ID: 1007112567

View in Genome Browser
Species Human (GRCh38)
Location 6:39321392-39321414
Sequence CCATCTACAAAGTGGAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007112560_1007112567 20 Left 1007112560 6:39321349-39321371 CCAGTAGCTGTGCAGCCTTGGTC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1007112567 6:39321392-39321414 CCATCTACAAAGTGGAGATAGGG No data
1007112561_1007112567 5 Left 1007112561 6:39321364-39321386 CCTTGGTCAACATATTCTACCTC 0: 1
1: 0
2: 1
3: 28
4: 214
Right 1007112567 6:39321392-39321414 CCATCTACAAAGTGGAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007112567 Original CRISPR CCATCTACAAAGTGGAGATA GGG Intronic
No off target data available for this crispr