACCCGGCCAGATGCTGG + Intronic
955385107 3:58473064-58473086 CACCGCACCCTGCCTGTGAGGGG + Intergenic
956191360 3:66611195-66611217 CACCGCACCTGGCTTGAGTCAGG + Intergenic
956721593 3:72122811-72122833 CACCGCTCCCAGCCTGTGATAGG - Intergenic
957098480 3:75800294-75800316 CACCGCGCCCGGCCTGTAAAGGG + Intergenic
957374043 3:79334015-79334037 CACCACACCCAGCCTGGAAGTGG - Intronic
957763446 3:84590169-84590191 CACCGCGCCCGGCCAGGTTCAGG + Intergenic
959512512 3:107230200-107230222 CACTGCACCAGGCCTGGGATAGG - Intergenic
959703965 3:109323116-109323138 TACCACACCCGGCCTGAAACAGG + Intergenic
959843807 3:111009491-111009513 CATCGCACCCGGCCAGGGAAAGG + Intergenic
960700142 3:120431257-120431279 CACCGCACCCGGCCTCTGGAAGG + Intronic
960790897 3:121429677-121429699 CACCACGCCCGGCCAGGTACTGG + Intergenic
961290104 3:125839904-125839926 CACCGCACCCAGCCTGGATGAGG + Intergenic
961541328 3:127601652-127601674 CACCACACCCGGCCCGTTACAGG + Intronic
961746281 3:129065361-129065383 CACCGCACCCAGCCTGTGTAGGG + Intergenic
962264831 3:133937433-133937455 CACTTCTCCCAGCCTGGGACTGG + Intronic
962309086 3:134313105-134313127 CCCCGCACCCCGCCTGGGCGCGG - Intergenic
963060527 3:141221392-141221414 CACCGCACCTTACCTGGGCCAGG + Intergenic
963709084 3:148725769-148725791 CACCACACCCGGCCGGAGACAGG + Intronic
963773819 3:149418514-149418536 CACCACGCCTGGCCTGGGTCTGG - Intergenic
963806635 3:149729132-149729154 CACCGCACCCAGCCTGGAAGGGG + Intronic
963811081 3:149777183-149777205 CACCACACCCGGCCTAGAACAGG - Intronic
963925984 3:150951624-150951646 CACCGCGCCCGGCCTGAGACTGG + Intronic
964346234 3:155757321-155757343 CACTGCACCCGGCCTGCTGCTGG - Intergenic
965265363 3:166536400-166536422 CACCGTACCTGGCCAGGGAAAGG - Intergenic
965567657 3:170137911-170137933 CACCACACCCAGCCTGAGAAAGG - Intronic
966879111 3:184339746-184339768 CACTGCGCCCGGCCTGAGAAGGG + Intronic
966922995 3:184626657-184626679 CACCGCGCCCAGCCTGTGATGGG - Intronic
967108558 3:186273006-186273028 CACCGCACCTGGCCAAGGTCAGG + Intronic
967157838 3:186709917-186709939 CACCGCGCCCGGCCCGGGAATGG - Intergenic
967245653 3:187483911-187483933 CACCGCACCCGGCCCAGACCAGG - Intergenic
967735958 3:192952836-192952858 CACCGCGCCCGGCCTGCTGCTGG - Intergenic
967811008 3:193761120-193761142 CACCGCGCCCGGCCTGCGCCAGG - Intergenic
967979662 3:195058317-195058339 CACCGCACCCGGCCAGATAAAGG + Intergenic
968006196 3:195244875-195244897 CACCGCACCCGGCCGGGAGTGGG - Intronic
968039987 3:195580691-195580713 CACCGCACCCGGCCTGTTGAGGG + Intronic
968163211 3:196443913-196443935 CACCACGCCCGGCCTGGGACGGG + Intergenic
968261073 3:197324629-197324651 CACCGCGCCCGGCCTTGTAGTGG + Intergenic
968390633 4:190140-190162 CACCGCACCCGGCCTAGAACAGG - Intergenic
968609948 4:1552392-1552414 CACTGCACCTGCCCTGGGCCTGG - Intergenic
969007177 4:4029678-4029700 CACCGCACCCAGCCTGGATGAGG - Intergenic
969460887 4:7328322-7328344 CACCGCACCCGGCCCGTGCTAGG + Intronic
970008180 4:11429486-11429508 CTCTGCAGCCGGACTGGGACCGG + Exonic
970512956 4:16799139-16799161 CACCGCGCCCGGCTCGTGACTGG + Intronic
970568242 4:17353381-17353403 CACCGCACCCGGCCCGATTCTGG - Intergenic
970596875 4:17608820-17608842 CACCGTGCCTGGCCTGAGACAGG - Intergenic
970889383 4:21025841-21025863 CACTGCACCCGGCCTGATACTGG + Intronic
971338919 4:25749943-25749965 CACGGCGCCCGGCCTGTGGCTGG - Intronic
971544424 4:27867443-27867465 CACTGCACCCGGCCAGGGGTAGG - Intergenic
971691221 4:29839230-29839252 CACCGCACCCGGCCTGGAGCAGG + Intergenic
972387797 4:38584845-38584867 CACTTCACCCAGCCAGGGACAGG - Intergenic
972704373 4:41527542-41527564 CACCACGCCCGGCCGAGGACGGG - Intronic
972970859 4:44574656-44574678 CACCGCGCCCGGCCTGGAATTGG + Intergenic
973058005 4:45685115-45685137 CACCCCACCCGGCCTGTAAATGG - Intergenic
973198050 4:47467929-47467951 CACCGCACCCGGCCTGGAACTGG - Intergenic
973809452 4:54556084-54556106 TACAGCACCGGGCCTTGGACAGG + Intergenic
974014388 4:56635493-56635515 CACCGCACCCGGCCCAAGAATGG - Intergenic
974069404 4:57110343-57110365 CACCGCACCCCGCCATGGAGCGG - Exonic
974595240 4:64005419-64005441 CACCGCTCCCGGCCTGTATCAGG + Intergenic
975310412 4:72897883-72897905 CACCGCACCTGGCCAGGAAGGGG + Intergenic
975766574 4:77674883-77674905 CACTGCACCTGGCCTGCCACAGG - Intergenic
975993331 4:80284144-80284166 CACCGCACCCGGCCGAAGGCAGG - Intronic
976734295 4:88295060-88295082 CACCACACCCGGCCTGCAACTGG - Intergenic
977636501 4:99304377-99304399 CACCGCGCCCGGCCTTGAATGGG - Intergenic
977693792 4:99946296-99946318 CTCCCCACCGGGCCTGGGGCTGG + Intronic
978417112 4:108488310-108488332 CACTGCACCCGGCCTGCCTCAGG + Intergenic
978425278 4:108575965-108575987 CACCGCACCCAGCCTAAGATGGG - Intergenic
979235011 4:118390001-118390023 CACCGCACCCGGCCAGGAATGGG - Intergenic
980572405 4:134637742-134637764 CACCGCGCCCGGCCCTGGATAGG + Intergenic
981557152 4:146007838-146007860 CACCGCGCCCGGCCTGTGTATGG + Intergenic
982004042 4:151047853-151047875 CACCGCACCCGGCCATGCAGTGG + Intergenic
982235502 4:153248282-153248304 CACCGCACCCGGCCTAGATCAGG + Intronic
982462459 4:155687933-155687955 CACCGCACCCGGCCCTGTAATGG - Intronic
982988595 4:162242607-162242629 CACCGCGCCCGGCCTGTGACTGG - Intergenic
983517188 4:168670443-168670465 CACCGCGCCCGGCCCGCGCCCGG - Intronic
983533331 4:168832779-168832801 CACAGCACCCGGCCGGGGAAAGG - Intronic
983625119 4:169794712-169794734 AACTGCACCCGGCCTGGAAGGGG - Intergenic
983633806 4:169877590-169877612 AACTGCACCCGGCCTGGAAGGGG + Intergenic
983814360 4:172104229-172104251 CACCGTGCCCGGCCTGGGGCAGG + Intronic
984622673 4:181971856-181971878 CACTGCACCTGGCCAGGGATGGG + Intergenic
984794657 4:183647954-183647976 CACCGCATCCGGCCTGGTGAGGG - Intronic
984982171 4:185292689-185292711 CACCGCACCCGGCCATGGACAGG + Intronic
984989050 4:185360658-185360680 CACCGCACCCGGCCAGTCATTGG - Intronic
985233593 4:187848867-187848889 CACCGCACCCGGCCAAAGTCTGG + Intergenic
985982373 5:3481625-3481647 CATCACACCCGGGCTGGGAGAGG + Intergenic
987178921 5:15346133-15346155 CACCGCGCCCGGCCTCCGATAGG - Intergenic
987318328 5:16745049-16745071 TACCGCGCCCGGCCTGGGAAAGG - Intronic
987371957 5:17201660-17201682 CACCGCACCCAGCCTTAGATTGG - Intronic
988891272 5:35619392-35619414 CACCGCACCCGGCCCGGGTGTGG - Intronic
989193299 5:38691905-38691927 CATCGCACCCAGCCTGAGTCTGG - Intergenic
989275199 5:39580574-39580596 CACCGCACCCGGCCTGGAACGGG + Intergenic
989595231 5:43150499-43150521 CACCGCACCCAGCCAGGTCCTGG - Intronic
989630493 5:43477298-43477320 CACCGCCCCCGGCCTGTGTCTGG - Intronic
990247817 5:53881103-53881125 CACCGCGCCCGGCCGGGAGCTGG - Intergenic
991362514 5:65835780-65835802 CACCGCACCTGGCCTTGCATTGG - Intronic
991691635 5:69231086-69231108 CACCACACCCGGCCTGGCCCTGG - Intergenic
991953480 5:71969813-71969835 CACCACGCCCAGCCTGGCACAGG - Intergenic
991979940 5:72220230-72220252 CACCACACCCGGCCAAGCACAGG - Intronic
992563145 5:77972574-77972596 CACGGCTCCCGGCCCGGGCCGGG + Intergenic
992686233 5:79202107-79202129 CACCCCACCCAGCCAGGGAAGGG + Intronic
992817674 5:80461685-80461707 CACCACACCCAGCCTAGGACTGG - Intronic
993037135 5:82770384-82770406 CACCGTGCCCAGCCTGAGACTGG - Intergenic
993127355 5:83851575-83851597 CACTGCACCCGGCCTGCATCTGG + Intergenic
993716476 5:91280016-91280038 CACCGCGCCCGGCCTGTCTCAGG + Intergenic
993975094 5:94469458-94469480 CACCGCACCCGGCCTCAAATGGG + Intronic
994674319 5:102802069-102802091 CACCGCGCCCGGCCGGGAAAAGG + Intronic
995156412 5:108918773-108918795 CACCGCGCCCCGCCTTGGACTGG + Intronic
996269630 5:121587655-121587677 CACCGCGCCCGGCCTGTCACAGG - Intergenic
996370809 5:122750490-122750512 CACCGCACCCAGCCAGAGTCTGG + Intergenic
996564384 5:124864004-124864026 CACCACACCCGGCCTGAAACTGG - Intergenic
996723992 5:126657843-126657865 CACCGCACCCTGCCTATGAATGG - Intergenic
997034946 5:130178538-130178560 CACAGCACCCGGCCGTGGTCTGG + Intronic
997239178 5:132294360-132294382 CCCCGCGCCCGGCCGGGGATGGG + Intronic
997306905 5:132844367-132844389 CACCACACCCGGCCTGACATTGG + Intergenic
997319906 5:132969338-132969360 CACCGCACCCGGCCAGAAAAGGG + Intergenic
997342343 5:133154469-133154491 CACCGCGCCCGGCCTGGGAGAGG - Intergenic
997346497 5:133196161-133196183 CAGCCCACCCTGCCTGGGGCTGG - Intergenic
997529128 5:134571408-134571430 CACCGCGCCCGGCCCAGGGCTGG - Intronic
998076300 5:139239469-139239491 CACCGCGCCCGGCCGGGGCGAGG - Intronic
998077759 5:139250276-139250298 CACTGCGCCCGGCCTGGTGCTGG - Intronic
998084982 5:139312938-139312960 CACCGCACCTGGCCTTTCACAGG + Intronic
998088572 5:139347095-139347117 CACTGCACCCAGCCTAGAACAGG + Intronic
998143780 5:139714105-139714127 CACCGCGCCCGGCCTGGCATGGG + Intergenic
998419188 5:141968391-141968413 CACCGCACCCGGCCTTCTAAGGG + Intronic
998453881 5:142255539-142255561 CACCACACCTGGCCTGAGAATGG - Intergenic
998548048 5:143048625-143048647 CACTGCACCTGGCCTGGGGAAGG - Intronic
998614549 5:143726074-143726096 CACTGCACCCAGCCTGAGTCAGG - Intergenic
998831823 5:146167815-146167837 CACCGCGCCCGGCCTACGACCGG + Intronic
999295704 5:150458365-150458387 CACCGCGCCCGGCCTGAGCTGGG - Intergenic
999334800 5:150706259-150706281 CACCGCACCTGACCTGGGCTTGG + Intergenic
1000095715 5:157969219-157969241 CACTGCGCCCGGACTGGGCCAGG + Intergenic
1000199669 5:158995716-158995738 CCCAGCACCCTGCCTGGCACAGG + Intronic
1000334322 5:160230789-160230811 CACCACATCCTGCCTGGGAGAGG + Intronic
1000602857 5:163296012-163296034 CACCGCACCCGGCTGGAGAAGGG + Intergenic
1000796857 5:165674566-165674588 CACCGCACCCGGCCAGCATCTGG + Intergenic
1001166781 5:169375713-169375735 CACCGCACCCGGCCAGCCCCAGG - Intergenic
1001616940 5:173050121-173050143 CACCACACCCAGCCTAAGACTGG + Intergenic
1001646755 5:173287841-173287863 CACTGCGCCCGGCCTGGGAATGG + Intergenic
1002134463 5:177099180-177099202 TGCCGCACCTGGCCTGGAACAGG - Intergenic
1002720209 5:181254661-181254683 CACCGCGCCCGGCCTGTATCAGG + Intronic
1003052425 6:2792233-2792255 CACCGTGCCCGGCCTAGAACTGG + Intergenic
1003345376 6:5261296-5261318 GACCGCAGCCGGCGTGGGAGGGG - Exonic
1003559282 6:7167617-7167639 CACCGCTCCCGGCCGGGGACAGG + Intronic
1004042428 6:11993763-11993785 CACCGCACCTGGCCTCCGATCGG + Intergenic
1004509316 6:16271920-16271942 CACCGCACCCAGCCTAAGAGTGG - Intronic
1004673135 6:17816204-17816226 CACCGCACCTGGCCTGAGTCAGG + Intronic
1004842044 6:19598569-19598591 CACCGCGCCCGGCCCAGGCCGGG + Intergenic
1005229398 6:23683220-23683242 CACCGCACCCAGCCTGGTTCAGG - Intergenic
1005262452 6:24075764-24075786 CACCGCACCCGGCCTTGTTGAGG + Intergenic
1005297958 6:24445313-24445335 CACCGCACCCGGCCTGAAATAGG + Intronic
1005544353 6:26849637-26849659 CACCGCCCCGGGCCTGGGGTTGG + Intergenic
1005705176 6:28444168-28444190 CACCGCACCCGGCCACAAACAGG + Intergenic
1005957493 6:30674421-30674443 CACCGCACTGGGCCTGAGACAGG + Intergenic
1006504725 6:34481392-34481414 CACCGCACCCGGCCAAGCAAGGG - Intronic
1006557997 6:34885831-34885853 CACCGCACCCGGCCAGCTAAAGG - Intronic
1006774021 6:36577950-36577972 CACCGTGCCCGGCCTGGCAACGG + Intergenic
1006796113 6:36733463-36733485 CACCGCCCCCAGCCTGGGTTTGG + Intergenic
1007026451 6:38580605-38580627 CACTGCACCCGGCCTCTGAATGG - Intronic
1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG + Intronic
1007486013 6:42181246-42181268 CACCGCGCCCGGCCTGAGTTGGG - Intergenic
1007902271 6:45422977-45422999 CGCCGCTCCCGGCCGGGGGCGGG - Intronic
1009520463 6:64675714-64675736 CACCACACCTGGCCTGTGATTGG + Intronic
1010110483 6:72223657-72223679 CACCGCACCTGGCCTGCAACTGG - Intronic
1010200134 6:73275062-73275084 CACTGCACCCGGCCTCAGACTGG - Intronic
1010209889 6:73354338-73354360 CCCCGCCCCCGGCCCGGGCCAGG + Intergenic
1011051273 6:83152904-83152926 CACCGCGCCCGGCCTGGGGAGGG + Intronic
1011576522 6:88806601-88806623 CACCGCACCCGGCCTGAAAAAGG + Intronic
1011607015 6:89115921-89115943 CACCGCACCCGGCCACGAATGGG + Intronic
1011762132 6:90578561-90578583 CACTGCACCTGGCCAGAGACAGG + Intronic
1012939466 6:105402293-105402315 CGCCTCATCCGACCTGGGACAGG + Intronic
1013217885 6:108046631-108046653 CACCGCGCCCGGCCTGTCTCTGG + Intronic
1013722982 6:113053823-113053845 CACCGCACCCGGCCGAAAACAGG - Intergenic
1013771933 6:113637629-113637651 CACCACACCCAGCCCGAGACGGG + Intergenic
1014262819 6:119239164-119239186 CACCGCACCCGGCCTGAAACTGG + Intronic
1015024625 6:128519440-128519462 CCCCGGATCCGGCCTGGGGCTGG - Intronic
1015983625 6:138863898-138863920 CACCGCATCTGGCCGGGAACAGG + Intronic
1016001928 6:139050345-139050367 CACCGCACCTGGCCTAGCAAAGG + Intergenic
1016049562 6:139516376-139516398 CACCGCGCCCGGCCGGGAGCAGG + Intergenic
1016902337 6:149114820-149114842 CACCGCTCCTGGCCTAGAACTGG - Intergenic
1017086476 6:150717466-150717488 CACCACGCCCGGCCTGGGAAGGG + Intronic
1017188496 6:151626617-151626639 CACCTCACCCGGCCTAAGAAGGG + Intergenic
1018037869 6:159897160-159897182 CACCACCCCCGGCCGGAGACTGG + Intergenic
1018183727 6:161246651-161246673 CACCGCACCCAGCCTAGCACAGG + Intronic
1018677408 6:166235190-166235212 CACCGCGCCCGGCCTTGAAATGG + Intergenic
1019189321 6:170241962-170241984 CACCGCGCCCGGCCTGAGACCGG - Intergenic
1019320438 7:412920-412942 CACCGCGCCCGGCCTGGCTGTGG - Intergenic
1019344318 7:522043-522065 CGACGCACCCGGCGTGGGACTGG + Intergenic
1019466455 7:1192216-1192238 CACCGCAGCCGCCCTGGTCCAGG + Intergenic
1019468740 7:1205863-1205885 CACCACGCCCGGCCTAGGCCTGG + Intergenic
1019644609 7:2122337-2122359 CACTGCACCCAGCCAGGGATTGG - Intronic
1019692604 7:2424915-2424937 CACCACGCCCGGCCTGGAGCGGG - Intronic
1019702804 7:2482215-2482237 CACCGCACCCGGCCAGGTGAGGG + Intergenic
1020072695 7:5237995-5238017 CACCGCGCCCGGCCGAGGCCAGG - Intergenic
1020106209 7:5423398-5423420 CATCGCGCCCGGCCGGGGGCCGG + Intronic
1020162719 7:5784417-5784439 CACCGCACCTGGCCTGAGTCTGG + Intergenic
1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG + Intronic
1022474321 7:30700103-30700125 CACCCCACCCGGCCCTGGAGGGG + Exonic
1022484753 7:30769989-30770011 CACCGCACCCGGCCCAACACAGG - Intronic
1022810010 7:33859547-33859569 CACCGCGCCCGGCCTGAGCCTGG + Intergenic
1024236739 7:47404596-47404618 CACCGCGCCCGGCCGGGCACAGG - Intronic
1024505580 7:50158779-50158801 CACCGCACCGTGCCTGGGGAGGG - Intronic
1024569022 7:50709227-50709249 CTCAGCACAGGGCCTGGGACTGG - Intronic
1025067058 7:55866288-55866310 CACCGCGCCCGGCCAGGCATTGG - Intergenic
1025193692 7:56916027-56916049 CACAGCACCCGGCCCTGGGCTGG + Intergenic
1025678251 7:63660913-63660935 CACAGCACCCGGCCCTGGGCTGG - Intergenic
1025723526 7:64037400-64037422 CACCGCGCCTGGCCTGGGAGTGG - Intronic
1025835707 7:65091621-65091643 CACTGCACCCGGCCTGCTAGTGG + Intergenic
1025905486 7:65781085-65781107 CACTGCACCCGGCCTGCTAGTGG + Intergenic
1025985898 7:66451559-66451581 CACCGCACCCGGCCTGTTTTTGG - Intergenic
1026353823 7:69540207-69540229 CACTGCACCCGGCCTGGTAAAGG + Intergenic
1026741681 7:72982788-72982810 CACCGCGCCTGGCCTGAGCCTGG - Intergenic
1026801521 7:73403184-73403206 CACCGCACCTGGCCTGAGCCTGG - Intergenic
1026839041 7:73658604-73658626 CACCGCCCCCGGCCAGTGACTGG - Intergenic
1026897892 7:74021102-74021124 CACCGTGCCCGGCCAGGAACAGG - Intergenic
1026980259 7:74522409-74522431 CACCGCACCTGGCCTAGGACTGG - Intronic
1027102054 7:75382289-75382311 CACCGCGCCTGGCCTGAGCCTGG + Intergenic
1027140735 7:75655288-75655310 CACCGTGCCCGGCCTGTGTCTGG - Intronic
1027225200 7:76239320-76239342 CACCGCACCCAGCCTAGGCTTGG + Intronic
1027590401 7:80112324-80112346 CACCGCACCCAGCCAGTGATTGG - Intergenic
1027787610 7:82599634-82599656 CACTGCACCCGGCCCGGAACAGG + Intergenic
1028518102 7:91699542-91699564 CACCGCGCCCGGCCTGGATGAGG - Intronic
1029013925 7:97294570-97294592 CACCGCACCTGGCCTGGAATTGG + Intergenic
1029147563 7:98457772-98457794 CACCGCACCCAGCCTAAGGCTGG + Intergenic
1029250819 7:99234885-99234907 CACCGCGCCCGGCCAGGCACTGG + Intergenic
1029505814 7:100963571-100963593 CACGGCACCCGGCCGGGGAGGGG + Intronic
1029543777 7:101199803-101199825 CACCGCGCCCGGCCTGGGAGTGG - Intronic
1029557306 7:101279323-101279345 CACGGCGCCTGGCCTGGGCCTGG - Intergenic
1029576009 7:101403805-101403827 CACCGTGCCCGGCCTGGATCAGG - Intronic
1029723634 7:102387532-102387554 CACCGCGCCCGGCCTACGCCTGG - Intronic
1029918228 7:104234495-104234517 CACCGCACCCGGCCTGAGGAAGG - Intergenic
1030292487 7:107886518-107886540 CACCGCACCCGGCCAAGGATAGG + Intergenic
1030676769 7:112392778-112392800 CACCGCGCGCGGCCTGTGCCAGG - Intergenic
1030746440 7:113172112-113172134 CACCACACCCAGCCAGGGCCAGG + Intergenic
1030876353 7:114817873-114817895 CACCGCACCTGGCCGAGGAATGG + Intergenic
1031918598 7:127585365-127585387 CAGCCCTCCGGGCCTGGGACCGG - Exonic
1032244172 7:130193908-130193930 CACCGCACCCGGCCTCACAGTGG - Intronic
1032353474 7:131187638-131187660 CACCGCACCTGGCCTAGGATTGG - Intronic
1033076958 7:138258578-138258600 CACCGTACCCGGCCAAGGATAGG - Intergenic
1033219492 7:139518928-139518950 CACCGCGCCCGGCCTAGGGCGGG + Intergenic
1033313445 7:140279212-140279234 CACTGCACCTGGCCTGAGAGTGG - Intergenic
1033329828 7:140408762-140408784 CACCACACCCAGCCTGAGACAGG + Intronic
1033348926 7:140546129-140546151 CACCGCGCCCAGCCTGGGCTGGG - Intronic
1033907462 7:146222945-146222967 CACCGCACCTGGCCAGGAAAAGG + Intronic
1034135346 7:148762856-148762878 CACCGCGCCCGGCCTAGGCCTGG - Intronic
1034440129 7:151081999-151082021 CACCGGCCCTGGCCTGGGAGGGG + Intronic
1034493621 7:151407548-151407570 CACTGCACCCGGCCTAGAATTGG - Intronic
1034625287 7:152487586-152487608 CACCACACCCGGCCAAGGTCAGG - Intergenic
1034706668 7:153151934-153151956 CACCGCACCTGGCCTTAAACTGG - Intergenic
1035211259 7:157329981-157330003 CACCGCACCTGGCCGGGAATAGG - Intergenic
1035656374 8:1309804-1309826 CACGGCGCCCGGCCTGTCACAGG - Intergenic
1035875363 8:3183044-3183066 CACCGCACCCGGCCTAGAAGAGG + Intronic
1036507458 8:9368494-9368516 CACCACGCCCGGCCTTGGAAGGG - Intergenic
1036587810 8:10141212-10141234 CACAGAACCAGGCCTGGCACAGG - Intronic
1036720605 8:11171762-11171784 CACTGCACCTGGCCCGAGACTGG - Intronic
1037325785 8:17688921-17688943 CACCGCACCCGGCCTGGCTTGGG - Intronic
1037777693 8:21846612-21846634 CAACACCACCGGCCTGGGACTGG - Intergenic
1037829357 8:22178817-22178839 CAAAGCACCAGGCCTGGGAATGG - Intronic
1038241079 8:25808477-25808499 CACCGCCCCCGCCCTGACACAGG - Intergenic
1038311836 8:26450652-26450674 CACCGCACCTGGCCTGTAAGGGG - Intronic
1038411245 8:27361510-27361532 CACCGCAGCCGGCCTGGATTTGG + Intronic
1038461884 8:27724022-27724044 CACTGCACCTGGCCTGGAAAGGG + Intergenic
1039321893 8:36441213-36441235 CACTGCGCCCGGCCTCGAACTGG - Intergenic
1039408818 8:37334985-37335007 CACTGCACCAGGCCTTGGAGAGG + Intergenic
1039616853 8:38962198-38962220 CACTGCACCCGGCCTGGACCAGG - Intronic
1039862649 8:41472106-41472128 CACTGCACCCGGGCTTGAACTGG - Intergenic
1039993346 8:42508677-42508699 CACCACACCCGGCCTGGGAGTGG + Intronic
1040422041 8:47250004-47250026 CACCGCGCCCGGCCGAGGACAGG - Intergenic
1040437789 8:47409738-47409760 CACCACACCTGGCCTCGGAAAGG - Intronic
1040453881 8:47576437-47576459 CACTGGACCCAGCCTGAGACAGG + Intronic
1040816978 8:51519251-51519273 CACCGCACCCGGCCTTCTTCAGG - Intronic
1041490106 8:58423721-58423743 CACCGCGCCCAGCCGGGGATGGG + Intronic
1041492938 8:58454759-58454781 CACCGCGCCCGGCCTATAACAGG - Intergenic
1041512937 8:58671518-58671540 CACCGTGCCCTGCCTGGGTCTGG - Intergenic
1042244518 8:66697314-66697336 CACCGCGCCCGGCCTTGCAGGGG - Intronic
1042276351 8:67008980-67009002 CACTGCACCCAGCCTGGTAACGG - Intronic
1042911112 8:73827500-73827522 CACCGCACCTGGCCTGTGCATGG + Intronic
1044128940 8:88496145-88496167 CACCGTGCCCGGCCTGGAAAGGG - Intergenic
1044574874 8:93757347-93757369 CACCGCGCCCGGCCTAGTAAAGG - Intronic
1045519544 8:102891908-102891930 CACAGCACCTGCCTTGGGACTGG - Intronic
1045630310 8:104111692-104111714 CACCGCACCCGGCCTCCCATTGG + Intronic
1046075633 8:109308681-109308703 CACCGCACCCAGTCTGGTCCTGG - Intronic
1046443847 8:114289336-114289358 CACCGCTCCCGGCCTAAGAGAGG + Intergenic
1046551420 8:115722739-115722761 CACCGCACCCGGCATGGTGGTGG + Intronic
1046865871 8:119149780-119149802 CACCGTGCCCGGCCCGAGACTGG - Intergenic
1047296368 8:123573804-123573826 CACCGTGCCCGGCCTGAGACAGG + Intergenic
1047372497 8:124267563-124267585 CACTGCGCCCGGCCTGCGAATGG - Intergenic
1047393110 8:124470474-124470496 CACCGTGCCTGGCCTGGGACTGG + Intergenic
1047642418 8:126834623-126834645 CACCGTACCCGGCCCGGAACTGG - Intergenic
1048056348 8:130869803-130869825 CACTGCACCCGGCCGGCTACTGG + Intronic
1048569847 8:135643079-135643101 CACCGCGCCTGGCCTGGTCCAGG + Intronic
1049081512 8:140446818-140446840 CACCGCACCCAGCCTGGTGTGGG + Intronic
1049145893 8:141000984-141001006 CGCCGCATCCGCCCCGGGACTGG + Intronic
1049415607 8:142493483-142493505 CAGCGCACCCAGCCGGTGACGGG - Intronic
1049455062 8:142682502-142682524 CCCCGCACCCAGCAGGGGACAGG + Exonic
1049638055 8:143699945-143699967 CACCGCGCCCAGCCTAGGGCTGG - Intronic
1049695433 8:143982179-143982201 CACCGCGCCCGGCCTTGCACGGG - Intronic
1049746680 8:144266046-144266068 CCCTGCACACGGCCTGGCACAGG + Intronic
1049908428 9:241900-241922 CACAGCACCTGGCATGGGATAGG + Intronic
1050541982 9:6678486-6678508 CACCGCACCCGGCCAAAGATGGG - Intergenic
1052903662 9:33816750-33816772 CTCCGCAGCCATCCTGGGACGGG - Intergenic
1053008983 9:34622858-34622880 CACCGCGCCCGGCCAGGAAAAGG - Intronic
1053193903 9:36099771-36099793 CACTGCACCCAGCCTAGAACAGG + Intronic
1053848539 9:42266712-42266734 CACCGCGCCTGGCCTGGAGCTGG - Intergenic
1055481546 9:76713221-76713243 CACCAAACCGGTCCTGGGACAGG + Intronic
1055486454 9:76760801-76760823 CACCGCGCCCGGCCCGAGTCTGG - Intronic
1055610006 9:78012493-78012515 CACCTCACCTGGCCTCGGAAAGG + Intronic
1055618671 9:78100031-78100053 CTCCGCGCCCAGCCTTGGACTGG + Intergenic
1056630381 9:88288552-88288574 CACCGCACCTGGCATAGGTCAGG - Intergenic
1056645934 9:88411883-88411905 CACCGCACCCGGCCTCAAACGGG - Intronic
1057150567 9:92792635-92792657 CACCGCACCCGGCCAGAGGCAGG + Intergenic
1057347270 9:94261309-94261331 CACCGCACCCCGCTCGAGACGGG + Intronic
1057753791 9:97813712-97813734 CACTGCACCCGGCCTGGCAATGG - Intergenic
1058179353 9:101778353-101778375 CACTGCACCCGGCCAGGCAAAGG + Intergenic
1058697475 9:107571859-107571881 CACCGCACCCGGCTGGAGATGGG + Intergenic
1058855007 9:109053135-109053157 CACCGCACCCAGCCTGAGTTGGG - Intronic
1059116138 9:111601224-111601246 CACAGCACCCAGCCTGGGAATGG - Intergenic
1059210768 9:112513291-112513313 CACTGCGCCCGGCCAGGGATAGG + Intronic
1059248104 9:112865333-112865355 CACTGCACCTGGCCTCGCACTGG - Intronic
1059432291 9:114257502-114257524 CTCGGCACCTGGCCTGGCACAGG - Intronic
1060181587 9:121538119-121538141 CACCACACCTGGCCTGATACTGG + Intergenic
1060489160 9:124069426-124069448 CACCGCGCCCGGCCAGGAAAGGG - Intergenic
1060606939 9:124923423-124923445 CACCACACCCGGCCTGAAAGTGG + Intronic
1060728296 9:126020852-126020874 CACCGCGCCCTGCAGGGGACTGG + Intergenic
1060837489 9:126767383-126767405 CACCGCACCCGGCCTGTGGGTGG + Intergenic
1061023616 9:128033163-128033185 CACTGCACCCGGCCTGAGACAGG + Intergenic
1061029379 9:128070527-128070549 CACCGCACCCGGCTAGAGACAGG + Intronic
1061035162 9:128109435-128109457 CCCCGCACCCTGCCTGAGACAGG - Intergenic
1061042429 9:128147988-128148010 CACCGCACCCGGCCTGGCAGAGG + Intergenic
1061082250 9:128378664-128378686 CTCCACACCTGGCCTGGGACTGG - Intronic
1061171368 9:128957750-128957772 CACCGCACCCGGCCAGGATTTGG + Intronic
1061236699 9:129347327-129347349 CACTGCACCCGGCCTCAGGCAGG + Intergenic
1061309870 9:129755158-129755180 CACCGCACCTGGCCAAGGGCAGG + Intergenic
1061477510 9:130878237-130878259 CACCGCACCCAGCCTTGTCCTGG + Intronic
1061549199 9:131323482-131323504 TACCGCACCCAGCCAGAGACAGG + Intergenic
1061612221 9:131754723-131754745 CACCACACCCGGCCGAGGACTGG + Intergenic
1061662290 9:132138204-132138226 CACCGCGCCCGGCCTCGTGCAGG + Intergenic
1061917456 9:133762790-133762812 CCCCACACCCAGCCTGGGCCGGG + Exonic
1061921607 9:133785526-133785548 CAGCGGAGCCTGCCTGGGACAGG + Intronic
1062123647 9:134847950-134847972 CACCGCCCCCAGCCTGCGTCTGG - Intergenic
1062286018 9:135772833-135772855 CATCGCGCCCGTCCTGGAACTGG + Exonic
1062343994 9:136106493-136106515 CACCGTGCCCAGCCTGGGAGTGG + Intergenic
1062493249 9:136819032-136819054 CACCGCGCCCGGCCTGGACAAGG - Intronic
1062515332 9:136931222-136931244 CACTGCACCCAGCCGGAGACAGG + Intronic
1062524995 9:136974616-136974638 CAACTCCCCCAGCCTGGGACTGG - Intergenic
1062578528 9:137219708-137219730 CACCGCACCCAGCCTGGGGCGGG + Intergenic
1062653359 9:137589926-137589948 CTCCGCACCCGGCTCGGGACAGG + Intronic
1062687656 9:137823389-137823411 CACCGCACCCGGCCAACGCCTGG + Intronic
1185507173 X:640054-640076 CACTGCACCTGGCCTAGAACTGG - Intronic
1185552390 X:993465-993487 CACCGCGCCCAGCCCGAGACTGG - Intergenic
1185668120 X:1784549-1784571 CACCGCGCCCGGCCGAGGAGAGG - Intergenic
1185998936 X:4986968-4986990 CACCGCGCCCGGCCTTGGTGGGG + Intergenic
1187811234 X:23179629-23179651 CACCGCACCCGGCCTCATATTGG + Intergenic
1188124658 X:26352489-26352511 CACCACACCTGGCTTGAGACTGG + Intergenic
1188473998 X:30570890-30570912 CACTGCACCCGGCCTTGAATGGG - Intronic
1189126874 X:38457611-38457633 CACTGCACCCGGCCCCAGACTGG + Intronic
1189172121 X:38918900-38918922 CACTGCACCCGGCCGGGTATAGG + Intergenic
1189418890 X:40837898-40837920 CACCACACCCGGCCAGGAAAAGG + Intergenic
1189994588 X:46626561-46626583 CACCACGCCCGGCCTGGGCCTGG + Intronic
1190265830 X:48826818-48826840 CACCTCACCCGGCCTCGTCCGGG + Intergenic
1190768253 X:53493624-53493646 CACTGCACCTGGCCAGGGAATGG - Intergenic
1190837398 X:54113621-54113643 CACCGCGCCCGGCCTGGTGCAGG - Intronic
1192055101 X:67765926-67765948 CACCACACCCGCCCTGTGAATGG - Intergenic
1192116376 X:68415724-68415746 CACCACACCCAGCCTTGAACTGG - Intronic
1192127412 X:68515036-68515058 CACCGCGCCCGGCCAAGGCCAGG - Intronic
1192522396 X:71814348-71814370 CACCTCACTGGTCCTGGGACAGG + Intergenic
1192630219 X:72771690-72771712 CACCGCGCCCGGCCTAAGAGTGG - Intergenic
1192651491 X:72949114-72949136 CACCGCGCCCGGCCTAAGAGTGG + Intergenic
1193379769 X:80805645-80805667 CACCGCGCCCGGCCTGGGGTAGG - Intronic
1193490159 X:82140042-82140064 CACCGCACCCAGCCTAGGCATGG - Intergenic
1194666061 X:96678778-96678800 CACCGCGCCCGGCCGAGTACAGG - Intergenic
1195088682 X:101438274-101438296 CACCGCACCCAGCCTGATAATGG - Intronic
1195680085 X:107538945-107538967 CACCACACCTGGCCTGGTAATGG + Intronic
1196079496 X:111616211-111616233 CACCGCGCCCGGCCTGTGCCCGG + Intergenic
1196272772 X:113731885-113731907 CACCGCGCCCGGCCTGACAATGG + Intergenic
1196783913 X:119405760-119405782 CACCGCACCCGGCCCAGAACTGG + Intronic
1196786609 X:119426532-119426554 CGCCGCGCCCGGCCTTGGACTGG - Intronic
1196857862 X:120000423-120000445 CACCCCACCCGGGTTGGGAGTGG - Intergenic
1196868638 X:120091803-120091825 CACCGCGCCCGGCCTGTGCAAGG + Intergenic
1196920527 X:120580872-120580894 CACCGCACCCGGCCGAGGAGAGG - Intergenic
1197203753 X:123772159-123772181 CACCGCGCCCGGCCAGGGCAGGG - Intergenic
1199855891 X:151758607-151758629 CACCGCGCCCGGCCTGAAGCTGG - Intergenic
1200125024 X:153809296-153809318 CACCGCACCCGGCCTAGTGGTGG - Intronic
1200228084 X:154430405-154430427 CACCGCGCCCGGCCTGTGAGGGG + Intronic
1201337975 Y:12900832-12900854 CACCGCACCCGGCCCATGCCCGG + Intergenic
1201553202 Y:15240374-15240396 CACCGCACCTGGCCAGGTGCAGG - Intergenic