ID: 1007111087

View in Genome Browser
Species Human (GRCh38)
Location 6:39313890-39313912
Sequence ACCAGAGGGTTGGGGGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007111087 Original CRISPR ACCAGAGGGTTGGGGGACCT CGG (reversed) Intronic
900380457 1:2381552-2381574 CCCAGAGGACTGGGAGACCTGGG - Intronic
901853420 1:12029902-12029924 ACCAGAGTATTGGGACACCTTGG + Intronic
902188930 1:14746994-14747016 ACCAGAGGCTGGGGGGACAAGGG - Intronic
902788041 1:18745624-18745646 ACCAGAGGGTAGGGGCACATGGG + Intronic
903269263 1:22177534-22177556 AACACAGGGTTGGGGGAATTTGG + Intergenic
903659781 1:24969968-24969990 ACCAGCAAGCTGGGGGACCTTGG - Intergenic
903808496 1:26021806-26021828 ACCATAGGGTTTGGGGGGCTTGG + Exonic
903967082 1:27097561-27097583 ACCAGAGGGCAGTGGGGCCTTGG - Intergenic
904595795 1:31644592-31644614 ACTCGAGGATTTGGGGACCTTGG - Intronic
905414180 1:37793628-37793650 GGCCGAGGGATGGGGGACCTGGG + Intergenic
905772529 1:40647585-40647607 ACCTGAGAGTTAGGGGACTTAGG - Intronic
906062426 1:42957848-42957870 ACCGGAGGGGCGGGGGATCTGGG - Intronic
906552152 1:46673809-46673831 ACCAGTGCCTTGGGGTACCTAGG - Intronic
906590990 1:47023955-47023977 ACCAGTGGGTGGGGGGCGCTGGG - Exonic
906679176 1:47713610-47713632 ACCACAGGGTTGGGGGAAGGGGG - Intergenic
908572616 1:65425228-65425250 ACTAGAGGGTTTGGGGAAATGGG - Intronic
909782931 1:79570344-79570366 ACCAGAAGGGTGAGGGAGCTGGG + Intergenic
910167231 1:84340401-84340423 ACCAGAGGTTTGGGGGAGTAGGG + Intronic
918068501 1:181118129-181118151 TTCAGAGATTTGGGGGACCTAGG - Intergenic
920386732 1:205575148-205575170 AGGAGATGGTTTGGGGACCTGGG - Intronic
922573463 1:226646978-226647000 TGCAGAGGGTTCCGGGACCTGGG - Intronic
924053051 1:240096552-240096574 ACCAGAGGCTTGGGGAACACTGG + Intronic
1063125470 10:3133092-3133114 ACCATAGGGTTGGGGGATGCGGG + Intronic
1063449158 10:6140090-6140112 GCCAGAAGGCTGGGGGATCTGGG - Intergenic
1065447978 10:25822697-25822719 AACAGAGGGTTCAGGGATCTGGG - Intergenic
1066058981 10:31705958-31705980 AGCAGAGGGATGGGGGAGCCTGG - Intergenic
1067539893 10:47143785-47143807 GCCAGAGGGCAGGGGGGCCTGGG + Intergenic
1069885465 10:71620764-71620786 ACCTCAGGGTTGGGTGGCCTGGG - Intronic
1070072509 10:73103250-73103272 ACCAGCGGTTTGGGAGACCAAGG + Intergenic
1071474791 10:86016831-86016853 ACCACATGGTTGAGGGACCCTGG + Intronic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1072195894 10:93116941-93116963 CCCAGAGGTTCGGGAGACCTGGG - Intergenic
1072584396 10:96768668-96768690 AACAGATGGTTGGGAGGCCTAGG + Intergenic
1072588122 10:96800419-96800441 TTCAAATGGTTGGGGGACCTTGG - Intergenic
1074530865 10:114297781-114297803 GCCAGAGGATTGAGGGAACTTGG - Intronic
1075162901 10:120040376-120040398 ACAATAGGGTTTGGGGAGCTGGG + Intergenic
1076266860 10:129115425-129115447 AGCAGAGCACTGGGGGACCTTGG + Intergenic
1076420415 10:130327437-130327459 ACCAGAGGCCTGGGGGGCATGGG + Intergenic
1076491512 10:130864853-130864875 AACAGAGGGTTGGGGGGCCTCGG - Intergenic
1076685494 10:132196763-132196785 ACTGGAGGGTTGGGGGTCTTGGG - Intronic
1076878311 10:133227715-133227737 AACTGAGGGTTGGGGGTGCTGGG - Intergenic
1076990239 11:269196-269218 ACCAGAGGCTGGGGGGACGGAGG - Intergenic
1077643461 11:3902687-3902709 GCCTGAGGGTTGGGGACCCTTGG + Intronic
1078063277 11:8061803-8061825 GCAAGAGAGCTGGGGGACCTTGG - Intronic
1079343032 11:19628793-19628815 ACTAGAAGGGTAGGGGACCTTGG - Intronic
1081167138 11:39820377-39820399 ACCAGAGGCCTGGGGGAGCAGGG - Intergenic
1081498035 11:43635606-43635628 ACAAAAGGGTTTGAGGACCTTGG + Intronic
1082806847 11:57457246-57457268 CCCAGAGGGAAGGGGGATCTTGG + Intergenic
1083149616 11:60783624-60783646 ATCTGAGGGTTGTGGGATCTGGG + Intergenic
1085311864 11:75521683-75521705 ACCAGAGGGTTGGGTAATCCAGG + Intronic
1088771073 11:113036576-113036598 AGCAGAAGGATGGGGGACCTGGG - Intronic
1088878056 11:113952184-113952206 ACCAGAGTGTGGGGGGAGCGTGG - Intergenic
1089698616 11:120230839-120230861 GCCAGAGGGTTGAGGGAGCTGGG + Intergenic
1090146960 11:124335301-124335323 TCCAGAGGGCTGGGAGTCCTAGG - Intergenic
1090198983 11:124840351-124840373 ACCAGAGGATTGGGGTGCTTAGG - Intergenic
1090351196 11:126109726-126109748 ACCAGAGCCTTGTGGGACCCAGG - Intergenic
1090412507 11:126518855-126518877 ACCAGCTGGGTTGGGGACCTGGG + Intronic
1091015973 11:132051011-132051033 GCCAGTGGGTTGGCTGACCTTGG + Intronic
1091347435 11:134864647-134864669 ACCAGAGAGTTGGGGGAGTCCGG + Intergenic
1094383050 12:29864570-29864592 AGAAGACAGTTGGGGGACCTTGG + Intergenic
1096178469 12:49538390-49538412 ACCAGAGGGTGGGTAGCCCTAGG - Intergenic
1096420016 12:51449028-51449050 ACCAGAGGGGTGGGAGACAATGG + Intronic
1096462747 12:51831469-51831491 TCCAGAGGATTGCGTGACCTGGG - Intergenic
1096595955 12:52695635-52695657 CCCACAGAGTTGGGGTACCTGGG + Intronic
1099505318 12:83468743-83468765 ACCAGAGGGGTGGGGGTCAGTGG + Intergenic
1101611949 12:106301013-106301035 ACCAGAAGTTTGGGGGATTTGGG + Intronic
1102033956 12:109760434-109760456 GCCAGGGGGATGGAGGACCTGGG + Intronic
1102365586 12:112331425-112331447 ACCACTGAGTTGGGGGAACTAGG + Intronic
1103411019 12:120711122-120711144 GCCAGAGGGCTGGGGGAGCCTGG - Intronic
1106230668 13:27819002-27819024 CCCAGAGGGGTTGGTGACCTGGG - Intergenic
1107679986 13:42838367-42838389 ACAAGAGGCTTTGGAGACCTAGG + Intergenic
1108680068 13:52772397-52772419 ACCTAAGGGGTGGGGGAGCTGGG - Intergenic
1113847841 13:113402751-113402773 ACCAGAGGGTGTGGGGACGCTGG - Intergenic
1115952622 14:38737903-38737925 AGCAGAGGGCTGGGGGAACAGGG + Intergenic
1116913030 14:50491545-50491567 ACCAGTGGTTTGGGAGACCAAGG - Intronic
1117612875 14:57502607-57502629 ACCAGAGGAGTGAGGGAACTGGG + Intergenic
1119540120 14:75432442-75432464 ACAAGAGAAGTGGGGGACCTTGG - Intronic
1120891906 14:89498821-89498843 CACAGAGGGTGGGGGGAACTGGG + Intronic
1121775472 14:96587738-96587760 ATCAGCTGGTGGGGGGACCTGGG + Intergenic
1122983998 14:105203847-105203869 ACCTGGGGGTTGGGGGAGCCTGG + Intergenic
1125277389 15:38007783-38007805 AACAGAGGGTGGGGAGGCCTAGG + Intergenic
1125750217 15:42022803-42022825 GCCAGGGGGTTGGGGGCCCCTGG + Intronic
1128065067 15:64759352-64759374 AAGAGAGGGCTGGGTGACCTGGG - Intronic
1128765973 15:70251361-70251383 AGAAGAGGGTTGGGGGAGCTAGG + Intergenic
1128852651 15:70975575-70975597 ACCAGAGACTTGGGGGACTGAGG + Intronic
1129110531 15:73334562-73334584 ACCAGGGGGTTGGGTGAGCTGGG - Intronic
1129394836 15:75238037-75238059 AAGAAAGGGTTGGGGAACCTGGG + Intergenic
1130769789 15:86912832-86912854 ACTAGAGAGTTTGGGGAGCTGGG - Intronic
1131151430 15:90049707-90049729 ACCAGAGGGCAGTGGGGCCTGGG - Intronic
1132215054 15:100056427-100056449 ACCAGGGGGTTGGGGGAAGTGGG + Intronic
1132838269 16:1965445-1965467 ACCGCGGGGTTGGGGGAACTTGG + Intergenic
1132841873 16:1982027-1982049 GCCAGAGAGGTGGGGCACCTGGG - Exonic
1133554478 16:6892115-6892137 ACCAGGGGGTTTGGGGACTTGGG - Intronic
1134040004 16:11061046-11061068 AGCAGGGGGCTGGGGGACATGGG + Intronic
1134490701 16:14693753-14693775 ACCAGAGGGTGGGAGGAGCAGGG - Intronic
1134496082 16:14732871-14732893 ACCAGAGGGTGGGAGGAGCAGGG - Intronic
1135179513 16:20260657-20260679 ACCAAAGGCTTTGGGGTCCTCGG + Intergenic
1136154720 16:28374959-28374981 ACCAGAGGGTGGGAGGAGCAGGG + Intergenic
1136208372 16:28740299-28740321 ACCAGAGGGTGGGAGGAGCAGGG - Intergenic
1136264460 16:29106975-29106997 ACCAGAGGGTGGGAGGAGCAGGG - Intergenic
1140092300 16:71848716-71848738 ACCTGAGGGTTTTGGCACCTAGG + Intronic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1141305284 16:82856897-82856919 ACCAGAGGGGTGAGGGAATTGGG + Intronic
1141660155 16:85437151-85437173 CTCAGAGGGTTGGGGGACTGTGG - Intergenic
1141682809 16:85554157-85554179 AGGAGAGGGTGGGGGGACGTGGG + Intergenic
1142178233 16:88654853-88654875 ACCAGAGGGTTGGGGAGACAAGG - Intronic
1143622032 17:8086269-8086291 GCCAGAGGGGTGGGCGGCCTGGG - Intronic
1143793744 17:9319590-9319612 GCCAGAGGGTTTGAGGATCTTGG + Intronic
1145031409 17:19507639-19507661 CCCAGAGGGCAGGGGGACCCCGG - Intronic
1145273183 17:21415321-21415343 TCCCGGGGGTTGGGGGACCCTGG - Exonic
1145311376 17:21702765-21702787 TCCCGGGGGTTGGGGGACCCTGG - Exonic
1146435372 17:32841214-32841236 TCCAGAGCTTTGGGAGACCTAGG + Intronic
1146682143 17:34816093-34816115 AGCAGAGGGCTGGGGGGCCAAGG - Intergenic
1146845567 17:36179597-36179619 AGCAGAGGGCTGCAGGACCTTGG - Intronic
1146873784 17:36391438-36391460 AGCAGAGGGCTGCAGGACCTTGG - Intronic
1146881141 17:36442528-36442550 AGCAGAGGGCTGCAGGACCTTGG - Intergenic
1147065606 17:37921433-37921455 AGCAGAGGGCTGCAGGACCTTGG + Intergenic
1147553058 17:41458499-41458521 ATCAGAGAGTAGGGGGGCCTTGG - Intergenic
1147888460 17:43700200-43700222 CCCAGTGGGGTGGGGGACCAAGG + Intergenic
1147924207 17:43936512-43936534 AAAAGAGGGTTGAGGGGCCTAGG + Intergenic
1148136086 17:45292885-45292907 ACACGTGGGTTGGGTGACCTTGG - Intronic
1148217418 17:45840572-45840594 GGCACAGGGATGGGGGACCTGGG + Intergenic
1150125570 17:62632516-62632538 ACCAGAGGCATGGGGGGCCGGGG - Intronic
1152318345 17:79593930-79593952 ACCAAAGGGTTTGGGCACCTGGG + Intergenic
1152594651 17:81232348-81232370 TCCCCAGGGTTGGGGGACCGTGG + Intronic
1155440017 18:25852240-25852262 AGCCAAGGGATGGGGGACCTGGG + Intergenic
1157286227 18:46379135-46379157 ATCAGAGGGTTGGGGGGCCTGGG - Intronic
1157685305 18:49638587-49638609 ACCAGAGGGATTTGTGACCTGGG + Intergenic
1157854419 18:51092107-51092129 TCCTGTGGGTTTGGGGACCTAGG + Intergenic
1160442634 18:78904051-78904073 GCCCGAGGGGTGGGGGACCTTGG + Intergenic
1161806518 19:6446622-6446644 ACCAGAGAGATGAGGGAGCTGGG - Intronic
1161988122 19:7668995-7669017 ACCGGAGGGTTGGGGGCCCAGGG + Intergenic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1163628074 19:18402248-18402270 TCCGGAGGTTTGGGGGTCCTGGG + Intergenic
1164412212 19:28015291-28015313 ACCAGAGGTCAGGGGGACCATGG + Intergenic
1166340035 19:42132063-42132085 ACCAGTGGGGTGGGTGACATGGG - Intronic
1167041850 19:47027364-47027386 TGCAGAGTGTGGGGGGACCTGGG - Intronic
1167744245 19:51341377-51341399 ACCAGAGAGGTGGGGGGCCCAGG + Exonic
1168432381 19:56291491-56291513 ACCACAGGGTGGGAGGAGCTAGG + Intronic
1168691289 19:58379162-58379184 AACAGAGGGTTGGGGAAGCTGGG + Intronic
925179497 2:1807769-1807791 ACCAGAGGGTGGCAGGAGCTTGG - Intronic
927430771 2:23024712-23024734 GCCAGAGGGCTGAGGGGCCTTGG + Intergenic
929892231 2:45927927-45927949 AGGAGAGGGTGGGGGGGCCTGGG + Intronic
929924959 2:46200416-46200438 AGCAGAGGGTTGGGTGTCATGGG + Intergenic
930719465 2:54625456-54625478 ACCAGTGGGGTGGGGGACTCAGG + Intronic
936398739 2:112150014-112150036 ACCAGAGGCATGGGGGATATTGG + Intronic
937861723 2:126716609-126716631 ACCAAAGGATTGGGGGAGCTAGG - Intergenic
938307302 2:130264749-130264771 AGCATAGGGTTGGGGGACGTGGG + Intergenic
938448027 2:131392095-131392117 AGCATAGGGTCGGGGGACGTGGG - Intergenic
939628759 2:144510359-144510381 ACCAGAGAGGTGAGGGCCCTGGG - Intronic
941636383 2:167939616-167939638 AACAGAGGGAAGGAGGACCTGGG + Intergenic
943153116 2:184138726-184138748 CCCAGAGGGTTGGGTGTCCCTGG + Intergenic
945079697 2:206076107-206076129 ACCAGAAGGTTGGGAGGCCACGG + Intronic
946693481 2:222328388-222328410 ACCAGGGGCTGGGGGGAGCTGGG - Intergenic
948253140 2:236546630-236546652 AAGAGAGGGTTGGAGAACCTGGG + Intergenic
1169103721 20:2975747-2975769 ACTAGAGAGTAGGGGGACATGGG + Intronic
1173526470 20:43736757-43736779 ACCCAAGGGGTGGGGGAGCTGGG + Intergenic
1173581699 20:44151645-44151667 ACTAGAGGGTGGTGGGACCATGG - Intronic
1176110265 20:63407724-63407746 CCCAGGAGGTGGGGGGACCTGGG + Intronic
1176252939 20:64134224-64134246 AACAGGGTTTTGGGGGACCTTGG + Intergenic
1181865296 22:25850056-25850078 AGCACAGAGATGGGGGACCTGGG - Intronic
1183123472 22:35751394-35751416 AGCAGAGGGTTGGGGGATGGCGG + Intronic
1183586441 22:38755722-38755744 AGGAGAGGGTTGGGGGGCCGCGG - Intronic
1183737981 22:39654394-39654416 AACAGAGGGTTGGGGCGCATGGG + Intronic
1184459537 22:44629133-44629155 CCCAGAGGGTCGGGGGGGCTGGG - Intergenic
1184755366 22:46512819-46512841 ACAAGAGGGTGGGGGGCCCCTGG - Intronic
950140546 3:10612199-10612221 CCCAGAGGGGCTGGGGACCTGGG - Intronic
950689872 3:14647085-14647107 ACAAGAAGGGTCGGGGACCTGGG + Intergenic
952676039 3:36031122-36031144 ACCAGATGGTTGAGGGCCCTGGG - Intergenic
953069672 3:39506572-39506594 ACCAGAGGGGTGGAGGAACTGGG + Intronic
953184681 3:40626877-40626899 ACCAGATGCTTGAGGGGCCTTGG + Intergenic
953428600 3:42817720-42817742 ACCAGTGGGTTGAGAGAGCTGGG - Intronic
955392960 3:58534538-58534560 AACAGAGGGCTTAGGGACCTGGG + Intronic
955573481 3:60332525-60332547 CCCAGAGGGCTGTGGGATCTAGG + Intronic
956166089 3:66399364-66399386 ACCCAAGGGTTGGTGGTCCTTGG - Intronic
959546886 3:107606923-107606945 ACCAGAGAGTGGGGGGAAGTGGG - Intronic
960289839 3:115870651-115870673 ACCAGTGAGTTGGGCCACCTTGG - Intronic
960935586 3:122899427-122899449 AACGGAGGGTTGGGGGAACCAGG + Intergenic
961005277 3:123401330-123401352 ACCTGAGGGCTGGGGAACCAGGG + Intronic
961168423 3:124779421-124779443 ACCACAGGGTAGGGGGAGGTTGG - Intronic
961406836 3:126685631-126685653 ACATGAGGTTTGGGGGACCAGGG + Intergenic
961644659 3:128386432-128386454 CCCACAGGGCTGGGGGCCCTGGG - Intronic
961661958 3:128473666-128473688 ACCAGGGTGTTTGGGGACCCTGG - Intergenic
963356640 3:144216121-144216143 GCCTGAGGGTTGGGGGCCCCTGG + Intergenic
967832851 3:193935668-193935690 TCCTGAGGGTTGGGAGACTTTGG + Intergenic
969174815 4:5390408-5390430 CCCAGAGGGTTGAGGACCCTGGG + Intronic
969664124 4:8547298-8547320 TTCAGATGGTTGGGGGATCTTGG - Intergenic
972923108 4:43968173-43968195 CCCTGGGGGTTGGGGGCCCTTGG - Intergenic
973221544 4:47732446-47732468 ACTAGAGGGGTGAGGGAGCTGGG - Intronic
982067840 4:151670388-151670410 GCCTGAGGGTTGGGGGATTTGGG + Intergenic
983652584 4:170048437-170048459 ACCTGAGTGATGGGTGACCTTGG - Intergenic
985185860 4:187315034-187315056 ACCAGAGGTTTGGGAGATGTTGG + Intergenic
986021539 5:3808993-3809015 ATCAGAGGGGTGGGGGCACTGGG + Intergenic
990655308 5:57948886-57948908 ACCTGAGGGATGCGGAACCTGGG - Intergenic
995378855 5:111510269-111510291 CCAAGAGGGTTGGGGGAGATGGG + Intronic
997467615 5:134098792-134098814 CCCAGAGGGTTGAGTCACCTGGG + Intergenic
997642010 5:135455504-135455526 AGCAGAGAGGTGGGGGATCTGGG + Intergenic
997781148 5:136659931-136659953 AACAGAGGGTTGTGGGGTCTAGG + Intergenic
998665151 5:144288496-144288518 AACAGATGGTTGGTGGACCCTGG + Intronic
999274023 5:150316975-150316997 ACCTGAGAGTTGGGAGTCCTGGG - Intronic
1005331862 6:24758377-24758399 TTCAGATGGTTGGGGGGCCTTGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006405737 6:33843716-33843738 ATCAGAGGGTAGGGGGACAACGG + Intergenic
1006424142 6:33953716-33953738 ACCAGAGGCTGGGGTGACCTGGG + Intergenic
1007111087 6:39313890-39313912 ACCAGAGGGTTGGGGGACCTCGG - Intronic
1007829814 6:44629635-44629657 ACCAGAGGGGTGGGTGAGCAGGG + Intergenic
1008264579 6:49409165-49409187 ACCAGAGGGGTGGAGGAAATGGG - Intergenic
1011693997 6:89895634-89895656 ACCTGAGGGTTCTGGGTCCTGGG - Exonic
1011863200 6:91786594-91786616 ACAAGATGGTGGGGGAACCTGGG - Intergenic
1013352414 6:109317716-109317738 CCCAGAGGGGACGGGGACCTTGG + Intergenic
1013619115 6:111872340-111872362 AGCAGAGGGGTGGGGGACAGAGG + Intronic
1016490407 6:144594286-144594308 ACCAGTGGGTTGTGTGACCTTGG - Intronic
1018040802 6:159920181-159920203 AACAAAGGGTAGGGGGACCTGGG - Intergenic
1018044523 6:159953950-159953972 ACCAAAAGGTTTGGGAACCTCGG - Intergenic
1019281037 7:200330-200352 GCCCCAGGGCTGGGGGACCTTGG + Intronic
1019499762 7:1359005-1359027 CCCAGAGGGGTGGGGGTCCCTGG + Intergenic
1019922435 7:4171632-4171654 ACCAGTGGATGAGGGGACCTTGG - Intronic
1024543296 7:50496839-50496861 AGCAGAAGCTTGAGGGACCTGGG + Intronic
1024745334 7:52399823-52399845 ACCAGTGGTTGGGGGGACCATGG + Intergenic
1025996057 7:66528222-66528244 TGCAGAGGGATGGGGGAGCTGGG + Intergenic
1028572462 7:92306035-92306057 ACCAGAGGGTGGGGTGGCCTGGG - Intronic
1029264117 7:99325325-99325347 ATAAAAGGGTTGGGGGAACTTGG - Intergenic
1031820872 7:126499782-126499804 ACCAGAGGCTGGGGGGAGGTGGG + Intronic
1032729363 7:134622690-134622712 ACCAGAGGGCAAGGGAACCTCGG + Intergenic
1033120889 7:138665295-138665317 AAAACAGGGTTGGGGGGCCTGGG + Intronic
1035473331 7:159125478-159125500 ACCAGAGGGTTGGGCTGCCCTGG - Intronic
1036985658 8:13526768-13526790 GCCAGGGGGTTGGGGGACAGGGG + Intergenic
1037567650 8:20130898-20130920 TCCAGAGGCTGGGAGGACCTAGG - Intergenic
1038670816 8:29581458-29581480 GCCAGATTGTTGGGGGGCCTTGG - Intergenic
1040008456 8:42640829-42640851 ACCAGAGGGCAGGGGAGCCTGGG + Intergenic
1042862478 8:73328324-73328346 AGCAGAGGGCTGGAGGAGCTGGG - Intergenic
1044422159 8:92009365-92009387 ACCATATGGTTGTGGGAACTCGG - Intronic
1044586953 8:93877087-93877109 ACCTGAGGGGTCGGGGAGCTGGG + Intronic
1044870850 8:96618509-96618531 ACCAGGGCCTTGGGGGATCTGGG + Intergenic
1045836091 8:106523360-106523382 ACCAGAGGGGTGGGAGATCTTGG + Intronic
1046503875 8:115112021-115112043 TCCAGAGAGCTGGGGGAGCTTGG - Intergenic
1048030543 8:130627714-130627736 ACCAGAGGATTAGGGGACGAGGG - Intergenic
1048054400 8:130849571-130849593 ACCAGAGGGTTGGTGGATGTGGG + Intronic
1049431587 8:142567680-142567702 ACCAGAGGGATGAGGGACAGGGG + Intergenic
1057264523 9:93605511-93605533 ATCAGAGGTTTGGGGGTACTGGG - Intronic
1058513966 9:105751238-105751260 AGCAGTGGGGTGGGGGACCATGG + Intronic
1059872023 9:118588032-118588054 ACCAAAGTATTGGGGGATCTTGG + Intergenic
1060158630 9:121338889-121338911 ACCAGAGGGTGCCTGGACCTGGG + Intergenic
1060423592 9:123486760-123486782 CCCAGAAGGTTGGGGGACCATGG - Intronic
1060551289 9:124486582-124486604 ACCCCAGGGGTGGGGGATCTCGG - Intronic
1060967134 9:127717608-127717630 ACCTGAGGGTGAGGGGACCCAGG - Exonic
1061709145 9:132475775-132475797 AGCAGAGGGTGGGGGTACCCAGG - Intronic
1061913857 9:133738890-133738912 ACCAGAGGGGTCTGGGAGCTCGG - Intronic
1062626533 9:137445542-137445564 GCCTGAGGGTTGGGGGGCGTTGG + Intergenic
1185683237 X:1906217-1906239 AGCAGAGGGGTGAGGGAGCTGGG + Intergenic
1185983838 X:4808373-4808395 ACCAGAGGGCTGGGGACCCTTGG + Intergenic
1187569919 X:20490399-20490421 ACCTGAGGGTTGAGGAAGCTAGG - Intergenic
1189771376 X:44431104-44431126 ACCAGTGGGTTGGGTCACTTTGG - Intergenic
1190300301 X:49053559-49053581 CCTAGAGGGTGGGGGGACCGGGG - Intronic
1190464159 X:50709041-50709063 TCCAGAGGGGTGGGGGACGGAGG + Intronic
1190533652 X:51406343-51406365 ACCTGAGGTGTGTGGGACCTGGG + Intergenic
1191700725 X:64038920-64038942 ACCAGAGGCCTGGCGGAACTTGG + Intergenic
1191880772 X:65842076-65842098 TCCAGAGTGTTGGGGGATTTCGG - Intergenic
1192795034 X:74419914-74419936 ACCTGAGGGCTGGCGGAGCTGGG - Intergenic
1194369581 X:93055818-93055840 ACCACAGGGTTGGGGGGCGCAGG - Intergenic
1200677773 Y:6172030-6172052 ACCACAGGGTTGGGGGGCGCAGG - Intergenic