ID: 1007110570

View in Genome Browser
Species Human (GRCh38)
Location 6:39311215-39311237
Sequence ACAGCTACTGACAGCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007110558_1007110570 30 Left 1007110558 6:39311162-39311184 CCAGCCCACCAGGGCAAGGAGGC 0: 1
1: 0
2: 2
3: 26
4: 287
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data
1007110565_1007110570 2 Left 1007110565 6:39311190-39311212 CCCTCTCACCAAGGGCTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 205
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data
1007110559_1007110570 26 Left 1007110559 6:39311166-39311188 CCCACCAGGGCAAGGAGGCTCTA 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data
1007110561_1007110570 22 Left 1007110561 6:39311170-39311192 CCAGGGCAAGGAGGCTCTACCCC 0: 1
1: 0
2: 3
3: 12
4: 210
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data
1007110560_1007110570 25 Left 1007110560 6:39311167-39311189 CCACCAGGGCAAGGAGGCTCTAC 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data
1007110564_1007110570 3 Left 1007110564 6:39311189-39311211 CCCCTCTCACCAAGGGCTCACCA 0: 1
1: 0
2: 0
3: 23
4: 196
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data
1007110568_1007110570 -6 Left 1007110568 6:39311198-39311220 CCAAGGGCTCACCAGGTACAGCT 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data
1007110566_1007110570 1 Left 1007110566 6:39311191-39311213 CCTCTCACCAAGGGCTCACCAGG 0: 1
1: 0
2: 0
3: 22
4: 233
Right 1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007110570 Original CRISPR ACAGCTACTGACAGCTACCA TGG Intronic
No off target data available for this crispr