ID: 1007111896

View in Genome Browser
Species Human (GRCh38)
Location 6:39317650-39317672
Sequence CTGTGAAAGAGGAAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007111896_1007111905 24 Left 1007111896 6:39317650-39317672 CCTTCACCCTTCCTCTTTCACAG 0: 1
1: 0
2: 1
3: 61
4: 525
Right 1007111905 6:39317697-39317719 GCCAAACTCCATCTCAGCATCGG 0: 1
1: 0
2: 1
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007111896 Original CRISPR CTGTGAAAGAGGAAGGGTGA AGG (reversed) Intronic
900860156 1:5223186-5223208 CTGTGGCAGAGGAAGGGTCCAGG + Intergenic
900891957 1:5456006-5456028 CTGTGAAGCTGGAAGGGTGCAGG - Intergenic
901004232 1:6164104-6164126 CTGGGAAGGAGGAAGGGTGGCGG - Intronic
901215402 1:7552129-7552151 CTTTGACAGAGCAAGGCTGATGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901332369 1:8420774-8420796 CTGTGAAGGCGGAGGAGTGATGG + Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902257048 1:15196426-15196448 ATGTGAAAGAGAGAGGGGGAGGG + Intronic
902790628 1:18765442-18765464 CTGGGAAAGGGGTAGGGTGCAGG + Intergenic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904432827 1:30476175-30476197 GTGGGCAAGAGCAAGGGTGATGG - Intergenic
905734263 1:40315254-40315276 ATGTGCCAGAGGCAGGGTGAGGG + Intronic
905825914 1:41025966-41025988 CTGTGAAACAGTCAGGGTCAAGG - Intergenic
905941222 1:41865006-41865028 CAGTTAAACAGCAAGGGTGAAGG + Intronic
906699263 1:47845977-47845999 CTGGGAAAGTGAAAGGGTGGAGG + Intronic
906760703 1:48374879-48374901 CTCTGAAAGAGGCAGGTTAATGG - Intronic
907574685 1:55515464-55515486 CTGTGAAAAATGAAGGGGGTTGG - Intergenic
908518932 1:64922043-64922065 CTGTGTCTCAGGAAGGGTGATGG - Intronic
910197242 1:84655064-84655086 ATGTGAATGAGGAAGGGTGTAGG + Intronic
911310575 1:96287938-96287960 CTCTGAAAGAGAAGGGGAGAAGG - Intergenic
911486991 1:98514958-98514980 GTGTGAAAGAAAAAGGGTTAAGG - Intergenic
911710959 1:101072492-101072514 CAGTGAAACAGGAAAGGTAAAGG - Intergenic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
913567329 1:120085550-120085572 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
913586061 1:120277010-120277032 CTCAGAAAGAGGCAGGGTCAAGG - Intergenic
913622124 1:120621359-120621381 CTCAGAAAGAGGCAGGGTCAAGG + Intergenic
913630805 1:120707996-120708018 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
914240531 1:145849870-145849892 CAGGGAAAGGGGAAGGGTGTAGG - Intronic
914288077 1:146246256-146246278 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914549113 1:148697002-148697024 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914568070 1:148888868-148888890 CTCAGAAAGAGGCAGGGTCAAGG - Intronic
914604754 1:149241380-149241402 CTCAGAAAGAGGCAGGGTCAAGG + Intergenic
914617569 1:149374717-149374739 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
915106790 1:153539862-153539884 CTGTGAAGGAGAATGGGTCAGGG - Intronic
915938305 1:160101657-160101679 ATGTGAAACAGGACGGGTGTCGG - Intergenic
916100920 1:161392548-161392570 CAGTGAAATAGTAAGAGTGATGG - Intergenic
916410848 1:164545589-164545611 CTGTGAAAGCGAAAAGTTGAAGG - Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917359523 1:174160113-174160135 CGGAGGAAGAGGAAGGGCGAGGG - Intronic
917382811 1:174432858-174432880 CTTTAAAAAAGGAATGGTGAGGG + Intronic
917586005 1:176426688-176426710 CTGTGAAATAGCAAAGGTGGTGG + Intergenic
917680455 1:177360952-177360974 CTGGGGCACAGGAAGGGTGAAGG - Intergenic
918019642 1:180674167-180674189 CTGTAAAACAGGAATAGTGATGG - Intronic
922110862 1:222553775-222553797 CTGTGACAGAGGGAGTCTGAAGG - Intergenic
922184512 1:223262189-223262211 CAGTGAAAGAGGAACGGGAAAGG + Intronic
922484514 1:225962809-225962831 CTGTAAGAGAGGAAGGGTTAGGG + Intergenic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922855357 1:228770400-228770422 CTGTGTCAGTGGAAGGGTGCAGG + Intergenic
922994311 1:229943929-229943951 CTGTGAGAGAGGAAGAGCAATGG + Intergenic
923401034 1:233615178-233615200 CAGAGTAGGAGGAAGGGTGAGGG + Intronic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
924608228 1:245553174-245553196 GTGTAAAAGAGGAGTGGTGATGG - Intronic
1063055354 10:2498309-2498331 CTGTGAAAGATGTGGGGAGAGGG + Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064515581 10:16144271-16144293 CTAAGTAAGAGGAAGGGAGAAGG - Intergenic
1066242156 10:33548613-33548635 CTGTGAAATATGAATAGTGATGG + Intergenic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068949822 10:62765745-62765767 CTTTCACAGAGGGAGGGTGAGGG - Intergenic
1069011282 10:63375990-63376012 CTGAGAAAGAAGAAAGTTGACGG + Intronic
1069178137 10:65320816-65320838 ATGTGAAAACTGAAGGGTGATGG - Intergenic
1069402184 10:68061047-68061069 CTGTGAAAGGGAAACGGTGTGGG - Intronic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1069812675 10:71174059-71174081 TTGTGAAACAGGAAGGCTGGAGG - Intergenic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070536608 10:77383144-77383166 CTCTGAATGAGGGAGGGGGATGG - Intronic
1070680933 10:78448532-78448554 CTGTGAAGGATAAAGGGTGGGGG + Intergenic
1070979064 10:80630022-80630044 CTGTGAAGGACAAAGGGGGAGGG + Intronic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1071876619 10:89850036-89850058 CTAGGAAAGAGGCAGGGTGGTGG + Intergenic
1072208707 10:93226624-93226646 ATGTGGAAGAGGAAGGGTCCTGG + Intergenic
1072442794 10:95471716-95471738 GTGTCAAAAAGAAAGGGTGAAGG + Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072751799 10:97986085-97986107 CTGGGAAGGAGGAAGGGTAAAGG + Intronic
1072922298 10:99586327-99586349 CAGTCAGAGAGGTAGGGTGAGGG - Intergenic
1073102648 10:101014824-101014846 TTGAGTAAGATGAAGGGTGAGGG + Intronic
1074270169 10:111945524-111945546 CTGTGAAATAGCAAGGATGGCGG - Intergenic
1074307725 10:112294416-112294438 GTGTGCAAGAGGAAGTGTGCAGG + Intronic
1074626074 10:115188035-115188057 CTGGGAGAGAGGGAGGGGGAGGG + Intronic
1074905851 10:117862754-117862776 TTGTGAAATAGGCATGGTGAAGG - Intergenic
1075551965 10:123399641-123399663 CTGTGCATCAGGAAGGGCGAAGG - Intergenic
1076070147 10:127482622-127482644 CTGTGGAAGCCCAAGGGTGAGGG - Intergenic
1076182930 10:128424703-128424725 CTAGGAAAGAGGAAAGGGGATGG - Intergenic
1077029210 11:456282-456304 CTTGGGAAGAGGGAGGGTGAGGG - Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1079376421 11:19896058-19896080 CGGTGAAGGAGCAGGGGTGATGG - Intronic
1079532877 11:21476682-21476704 CACTGAAAGAGGAAGAGTGTAGG + Intronic
1079616519 11:22500625-22500647 TTGTGAATGAGGAAGAGTCATGG - Intergenic
1080226043 11:29961599-29961621 CAGTAAATGTGGAAGGGTGAAGG - Intergenic
1081214617 11:40380655-40380677 CAGTAAAAGAGGAAGGGTAGCGG - Intronic
1081839524 11:46187139-46187161 CTGCGAAAGAAGGAAGGTGAAGG + Intergenic
1082822396 11:57552900-57552922 CTGTGAAAGATGAAGAGCCAGGG - Intronic
1084022639 11:66426727-66426749 CTGTGTAAAAGGAAGGGTGGAGG + Intergenic
1084091119 11:66879913-66879935 CTGTGAATGACGGAGGGTGAGGG + Intronic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084163786 11:67365631-67365653 CTGTGAAAAGGAGAGGGTGATGG + Intronic
1084323934 11:68388328-68388350 CTGTGAAAAAGGAAGGGATGGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085254068 11:75162488-75162510 CTAAGAATGAGGAAGGCTGAAGG + Intronic
1085271042 11:75269987-75270009 TTGGGAAAGAGGAAGGGACAGGG + Intronic
1085348557 11:75783719-75783741 CTGGGGAAGAGCATGGGTGAAGG - Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1087294300 11:96351947-96351969 CAGTCAAGGAGGAAGGGTAAAGG - Intergenic
1087800263 11:102496121-102496143 CTGTGAAGGATAACGGGTGAAGG + Intronic
1088841578 11:113631802-113631824 CACTGCAAGAGGAAGGGTGAGGG + Intergenic
1089217666 11:116845076-116845098 AAGGGAGAGAGGAAGGGTGACGG - Intronic
1089224898 11:116910619-116910641 CTGGGAAAGAGAAAGGGACAAGG + Intronic
1089355101 11:117844431-117844453 CTGGGAGAGAGGCAGGGGGATGG - Intronic
1089561816 11:119346982-119347004 CTGAGAAAGAAGCAGGGTGTAGG + Intergenic
1089616103 11:119695717-119695739 CTCTGTAAGAGAAAGGCTGATGG + Intronic
1091521471 12:1248386-1248408 CTGTGATAGATGATGGGGGAGGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1091795634 12:3296025-3296047 CTGAGAAAGAGGGAGCGTGCTGG - Intergenic
1092322166 12:7487714-7487736 CTGTGAAAGGGACAGGGTTAGGG - Intronic
1093131368 12:15395300-15395322 CTTGGAAAGAGGAAGGGTGAGGG + Intronic
1093345928 12:18038283-18038305 TAGTGAAAGGGGAGGGGTGATGG - Intergenic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1095304674 12:40625748-40625770 CTCTTAAAAAGGAAGGGGGAGGG - Intergenic
1096178183 12:49536869-49536891 CTGTGAAACAGCCAGGGTGGGGG - Intergenic
1096408539 12:51360936-51360958 CTGAGAAAGAGGAAAGGAGGGGG - Intronic
1097046854 12:56193380-56193402 GAGTGGAAGAGGAAGGGTGAAGG - Intergenic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1097710762 12:62914536-62914558 CTGTGGGAGAGGGAAGGTGATGG + Intronic
1098043834 12:66379838-66379860 TTGTGAAAGAGGAAATGAGAAGG - Intronic
1098144772 12:67487295-67487317 CTGTGAAACAGCAAGGATGGTGG - Intergenic
1099601266 12:84741244-84741266 CTGAGAAAGAAGAAAGATGAAGG + Intergenic
1100041415 12:90323001-90323023 TTGAGAAAGAGGAAGAGAGAAGG + Intergenic
1101008293 12:100424248-100424270 CCATGAAAGGGGAAGGGAGAAGG + Intergenic
1101926818 12:108978664-108978686 CTGGGAAGGAGAAAGGGAGAGGG + Intronic
1102244131 12:111344337-111344359 CTGTGAAACAGGAAGGAACAAGG + Intronic
1103088096 12:118077497-118077519 CTGTGAAAGAGGAATGTTTGTGG + Intronic
1103262189 12:119597017-119597039 CAGTGCAACAGGAAGGGTGTAGG - Intronic
1103387864 12:120547922-120547944 CTTTGAAAGAGGGTGAGTGATGG + Intronic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1103702613 12:122855597-122855619 CTGTGAAGGACGACAGGTGAGGG + Exonic
1103958896 12:124595117-124595139 CTGGGAAGGAGGCAGGGAGATGG + Intergenic
1104045443 12:125159656-125159678 CTGTGAAAGATAAAAGGTGGAGG - Intergenic
1104517769 12:129443575-129443597 TAGAGAAAGAGGAAGGGAGAAGG - Intronic
1104938021 12:132376959-132376981 CAGAGAGAGAGGAAGGGAGACGG + Intergenic
1105268538 13:18847049-18847071 CTGCAAAAGAGGAATGGTGAGGG + Intergenic
1105457135 13:20551424-20551446 ATGAGTAAGAGGAAGGGAGATGG + Intergenic
1106647659 13:31653998-31654020 CTCTGCAATAGCAAGGGTGAGGG + Intergenic
1106891251 13:34248025-34248047 ATGTGAAAGAGCAACGGTGAAGG + Intergenic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1113075908 13:106467962-106467984 CTGTAAAAGGGAAAGGTTGAAGG - Intergenic
1113281158 13:108789403-108789425 CTCTGAAAAATGAAGGGGGAGGG - Intronic
1113661879 13:112113179-112113201 CTGTTAAAGAGGAAAGGTGGAGG + Intergenic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1113954646 13:114091186-114091208 CTGTGAAAGATGAAGGGTCTGGG + Intronic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114632126 14:24165826-24165848 GTCTGAAAGAGAAAGGGTCAAGG - Exonic
1115144331 14:30208881-30208903 CTGTAAAATAGGTAAGGTGATGG + Intergenic
1115151566 14:30292331-30292353 CTGGGAAAGAGGAAGAGAGAAGG + Intergenic
1116313032 14:43350512-43350534 CTGTGAAAGAAGCATGGTGCTGG + Intergenic
1116467956 14:45254760-45254782 CTTTGATAGAGGAAGTTTGAAGG + Intergenic
1116644708 14:47511853-47511875 CAGTGAAAAAGGAATGGTGAAGG + Intronic
1117993634 14:61458705-61458727 CAGTCATAGCGGAAGGGTGAAGG + Intronic
1119175028 14:72562570-72562592 CTGTGAAGGAGAAAGAGTGAGGG + Intronic
1120602311 14:86526631-86526653 CTGTGAAAAAGGAAAGCTCAAGG - Intergenic
1121999989 14:98639623-98639645 TTGTCAAGGAGGAAAGGTGAAGG + Intergenic
1122832053 14:104403181-104403203 CAGAGAAGGAGGAAGGGTGGGGG - Intergenic
1202830767 14_GL000009v2_random:26907-26929 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1124103449 15:26716699-26716721 CTGTGAAAGAGAAAGGCAGTTGG - Intronic
1124229794 15:27934445-27934467 CTGTGTTAGAGGAGCGGTGAAGG - Intronic
1124239754 15:28019640-28019662 CTGTGGAGGAGGCTGGGTGAAGG - Intronic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1124362388 15:29047144-29047166 CTGTTAAAGATGAAGACTGAAGG - Intronic
1125099332 15:35891979-35892001 CTGCAAAACAGGAATGGTGAGGG - Intergenic
1125519726 15:40341006-40341028 CTCTGAGAGTGGAAGGGTGGGGG - Intergenic
1125539498 15:40461845-40461867 CTCTGAAAGCAGATGGGTGATGG + Intronic
1125593589 15:40870815-40870837 GTGTGAAAGAGCATGGCTGAGGG - Intergenic
1125923268 15:43539584-43539606 CTGGAAAGGAGGTAGGGTGAAGG + Intronic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127385044 15:58460364-58460386 ATGTGCAAAAGGAAAGGTGAAGG + Intronic
1127613943 15:60664436-60664458 CTGAGAAAGAAAATGGGTGAAGG + Intronic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129100281 15:73255734-73255756 CTAGGACAGAGGTAGGGTGATGG - Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129244332 15:74270531-74270553 CTGGGAAAGAGGATGGATTAGGG + Intronic
1130029293 15:80296973-80296995 CAGTGAAATAGGAGGTGTGATGG - Intergenic
1131174436 15:90201253-90201275 CCGGGAAGGAGGAAGGGGGAAGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1132010826 15:98275187-98275209 CTGATAAAGAGAAAGGGTAAGGG - Intergenic
1133124541 16:3637489-3637511 AGGTGAAACAGGAAGGGAGAGGG + Intronic
1133978590 16:10617576-10617598 CTGTGAGAGTGTAGGGGTGAAGG - Intergenic
1134360669 16:13528231-13528253 CTGAGCAAGGGGAAAGGTGAGGG - Intergenic
1135276917 16:21121110-21121132 GTGAGAAGGTGGAAGGGTGAGGG + Intronic
1135330645 16:21557133-21557155 CTGTAAATGGGGAAGGCTGAGGG + Intergenic
1135489336 16:22894908-22894930 ATGTCAAAGAGAAATGGTGAAGG - Intronic
1136165007 16:28447963-28447985 AAGTGAGAGAGGAAGGGGGAGGG - Intergenic
1136214305 16:28781194-28781216 AAGTGAGAGAGGAAGGGGGAGGG + Intergenic
1136244224 16:28964131-28964153 TGGTGAAAGGGGAGGGGTGAAGG - Exonic
1137491259 16:48934899-48934921 GTGTGACAGAGGAAGAGTTAGGG - Intergenic
1138483014 16:57316649-57316671 CTGTGAATGAGTATGGGGGAAGG + Intergenic
1138943646 16:61821051-61821073 CACTGCAATAGGAAGGGTGAAGG - Exonic
1140134673 16:72195387-72195409 CAGTGAAAGATAAAGGGAGAGGG - Intergenic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1142200559 16:88759321-88759343 CTCTGAAAGGGGCCGGGTGAGGG + Intronic
1142338718 16:89507456-89507478 CTGTCACAGAGGTAGGATGAGGG - Intronic
1143967162 17:10764221-10764243 CTGTGAAATAGGAATAGCGATGG - Intergenic
1145391189 17:22456893-22456915 CTTTGAAGGAGGAGGGGTTAGGG - Intergenic
1146657582 17:34644098-34644120 CTGTCCAAGAGGATGGATGAAGG - Intergenic
1147033391 17:37660352-37660374 CTGGGAAAGTGTAAGGGTGCGGG + Intergenic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148465173 17:47860814-47860836 GGGTGAAAGAGGAAGGGTCAGGG - Intergenic
1148641842 17:49193604-49193626 TGGTGAAAGAGGAAAGGAGAGGG + Intergenic
1149061620 17:52429274-52429296 GAGTGAATGAGGAAGAGTGAAGG - Intergenic
1151221314 17:72615158-72615180 TTGTGCAGGAGGCAGGGTGATGG - Intergenic
1151304481 17:73254249-73254271 CTCTGGAAGAGTAAGAGTGAGGG + Intronic
1152435225 17:80272438-80272460 CTGTGAAAGACTAAGCCTGATGG + Intronic
1152560114 17:81073784-81073806 TTGTGAAAGCCGAAGTGTGAGGG + Intronic
1153372949 18:4340708-4340730 TTGTGAGAGAGAAAGGGTGCTGG - Intronic
1154389038 18:13920773-13920795 GAGTGAACGGGGAAGGGTGAGGG + Intergenic
1154419484 18:14212952-14212974 CTACAAAAGAGGAATGGTGAGGG - Intergenic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156372147 18:36481121-36481143 CAGTGAAAGAGAAAAGCTGAGGG - Intronic
1156638552 18:39061761-39061783 CTGAGAAACAGGAAAGGTGATGG + Intergenic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1157812307 18:50706020-50706042 CTGTGAAACAGGTAGAGAGATGG - Intronic
1157820336 18:50762964-50762986 CAGAGAGAGAAGAAGGGTGAAGG - Intergenic
1157980349 18:52372707-52372729 GTGAGAAAGAGGGTGGGTGAGGG - Intronic
1158200879 18:54939165-54939187 CTGTGACAGAGTTACGGTGAGGG - Intronic
1158388887 18:57026944-57026966 CTGTGATAGGGAAAGGGAGAGGG + Intronic
1158776250 18:60583579-60583601 GAGTGAAAAAGGAAGGATGACGG - Intergenic
1159067423 18:63585800-63585822 CTATAAAAGAGGGAAGGTGAAGG + Intergenic
1159344564 18:67183547-67183569 CTGTAAGAGAGGAAGACTGATGG + Intergenic
1160047827 18:75404118-75404140 GGGTGAAAGAGAAAAGGTGAGGG + Intergenic
1160174758 18:76583966-76583988 CTGAGAAAGAGGAGGGCTCATGG - Intergenic
1160629876 18:80239326-80239348 CTCTGCAAGAGGAAGTGTGTAGG + Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1162069446 19:8144973-8144995 CTGTGGAGGAGAGAGGGTGATGG + Intronic
1162343704 19:10107618-10107640 CTGGGGGAGATGAAGGGTGAGGG - Intronic
1163387871 19:17011285-17011307 TTGTGACAGAGGAAGGCTGGTGG - Intronic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1165879501 19:39032254-39032276 CTGCGGGAGAGGAAGGGTCAAGG + Intronic
1166540117 19:43599575-43599597 CTGGGAAGAATGAAGGGTGATGG - Exonic
1167055697 19:47110957-47110979 CTGTGAAGGAGAAAGGGGAAAGG + Intronic
1167259706 19:48451393-48451415 CTCAGCAAGAGGAAGGGTGGCGG + Intronic
1167674893 19:50877882-50877904 CTGTGAGGGAGGCTGGGTGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168052184 19:53837663-53837685 ATGTGACAGAGTAGGGGTGACGG - Intergenic
1168105509 19:54163680-54163702 CTGGGAATGATGAAGGGTGGGGG - Intronic
1168110385 19:54188900-54188922 CTGTCGAAGAGGAAGGGTCCGGG - Intronic
1202641926 1_KI270706v1_random:100869-100891 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
925250591 2:2433825-2433847 ATGTGATAGAGGAAGGGGAAGGG + Intergenic
925677920 2:6385810-6385832 CAGGGGCAGAGGAAGGGTGAGGG - Intergenic
925715876 2:6783903-6783925 GTGAGAAAGAGGAAGCATGAGGG + Intergenic
926239238 2:11072242-11072264 CTTTGAAACATTAAGGGTGAGGG - Intergenic
928244790 2:29617844-29617866 CTGGGAGAGAGGAAAGATGATGG - Intronic
929024385 2:37585609-37585631 CTGTGAAGGATAAAGGGAGAGGG + Intergenic
929374487 2:41269082-41269104 CTGTGAAAGAGGTAGAGCAATGG + Intergenic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
931129796 2:59322289-59322311 CTGTGAAAGAGGATGGGCCAGGG - Intergenic
931640552 2:64377346-64377368 CTGGGAAAGAGAAAAGGAGAGGG + Intergenic
931689085 2:64819971-64819993 CTGTGAAGGATGAAGTGTGGTGG - Intergenic
931752369 2:65341210-65341232 GTGTGAAACAGGCAAGGTGAGGG + Intronic
932082857 2:68731431-68731453 CTAAGAGAGAGGAAGAGTGAGGG - Intronic
932606796 2:73170654-73170676 GTGTGACAGAGGAAGGGAGGGGG + Intergenic
933134755 2:78719348-78719370 CTGAGAAGCAGGAAAGGTGATGG + Intergenic
933276797 2:80292470-80292492 CTCTGAACGAGGAGGGATGAAGG + Intronic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
933925632 2:87089756-87089778 GTGTGACAGAGGAAGGGAGGGGG - Intergenic
934497761 2:94824330-94824352 CTGCAAAAGAGGAATGGTGAGGG + Intergenic
935324739 2:101925823-101925845 CAGAGCAAGAGGAAGGGTGTTGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
936243885 2:110809934-110809956 CTGTGGAAGAGCTTGGGTGAAGG - Intronic
936245180 2:110820268-110820290 ATGGGAAAGAGGAAGTGAGAGGG + Intronic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
936953595 2:118002692-118002714 CTGTTAGGGAGGAAGGGTGAGGG - Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938589711 2:132724585-132724607 CTGTGATAGATGAAGGGGAAGGG - Intronic
938692298 2:133802713-133802735 CTTTGAAAGGAGGAGGGTGAGGG + Intergenic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
940963099 2:159807543-159807565 TGGTGGAAGAGGAAGGGTGCAGG + Intronic
941373987 2:164705078-164705100 CTGTGAAGCAGGAAGAGTGAGGG - Exonic
941658180 2:168166983-168167005 CTGAGAAAGAGGACAGGTCAGGG + Intronic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941890787 2:170579448-170579470 CTGGGACAGAGGAATGGTGGGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942421757 2:175815077-175815099 CTTTGAAAGAGGAAGAGCTATGG - Intergenic
943816544 2:192264360-192264382 ATGTGAGATAGGAAGAGTGAGGG - Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944663582 2:201940772-201940794 CTGTGAAAGATGAAAGGGCAAGG - Intergenic
945517423 2:210779727-210779749 CTGTGAAAGATGAACAGTTAAGG + Intergenic
945856052 2:215071324-215071346 CTGTCAGATAGGCAGGGTGAGGG + Intronic
946031879 2:216711851-216711873 CTGAGAAATAGGAAGGATGTAGG - Intergenic
946127176 2:217573047-217573069 TTGTGGTAGAGGAAGGGTGTGGG + Intronic
946176249 2:217923375-217923397 CTGGCACAGAGCAAGGGTGATGG - Intronic
946176801 2:217927282-217927304 CTGGGACACAGGATGGGTGAAGG + Intronic
946700269 2:222405348-222405370 CTGAGAACCAGGAAGGCTGATGG - Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947898180 2:233694754-233694776 CTGTGAAAAGGCAAGGGTGAGGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
1168935508 20:1661888-1661910 CTGTCAATGAGGAAGGGTCATGG - Intergenic
1169286940 20:4316862-4316884 GTGTGAAAGAGGGAGGGGAAAGG + Intergenic
1171099428 20:22368624-22368646 GAGTCAAAGAGGAAGGGTGGGGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171501088 20:25593843-25593865 CTGTGAAGGAGGCTGGGTGAAGG - Intergenic
1171896317 20:30813467-30813489 CAGAGAAAGGGAAAGGGTGAGGG + Intergenic
1171953590 20:31442275-31442297 CCAGGAAAGAGAAAGGGTGATGG - Intronic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172975154 20:38900555-38900577 CAGAGAAAGAGGCAGGGTGAGGG - Intronic
1173215042 20:41073269-41073291 CTGAGAAAGAGAACGGGTCAGGG + Intronic
1173731676 20:45333245-45333267 CTGTGAAAGAGCCAGGGGGTGGG - Intronic
1174971564 20:55281406-55281428 CTTTGAGAGAGGTAGGGTGAAGG + Intergenic
1175148523 20:56914595-56914617 CAGTGAAAGAGAAAGACTGAAGG + Intergenic
1176513650 21:7767340-7767362 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1176609954 21:8871745-8871767 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1176728405 21:10464607-10464629 CTGCAAAGGAGGAAGGGTTAAGG - Intergenic
1176853818 21:13946344-13946366 CTGCAAAAGAGGAATGGTGAGGG + Intergenic
1177207380 21:18025793-18025815 CCGTGGAAGATGAAGGGAGAAGG - Intronic
1177942206 21:27424867-27424889 TGGTGAAAGAGGAAGGCAGAAGG - Intergenic
1177943411 21:27438899-27438921 CTGAGAAAGAGGAGAGGAGAAGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178647763 21:34397864-34397886 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1179029127 21:37704521-37704543 CTGTGAAAGCGGACGGATAATGG - Intronic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1180360019 22:11880996-11881018 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1180558474 22:16596647-16596669 CGTGGAAAGGGGAAGGGTGATGG + Intergenic
1180918517 22:19506206-19506228 CTGGGAAGGAGGAAGAGTGAGGG + Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1182082445 22:27538892-27538914 CAGGGAAGGAGGAAGGGGGAGGG - Intergenic
1183896829 22:40976077-40976099 CTGTGAAAGAGAAGAAGTGAGGG - Intergenic
1184569962 22:45316403-45316425 CTGTGAAAAAGGAAGTTTGTGGG + Intronic
949127955 3:469118-469140 GTGTGAAAGAGGGAGAGAGATGG - Intergenic
949852735 3:8435116-8435138 CTGTGAAAGAAGAAAGGAAAGGG + Intergenic
949922162 3:9011450-9011472 GTGTGACAGGGGAATGGTGAAGG - Intronic
950085547 3:10254984-10255006 GTGGGAAGGAGGAAGGGGGAAGG - Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950320427 3:12047387-12047409 CTGAGAAGAAGGAAGGATGATGG + Intronic
951400310 3:22225275-22225297 CAGTGAAGTAGCAAGGGTGACGG - Intronic
952731682 3:36643492-36643514 CGGTGAGAGAGGAAGCATGAGGG + Intergenic
953227558 3:41034365-41034387 CTGTGAAAGATAAAGGTAGAGGG - Intergenic
955034879 3:55257926-55257948 GTGGGAGAGAGGAAGGGGGAGGG - Intergenic
955395889 3:58556909-58556931 CAGGGAAGGAGGAAGGGGGAAGG + Intergenic
955838131 3:63080403-63080425 CTGTGCAAGAGGTAGCGTGAAGG + Intergenic
955953405 3:64264244-64264266 CTGTGAAATAGGCTGGCTGATGG + Intronic
956203319 3:66730163-66730185 CTGTGAAGGCGGATGGGTGCAGG + Intergenic
957168054 3:76700361-76700383 TGGTCAAAGAGTAAGGGTGAAGG - Intronic
958057484 3:88430807-88430829 ATGTGGATGAGGAAGGGTGCAGG - Intergenic
958119887 3:89271906-89271928 CTGAAAAAGAGGAAGGGGAAGGG - Intronic
959950586 3:112175819-112175841 CTGTGAAACAGCAAAGGTGGTGG + Intronic
960170497 3:114455019-114455041 CTGAGAGAGAGGAAGAGAGAGGG + Intronic
960232081 3:115240006-115240028 GTGGGAGAGAGGAAGGGAGAGGG + Intergenic
961744281 3:129053874-129053896 CTTTGAAAGAGGAGGGGTTGGGG + Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
964959237 3:162403727-162403749 CTTTGGAAGAGGAAGGGTCCAGG + Intergenic
965171321 3:165268285-165268307 CTTTGTAAGAGAAAGGGAGAGGG - Intergenic
965219193 3:165904367-165904389 CTGTGAAAGATACAGGGGGAGGG - Intergenic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
966000581 3:174944132-174944154 CTGTGAAACAGCAAAGATGAGGG + Intronic
967655229 3:192040261-192040283 CAGAGAAAGAGGAAAGGAGAGGG + Intergenic
967957023 3:194885161-194885183 CTGTGATGGAGGAAGAGTGGAGG + Intergenic
1202736640 3_GL000221v1_random:6535-6557 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
968646052 4:1741123-1741145 CTGTGAACGAGACAGGGTGCAGG + Intronic
968810545 4:2797784-2797806 CTGTCCCAGAGGAAGGGTGAGGG + Intronic
969135111 4:5023045-5023067 CTGTGAAAGACAGAGAGTGAGGG + Intergenic
969582548 4:8073529-8073551 CTGAGCAAGGGGAGGGGTGAGGG + Intronic
969987252 4:11225195-11225217 TTGTGAATGACAAAGGGTGAAGG + Intergenic
970023658 4:11597031-11597053 GTCTGAAAGAGGAAGGGAGGGGG - Intergenic
970251241 4:14118187-14118209 CTGTGAAAGAAGAAGACTAAAGG + Intergenic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
970624882 4:17865880-17865902 TTGTGAAGAAGGAAGGGTGTAGG - Intronic
970727837 4:19067899-19067921 CTCTGAAAAAGGAAGGATCATGG - Intergenic
971131819 4:23819512-23819534 CTGGGATAGAGGATGGGTAAGGG + Intronic
971307546 4:25496794-25496816 ATGAGAAAGGGGAAGGGTGGGGG - Intergenic
972729306 4:41777448-41777470 CGGTGAAAGAAGAAATGTGAGGG - Intergenic
973214076 4:47649194-47649216 CCGTGAAAGAGGCAGGATGAAGG + Intronic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
974132809 4:57777457-57777479 CTGGGAAAGAAGGAGGCTGAGGG - Intergenic
974210313 4:58764332-58764354 TTTTGAAAGAGGAAAGGTGCTGG - Intergenic
974629914 4:64475204-64475226 GAGTGAAAGAGGGAGTGTGAAGG - Intergenic
976198323 4:82555548-82555570 CTGTGTAAGAGGAGGCCTGATGG - Intronic
976216722 4:82721983-82722005 GTGTGCAACAGGAAGGGTGGAGG - Intronic
976244089 4:82990143-82990165 TTCTGAAGGAGGAAGGATGAGGG - Intronic
976337127 4:83902100-83902122 ATGAGAAAGTGAAAGGGTGAAGG - Intergenic
977055607 4:92186848-92186870 CTGTGAAAGAAGAAGGTTTCAGG + Intergenic
977809244 4:101340061-101340083 CTGTGAAACCGGAAGAATGATGG - Intronic
977822102 4:101485164-101485186 ATGAGAAAGAGGAAGGGAAAAGG + Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978257037 4:106704722-106704744 TTGTGAAACAGGAAGGGTTTGGG + Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
979446979 4:120825474-120825496 GTGTGAGAGAGGAAGGGTCAAGG - Intronic
979447104 4:120826826-120826848 GTGTGAGAGAGGAAGGGTCAAGG + Intronic
979680656 4:123456010-123456032 CTTACAAAGAGGAAGCGTGAGGG - Intergenic
979808368 4:125003450-125003472 TTGTGAAAGAGAAAGAATGAAGG - Intergenic
981655212 4:147105086-147105108 CTGTAAAAGGAGAAGGGTAAGGG - Intergenic
982335377 4:154231280-154231302 AAGTGAAAGAGGAAGGGAGGGGG - Intergenic
983803467 4:171964828-171964850 CTGCGAAAGAGGAATGGTGTTGG - Intronic
1202769294 4_GL000008v2_random:186734-186756 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
986221481 5:5772560-5772582 CTTTGAAAGAGGCAGAGTAAGGG - Intergenic
986348418 5:6855347-6855369 GTCTGTAAGAGGAAGGGTGCTGG - Intergenic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
986725857 5:10595862-10595884 CTGTGAACGAGCAGGTGTGATGG + Intronic
987092542 5:14521210-14521232 CACTGAAAGAGGAAGGGAGTTGG - Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987255329 5:16144524-16144546 CTGATGAAGAGGGAGGGTGATGG - Intronic
987427273 5:17787402-17787424 CTGTGAAGGGTGAAGGGTGAGGG - Intergenic
988787146 5:34575552-34575574 CTGTCAAAGAAGAGGGGTGATGG - Intergenic
989517533 5:42360905-42360927 TTCTGAAGGAGGAAGAGTGAGGG + Intergenic
989797213 5:45490465-45490487 CTCAGAAAGAGGAAGGGACAAGG - Intronic
990109173 5:52302763-52302785 CTGTCAATGGGGAAGGCTGATGG + Intergenic
990495690 5:56345620-56345642 CTGGCAGAGAGGAAGGGAGAGGG + Intergenic
992363302 5:76064758-76064780 ATTTGAAAGAGGAAAGGTTAGGG - Intergenic
992863361 5:80934302-80934324 CTTTGCTAGAGGAAGGTTGATGG - Intergenic
993413897 5:87602123-87602145 CTGTGAAAGAGCAAAGATGGTGG + Intergenic
994950218 5:106452305-106452327 TTCTAAAAGAGGAAGGATGAGGG + Intergenic
996723056 5:126648485-126648507 CTGAGAAACAGGTAGGGGGAAGG + Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
998658083 5:144204984-144205006 CCGTGAACGAGGAGGGGGGAGGG + Intronic
998741026 5:145201967-145201989 GTGTAGAAGAGGAGGGGTGATGG - Intergenic
999067907 5:148711287-148711309 CTGAGAGAGAGTAAGGGTGTTGG + Intergenic
1000118582 5:158175871-158175893 AGGTGAAAGATGAAGGGTGTGGG + Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000809108 5:165838549-165838571 GTGTGAGAGAGAAAGGGAGAAGG - Intergenic
1001706001 5:173741660-173741682 CTGAGAGAGAGGGAGGGAGAGGG + Intergenic
1001897414 5:175393278-175393300 CTGTGATGGAGGTGGGGTGAGGG - Intergenic
1002853727 6:1020022-1020044 GTGTGAAAGAGAATGGGTGAGGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003370835 6:5524287-5524309 GTGGGAAAGAGGAACTGTGAGGG + Intronic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1004012366 6:11702101-11702123 CTGTGAAGGATGAAGGGTTGAGG - Intergenic
1004073937 6:12328156-12328178 GTGTGAAGCAGGAAGGGAGAAGG + Intergenic
1004349774 6:14880895-14880917 CTGTGAAAGAGGAAATGTGTTGG - Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1005900519 6:30213335-30213357 CCGTGAGAGAGGAGGGGTGCCGG - Exonic
1005999257 6:30952727-30952749 GTGTGAAAGAGAAAGTGTGGGGG + Intronic
1006210254 6:32387313-32387335 ATGTGAAGAAGGAAGGGTCATGG + Intergenic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006817688 6:36863987-36864009 CTGTGAAAGATAAAGGGTCAGGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007292536 6:40798402-40798424 CTGGGAGAGAGGAAGAGGGAGGG + Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008251427 6:49244875-49244897 CTGTTAAAGATGAAGAGAGAAGG + Intergenic
1009939974 6:70280393-70280415 CGGTGAAAGAGCAAGGGCGAAGG + Intronic
1010091236 6:71984927-71984949 GTGTGAAGGAGGAAGAGTGTAGG - Intronic
1010825655 6:80470295-80470317 CTCTGCAAGAGGAAAAGTGATGG - Intergenic
1011050979 6:83149441-83149463 TTGTGAAACAGGAAGGGGAAGGG + Intronic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013299928 6:108795277-108795299 CTGTGACAGAGGTAGGGTAATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013647147 6:112156233-112156255 GTGTGAAAGGGCAGGGGTGAGGG - Intronic
1014623530 6:123698912-123698934 CTGAGAAACAGGGAAGGTGATGG + Intergenic
1015217685 6:130768723-130768745 ATGTGAAAGATGAAGGGGAATGG - Intergenic
1015608801 6:134991260-134991282 GTGTGTAAGAGGAAGTGTGTAGG - Intronic
1015881371 6:137873330-137873352 CGGTGAATGAGGAAGGGAGTAGG + Intronic
1016032881 6:139356218-139356240 TTGTCAAAGAGGGAGGGGGAAGG + Intergenic
1016486669 6:144547306-144547328 CTTTGAAAGATGAAAGGAGATGG - Intronic
1016844039 6:148553710-148553732 CTGTGAGAGAGAAAGGGAGGAGG + Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017222865 6:151986837-151986859 CAGAGAAAGAGGAAAGGAGAAGG - Intronic
1017847906 6:158275409-158275431 CTGTGAAAGACCATGGGAGATGG + Intronic
1017866590 6:158449248-158449270 ATGTGGAGGAGGGAGGGTGAAGG + Intronic
1017881842 6:158567502-158567524 CCGTGAGAGATGGAGGGTGAGGG + Intronic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018830997 6:167443509-167443531 GTGGGGAAGATGAAGGGTGAGGG + Intergenic
1019657410 7:2203238-2203260 CTATGAAATAGGAAGGGAGTGGG - Intronic
1019929030 7:4211257-4211279 CTTTGAAAGAGGAAATGTCAGGG + Intronic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1021239050 7:18178086-18178108 CTGTCAAAGAGGAGAGGGGAGGG - Intronic
1021782900 7:24123066-24123088 GCGTGTAAGAGGAAGGGAGATGG + Intergenic
1023200349 7:37690419-37690441 CTGTGAAAGGGGAAAGGACAGGG - Intronic
1023867796 7:44247046-44247068 CTGTGTACAAGGAAGTGTGAGGG - Intronic
1024514102 7:50229436-50229458 ATGGGAAAGAGGAAGGGTGCAGG + Intergenic
1024544237 7:50503439-50503461 CTCTGAATGAGGAAGGGAGGAGG + Intronic
1024742533 7:52370630-52370652 GTGAGAAAAGGGAAGGGTGAAGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027765427 7:82334724-82334746 CTAGCAGAGAGGAAGGGTGATGG + Intronic
1029220392 7:98984043-98984065 CTTTGAAAGAGGATCGGTGTGGG + Intronic
1030796793 7:113798714-113798736 CTGTGAAAGATAAAGGGGAAAGG + Intergenic
1031484216 7:122309031-122309053 GTGTGATGGAGGCAGGGTGACGG + Intronic
1032860063 7:135868242-135868264 CTCTAAAAAAGGAAGGGAGAGGG + Intergenic
1032997079 7:137459204-137459226 CTGAGAAAAAGGGAGGTTGATGG + Intronic
1033370673 7:140704589-140704611 CTGTGATAGAGGGAGGGTAGGGG - Intronic
1033648700 7:143323742-143323764 GTATGTAAGAGGTAGGGTGAGGG - Intronic
1033658882 7:143390555-143390577 CTGGGAAGAAGGAAGGGTGAGGG - Intronic
1034601684 7:152263363-152263385 CTGCAAAGGAGGAAGGGTTAAGG + Intronic
1034729590 7:153374830-153374852 CTGGGATAGGGGAAGGGTGTGGG - Intergenic
1035115081 7:156517423-156517445 CTGTGAAGGAGGCTGTGTGAGGG + Intergenic
1036438519 8:8758750-8758772 CTGTGAAAGTGGAAATGAGATGG - Intergenic
1036543389 8:9741436-9741458 CTGTGAAAGGTGAAGGCTAATGG - Intronic
1036549408 8:9803527-9803549 TAGTGAGAGAGGAAGAGTGAAGG - Intergenic
1036622534 8:10434252-10434274 CTGTGAAAGAGTAAAAATGAGGG + Intergenic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037759360 8:21731714-21731736 CCGCGAAGGAGAAAGGGTGATGG + Intronic
1038429760 8:27491006-27491028 CCGGGAAAGAGGCAGGGGGAGGG - Exonic
1038896599 8:31790342-31790364 CAGTGATAGAGGAAGGGTACTGG + Intronic
1039129787 8:34249993-34250015 GGGAGAAAGAGGAAAGGTGAAGG + Intergenic
1041610714 8:59844424-59844446 CTGTGAAGGATGTGGGGTGATGG + Intergenic
1041678592 8:60562799-60562821 CTCTGGAAGAGGAAGAGTAAAGG + Intronic
1041778433 8:61550839-61550861 CTGAGCAAGAGGGAGGGTGAGGG + Intronic
1041799504 8:61783966-61783988 CTGAGAACCAGGAAGGCTGAGGG + Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042722692 8:71842531-71842553 CAGGGAAAGGGGAAGGGTCAAGG + Exonic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1044115545 8:88328848-88328870 GGCTGAAAGAGGAAGGGGGAAGG + Intergenic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048445092 8:134487387-134487409 CTGTGAGGAAGGCAGGGTGAGGG + Intronic
1048539804 8:135332619-135332641 CTGCTAAAGAGGAAGGGTCCAGG - Intergenic
1048878075 8:138852229-138852251 CTGTGACAGGGAAAGGGTGGAGG + Intronic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1049958339 9:713485-713507 CTGGGAATGAGGAAGGATGGGGG + Intronic
1050137462 9:2481803-2481825 CTGGAAAAAGGGAAGGGTGAGGG - Intergenic
1051725500 9:20084516-20084538 CTGTGAAAGAAAAAAGGAGAGGG - Intergenic
1053123905 9:35564265-35564287 AGGTGAAAGAGGACAGGTGATGG + Intergenic
1053410241 9:37911606-37911628 CTGTGAGAGAGCCAGGGTCAGGG - Intronic
1053461074 9:38272032-38272054 CTGTGAAGGAGAAAGGGTGCTGG - Intergenic
1053659385 9:40256143-40256165 CTGCAAAAGAGGAATGGTGAGGG - Intronic
1053909757 9:42885506-42885528 CTGCAAAAGAGGAATGGTGAGGG - Intergenic
1054360419 9:64108905-64108927 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1054371512 9:64402444-64402466 CTGCAAAAGAGGAATGGTGAGGG - Intronic
1054525213 9:66120074-66120096 CTGCAAAAGAGGAATGGTGAGGG + Intronic
1054679133 9:67892159-67892181 CTGCAAAAGAGGAATGGTGAGGG - Intronic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1056535855 9:87527030-87527052 CTGTGAAAGAGGACACCTGAAGG + Intronic
1056628611 9:88274552-88274574 CTGTGAGTGAGGCAGGGTGGTGG - Intergenic
1056832320 9:89927294-89927316 ATGGGAGAGAGGAAGAGTGATGG - Intergenic
1056867083 9:90237597-90237619 CTCTGAAGGAGGAGGGGTTAGGG - Intergenic
1057545773 9:96019853-96019875 GTGAGAGAGAGGAAGGGGGACGG + Intergenic
1058681034 9:107440422-107440444 CTTTAAAAGAGGAAAGGAGAGGG + Intergenic
1059099549 9:111456723-111456745 CTGTGAAACTGGGAGGGTGCTGG - Intronic
1059516050 9:114896707-114896729 CTCAGAGATAGGAAGGGTGATGG + Intronic
1059736264 9:117102943-117102965 CTGTGAGAGAGACAGGGAGAGGG + Intronic
1060190322 9:121588535-121588557 GGGGGAAAGGGGAAGGGTGAAGG + Intronic
1060389322 9:123266293-123266315 CAGTAAATGAGGAAGGGGGAAGG - Intronic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1061338476 9:129959818-129959840 CTGAGGAAGATGGAGGGTGACGG - Intronic
1061394809 9:130338059-130338081 CTGAGAGACAGGCAGGGTGATGG - Intronic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1203694182 Un_GL000214v1:80450-80472 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203705372 Un_KI270742v1:36975-36997 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1203558637 Un_KI270744v1:28830-28852 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203642091 Un_KI270751v1:23613-23635 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1203654684 Un_KI270752v1:11783-11805 CTCAGAACAAGGAAGGGTGAAGG - Intergenic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186410801 X:9342893-9342915 CTCTGAAACAGGAAAGGGGACGG + Intergenic
1187527390 X:20066386-20066408 GTGGGAATGAGGAAGGGGGATGG + Intronic
1188422144 X:30003250-30003272 TAGTGAAAGATGAAGGGGGAAGG - Intergenic
1188791685 X:34413767-34413789 CTGCTGAAGAGTAAGGGTGAGGG - Intergenic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189513490 X:41686892-41686914 AAGAGAAAGAGGAAGCGTGAAGG + Intronic
1190709356 X:53055292-53055314 GTGTGAAAGAGAAAGTGTGTAGG + Intronic
1190753553 X:53381895-53381917 AGGAGAATGAGGAAGGGTGAAGG + Intronic
1192163641 X:68808814-68808836 CTGTGAAGGAGGCAGAGAGAGGG - Intergenic
1192880770 X:75281299-75281321 ATGTTGAAGAGGAATGGTGAGGG + Intronic
1193228688 X:79016406-79016428 ATGTTGAAGAGGAATGGTGAGGG - Intergenic
1195164736 X:102208084-102208106 ATGAGAAAGAGCAAGAGTGAGGG + Intergenic
1195194122 X:102479007-102479029 ATGAGAAAGAGCAAGAGTGAGGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196353655 X:114763049-114763071 CTATGAATGATGACGGGTGATGG - Intronic
1196931185 X:120683578-120683600 CAGTGAAAGAGGTGGGGAGATGG + Intergenic
1196988246 X:121298672-121298694 CTGAGTCAGAGTAAGGGTGATGG - Intergenic
1197974680 X:132154089-132154111 CTTTGAAAGATGGAGGGTGAAGG + Intergenic
1198006683 X:132501882-132501904 GTGTGAAGGAGGAAGACTGATGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199533477 X:148875711-148875733 CTGTTAAAGAGTTTGGGTGAGGG + Intronic
1199698336 X:150359552-150359574 CGGAGACAGAGGCAGGGTGAGGG - Intergenic
1200949185 Y:8877401-8877423 CTTTAAAAGAGGATGGGTAAGGG - Intergenic
1201698550 Y:16854353-16854375 CTGTCAAACAGGAAGGATGGAGG - Intergenic