ID: 1007114123

View in Genome Browser
Species Human (GRCh38)
Location 6:39331164-39331186
Sequence CAGAAAAAGAAGAAGGAGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1373
Summary {0: 1, 1: 0, 2: 6, 3: 105, 4: 1261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007114123_1007114130 18 Left 1007114123 6:39331164-39331186 CCCAACTCCTTCTTCTTTTTCTG 0: 1
1: 0
2: 6
3: 105
4: 1261
Right 1007114130 6:39331205-39331227 TCATCCAGGCTGGAGTGCAGTGG 0: 4928
1: 92025
2: 179521
3: 208342
4: 192078
1007114123_1007114129 8 Left 1007114123 6:39331164-39331186 CCCAACTCCTTCTTCTTTTTCTG 0: 1
1: 0
2: 6
3: 105
4: 1261
Right 1007114129 6:39331195-39331217 TCTTGCTCTGTCATCCAGGCTGG 0: 1678
1: 30797
2: 79818
3: 153968
4: 162427
1007114123_1007114128 4 Left 1007114123 6:39331164-39331186 CCCAACTCCTTCTTCTTTTTCTG 0: 1
1: 0
2: 6
3: 105
4: 1261
Right 1007114128 6:39331191-39331213 AGGGTCTTGCTCTGTCATCCAGG 0: 464
1: 5933
2: 25097
3: 70351
4: 129746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007114123 Original CRISPR CAGAAAAAGAAGAAGGAGTT GGG (reversed) Exonic
900731614 1:4265617-4265639 CCGAAAAAAAAGAAGGGGGTTGG - Intergenic
900838708 1:5028997-5029019 GAGAAAAAGAAGAATTAGATTGG - Intergenic
900923227 1:5687063-5687085 GTGAAACAGAAGAAGAAGTTGGG - Intergenic
901192168 1:7419132-7419154 AATAAAAAGAAGAAGAAGTTCGG - Intronic
901669074 1:10843818-10843840 CAGAAGAAGAGGATGGAGATGGG - Intergenic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
903085637 1:20855530-20855552 AAGAATAAGAAGAAAGAGATTGG + Intronic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
903145825 1:21371427-21371449 AAAAAAAAAAAGAAGGAGTTGGG + Intergenic
903167773 1:21532950-21532972 GAGAAAAAGATGAAGGTGTTGGG + Intronic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903396136 1:23003120-23003142 GAGAAAAAGAAGAAAGATTTGGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903914272 1:26751937-26751959 GAAAAAGAGAAGAGGGAGTTTGG + Intronic
904025753 1:27502531-27502553 AAAAAAAAGAAGAAGGGCTTCGG + Intergenic
904073216 1:27818080-27818102 GAAAGAAAGAAAAAGGAGTTAGG + Intronic
904102703 1:28046305-28046327 CAGGAAAAGATGAAGGTGATGGG + Intronic
904625795 1:31801320-31801342 CAAGAAAAGAGGAAGGAGGTGGG - Intronic
904860005 1:33529580-33529602 CACATAAAAAAGAATGAGTTTGG + Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905129005 1:35738053-35738075 CTGAAGAAGAAGAAGAAATTGGG - Exonic
905445310 1:38024859-38024881 CAATAAAAGAAGAATGAGTGAGG - Intergenic
905484041 1:38283204-38283226 CAGGACATCAAGAAGGAGTTGGG + Intergenic
906087596 1:43149058-43149080 GGGAAAGAGAATAAGGAGTTGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906274832 1:44507877-44507899 GAGAAAAAGAAGGGGGAGTGTGG - Intronic
906302123 1:44690506-44690528 GAGAGAAAGAATAAGGAGATAGG - Intronic
906548228 1:46637932-46637954 CAGAAACAGAAGGATGAATTGGG - Intronic
907166819 1:52419371-52419393 AAGAAGAAGAAGAATGGGTTTGG + Exonic
907190635 1:52645033-52645055 AAGAAGAAGAAGAAGAAGTAAGG + Intronic
907293481 1:53433779-53433801 GAGAAAAACAAGAAAGATTTGGG - Intergenic
907534709 1:55140242-55140264 CATTTAAAGAAGTAGGAGTTTGG + Intronic
907721137 1:56973459-56973481 CAAAAAAAAGAGAAGAAGTTTGG - Intergenic
908170497 1:61499895-61499917 TAGAAAAAAAGGAAGGAGCTGGG + Intergenic
908984425 1:69999758-69999780 GAGAAAAAGCAGAAGAAATTTGG + Intronic
909195112 1:72610424-72610446 AAGAAGAAGAAGAAAGAGATAGG - Intergenic
909444625 1:75734821-75734843 CAACAAAAGAAGAAGTATTTGGG + Exonic
909650967 1:77975874-77975896 CAGAAAAAAAAAAAGAAGATTGG + Intronic
909961278 1:81846686-81846708 GAGAAAAAGAAGAATCAGTAAGG - Intronic
910076113 1:83280978-83281000 CAGAAAAAGACCAAAGACTTTGG + Intergenic
910219410 1:84875477-84875499 CTGATAAAAAAGAATGAGTTTGG + Intronic
910801396 1:91150632-91150654 CAGAAAAAGAAGAACAAACTAGG - Intergenic
911070962 1:93831590-93831612 GAGAGAAAGAAGAAAGATTTGGG - Intronic
911196549 1:95000837-95000859 CAGAAAGAGAAGAAGAAGAGAGG + Intronic
911228134 1:95330561-95330583 AAGAAAAAGACAAAGAAGTTGGG + Intergenic
911321202 1:96415656-96415678 TAGAAGAAGAAGAAGAAGTAAGG + Intergenic
911603262 1:99869989-99870011 CAGAATCAGAATCAGGAGTTTGG - Intronic
911697605 1:100909273-100909295 CTGCAATAGAAGAAAGAGTTGGG + Intronic
911761334 1:101620842-101620864 CAGAAAAAGAAAAAAGAGAGTGG - Intergenic
912101010 1:106204824-106204846 CAGAGAAAGATAAAAGAGTTGGG - Intergenic
912157371 1:106938376-106938398 TAAAAAAAGAAAAAAGAGTTGGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
913099734 1:115552004-115552026 CAAAAAAAGAAGAAAGCATTTGG - Intergenic
913245024 1:116863664-116863686 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
913384187 1:118241713-118241735 GAGAAAAAGAGGGAGGAGTCAGG - Intergenic
913970999 1:143417601-143417623 AAGAAAAAGAAAAAGAGGTTGGG + Intergenic
914003112 1:143709266-143709288 CAGGAGAAGAAGGAGCAGTTGGG + Intergenic
914065377 1:144243213-144243235 AAGAAAAAGAAAAAGAGGTTGGG + Intergenic
914113774 1:144723141-144723163 AAGAAAAAGAAAAAGAGGTTGGG - Intergenic
914204782 1:145517552-145517574 AAGAAGAAGAGGAAGGAGTGTGG + Intergenic
914262525 1:146011140-146011162 AAGAAAAAGAAAAAGGGGCTTGG - Intergenic
914370780 1:147022675-147022697 AAGAAGAAGAGGAAGGAGTGTGG - Intergenic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
914962862 1:152221644-152221666 CAGAAAGAGAAAAAGGAATATGG + Intronic
914984211 1:152442321-152442343 CAGAAAAAAAAACAGGAGTGGGG - Intergenic
915134016 1:153716924-153716946 AAAAAAAAAAAGAAAGAGTTGGG + Intergenic
915332704 1:155123449-155123471 AAGAAAAAGAAAAAGAACTTAGG - Intergenic
915401052 1:155622148-155622170 CAGAAAAAGAAAAAGGGGAGGGG - Intergenic
915527585 1:156485508-156485530 AAAAAAAAGAAGAAGGAGAAGGG - Intronic
916512252 1:165482669-165482691 CAGGAAAAGAAGAGGAAGTTGGG + Intergenic
916549682 1:165838208-165838230 CAAAGAAAGAAGAGGGAGATGGG - Intronic
916746239 1:167686988-167687010 GAGTAAAAGCAGAGGGAGTTAGG + Intronic
916976034 1:170079703-170079725 GAGAAAAAGAAGAAAGATTGAGG - Intronic
917067275 1:171110594-171110616 CAGAAAGAGTAGAAGATGTTGGG + Intronic
917216275 1:172681307-172681329 GAGAAGGAGAAGAAGGAGGTTGG + Intergenic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
917749531 1:178041516-178041538 CAGAGAAAGAAGAAAGATTTGGG - Intergenic
918231123 1:182533207-182533229 CAGAAAAATAATTAGGAGGTAGG - Intronic
918404692 1:184200206-184200228 CCTAAAAAGAAGAGGGAGTAGGG - Intergenic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
919311795 1:195918409-195918431 CAGAAAAAGAGGAAGGGTCTGGG - Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919676385 1:200387718-200387740 CAGAGTAAGAAAAAGGAGATGGG + Intergenic
920004107 1:202820278-202820300 CAGAAAAACAAAAAGGAGCTGGG - Exonic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920657160 1:207885765-207885787 GAGAAAAGCAAGAAGGAGATGGG + Intronic
920793349 1:209113816-209113838 CAGACAAAGCAGAATGTGTTAGG - Intergenic
921037965 1:211400562-211400584 CAGTAAAAGAAACAGGAGCTTGG - Intergenic
921101432 1:211932352-211932374 AAAAAAAAGAAGAATGAATTGGG + Intergenic
921103244 1:211949928-211949950 CAGACAGATAAGAAGGGGTTGGG - Intronic
921105144 1:211969526-211969548 AAGAAAAAGAAAAAGAAATTTGG - Intronic
921451723 1:215316354-215316376 CAGAACAAGAAGGAGGAATAGGG + Intergenic
921572505 1:216796164-216796186 CAGAAATAGAAGGAGCAGTGGGG + Intronic
921640296 1:217544994-217545016 GAGAAAAACAAGAAGGAGAGGGG - Intronic
922046282 1:221949121-221949143 GAGAGAAAGAAGAAAGATTTAGG - Intergenic
922598868 1:226834796-226834818 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
923160722 1:231312427-231312449 AAGAAAAAGAAGAGGGAGAGTGG + Intergenic
923329264 1:232907475-232907497 AAGAAGAAGAAGAAGAAGTAAGG + Intergenic
923588960 1:235301708-235301730 CAAAAAAAAAAGAATTAGTTAGG - Intronic
923709370 1:236373499-236373521 CAGAAATGTAAGAAGGAGCTGGG - Intronic
923739561 1:236643034-236643056 CAGGCAAAGAAAAAGGGGTTTGG - Intergenic
923747129 1:236711702-236711724 CACAAAAAGAAGACCGAGATGGG - Intronic
924232817 1:241976622-241976644 AAGAAAAAGAGAAAGGGGTTTGG - Intergenic
924262218 1:242243643-242243665 TAGAAGAGGAACAAGGAGTTTGG + Intronic
924534778 1:244926208-244926230 GAGAAAAATAAGAAGAAATTAGG - Intergenic
924557586 1:245130924-245130946 AAGAGAAAGAAGAGGGAGATTGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063092593 10:2880411-2880433 TAAAAAAAGAAGAAGAAGATAGG + Intergenic
1063106526 10:2997168-2997190 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1063266382 10:4455841-4455863 CAGAAATAGAAGATGGTGTTTGG + Intergenic
1063518086 10:6715883-6715905 AAGAAAAATAAGATGGTGTTTGG + Intergenic
1063757468 10:9030234-9030256 AAGAAGAAGAAAAGGGAGTTGGG - Intergenic
1064366426 10:14712621-14712643 AAAAAAAAGAAGAAGAAGTTGGG + Intronic
1064896356 10:20241787-20241809 AATAAAAAGAAGAAGAAGTGAGG + Intronic
1065064697 10:21949397-21949419 AAAAAAAAGAAGAAGGGGGTGGG - Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065519603 10:26558858-26558880 CACAAAGAGAAGAAGGAAATGGG - Intronic
1065522906 10:26589173-26589195 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065528830 10:26648444-26648466 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065559275 10:26946059-26946081 CAGGGAAAGAAGAAGGGGTGGGG + Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1065930046 10:30471335-30471357 CAAAAAAAAAAAAAGGAGTTTGG - Intergenic
1066437471 10:35407414-35407436 GAGAGAAAGAAGAAAGATTTGGG + Intronic
1067555890 10:47270645-47270667 CTGAAAAAGAAGAACAAGTTTGG - Intergenic
1067672203 10:48333666-48333688 CAGGGAAAGAAGAAGGGGTGGGG + Intronic
1067727879 10:48785772-48785794 CTGAAAAAGAAGAATTAATTTGG - Intronic
1067780366 10:49198231-49198253 AAAAAAAAGAAGAAGAAGCTTGG + Intergenic
1068336449 10:55638643-55638665 CAGAAAAAGAATAAAAACTTTGG - Intergenic
1068423523 10:56825217-56825239 GAAAAAAAGAAAAAGAAGTTTGG + Intergenic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068599797 10:58944642-58944664 CAGAAACAGAAGGAAGAGTATGG - Intergenic
1069204118 10:65660317-65660339 CAGAAAAAGATGAAAGCCTTGGG - Intergenic
1069517327 10:69088345-69088367 GAGGCAAAGAAGAAGGATTTGGG + Intronic
1070119792 10:73564911-73564933 AAAAAAAAAAAAAAGGAGTTGGG + Intronic
1070299587 10:75193522-75193544 CAAAAAAAGGAGAATGTGTTTGG - Intergenic
1071102650 10:82057305-82057327 CAGAAATTGGAGTAGGAGTTAGG - Intronic
1071303227 10:84273519-84273541 CAGAAAAAAAAAAAGGATTTGGG + Intergenic
1071550898 10:86565420-86565442 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1071730896 10:88247408-88247430 CAGAAAAAATAGAATGAGTTCGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072810675 10:98459100-98459122 GAGGCAGAGAAGAAGGAGTTGGG + Exonic
1073013772 10:100382190-100382212 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1073557836 10:104470370-104470392 CAGAAAAAGAAGAACAAGTTGGG - Intergenic
1073641253 10:105254797-105254819 AAAAAAAAAAAGAAGTAGTTGGG + Intronic
1073752226 10:106541670-106541692 CAGAACAGCATGAAGGAGTTTGG + Intergenic
1074863347 10:117530005-117530027 CTGAAAAAAAAGAAGGAATTAGG - Intergenic
1074962968 10:118464352-118464374 GAAAAAAAGAAAAAGGAGATGGG + Intergenic
1075368295 10:121912737-121912759 CAAAAAAAAAAAAAGGAATTAGG - Intronic
1075708417 10:124517106-124517128 CAAAAAAAGATGAAGGAGCCCGG + Intronic
1075886746 10:125906218-125906240 CAAAAAAAGAAGGAGCAGCTAGG + Intronic
1077348743 11:2078967-2078989 CCGAAAAAGAAGAAAAAGGTTGG - Intergenic
1077851554 11:6078390-6078412 TAGTAAAAGAAGCAGGAGTTTGG - Intergenic
1078536988 11:12183158-12183180 AAGAAAAAAAAAAAGGAGTCAGG - Intronic
1078596444 11:12691044-12691066 CATAAAAAGAGGAATGGGTTGGG - Intronic
1078684397 11:13514649-13514671 AAGAAAAAGAAGAATGAAGTTGG + Intergenic
1078815688 11:14820221-14820243 AAAAAAAAAAAGAATGAGTTGGG - Intronic
1079158095 11:17967633-17967655 GAGAAAAGCAAGAAGGAGTCAGG + Intronic
1079230412 11:18644567-18644589 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1079250685 11:18785146-18785168 TAGAAAAAGAACAGGGAGCTTGG - Intronic
1079640907 11:22804288-22804310 CAGAGAAAGAACAATGAGATAGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079800874 11:24867102-24867124 AAGAAAAAGAAGAAAGACTCTGG - Intronic
1080005339 11:27400322-27400344 CAAAAAAAGCAGGAGGAGTAGGG - Intronic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080434177 11:32224573-32224595 CAGAAAAAAAAAAAAGAGGTAGG - Intergenic
1080449054 11:32363726-32363748 AAAAAAAAAAAGAAGGATTTGGG + Intergenic
1080772956 11:35359790-35359812 CAGAGAAAGGAGTAAGAGTTGGG - Intronic
1080858586 11:36133522-36133544 AAGAAAAAGAAAACGGACTTGGG - Intronic
1080893856 11:36432713-36432735 CAGAAAAAAAAGAAAGGGTCCGG - Intronic
1081029574 11:38061701-38061723 CTGACAAAGCAGATGGAGTTGGG - Intergenic
1081262490 11:40977996-40978018 AAGAAGAATAAGAAGGAATTAGG - Intronic
1081338115 11:41892940-41892962 CAGAAAATGAAGATAGAGGTGGG - Intergenic
1081552010 11:44122057-44122079 CAGAAAAAGAATAAACAGGTGGG - Intronic
1081578295 11:44333594-44333616 CAGAAAAAAAATAAGGAGCAGGG - Intergenic
1082033625 11:47626006-47626028 CAAAAAAAAAAAAAGTAGTTGGG - Intronic
1082200737 11:49363614-49363636 CAGAAAAATAATGAGGAGTAAGG - Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083493428 11:63030060-63030082 AAGAAAAAAAAGAAAGAGTGTGG + Intergenic
1083950913 11:65955612-65955634 CAAAAAAAAAAAAAAGAGTTAGG + Intronic
1084772374 11:71352022-71352044 CAGGAAAAAAAGAGGCAGTTTGG - Intergenic
1085079541 11:73622776-73622798 AAAAAAAAGAAGGAGAAGTTTGG + Intergenic
1085165091 11:74392195-74392217 GAGGAAAAGAAGAGGCAGTTAGG + Intronic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1085502641 11:77037914-77037936 AAAAAAAAGAAGAAGGAGAAAGG + Intronic
1085570077 11:77551461-77551483 GAGAGAAAGAAGAAAGATTTGGG - Intronic
1085609756 11:77936378-77936400 AAAAAAAAGAAGAAAGAATTTGG - Intronic
1085615225 11:77992679-77992701 GATAAAAAGAATAAGGACTTTGG + Intronic
1085931520 11:81089061-81089083 GAGAAAATGAAGATGGAGTGAGG - Intergenic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086292871 11:85330805-85330827 AAAAAAAAGAAAAAGAAGTTGGG + Intronic
1086298120 11:85394816-85394838 CAGTAAATGAAGTAGGAATTAGG - Intronic
1086377854 11:86219376-86219398 AAGAAATAGAAGAAAGAGATGGG + Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086950882 11:92889158-92889180 CAGGAAAAGAAGTCGGAGGTAGG - Intronic
1087202729 11:95362248-95362270 GAGAGAAAGAAGGAGAAGTTAGG + Intergenic
1087297628 11:96395821-96395843 AAAAAAAAAAAGAAGAAGTTGGG + Intronic
1087581116 11:100055074-100055096 CAAAAAAACAAAAAGGATTTTGG + Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087779721 11:102289512-102289534 CAGAAAAAGAAGAAAGTTGTAGG + Intergenic
1087973609 11:104516604-104516626 AAGAAAAAGAAGATGGAGAAAGG - Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088190983 11:107228073-107228095 GAGAAAACTAAGGAGGAGTTTGG - Intergenic
1088266264 11:107990934-107990956 AAAAAAAAGAAGAAGAGGTTGGG - Intergenic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089782792 11:120885342-120885364 CAAGAAAAGAAGAGGAAGTTGGG + Intronic
1090283941 11:125482520-125482542 CAAAAAAAGAGGAGGGAGGTTGG + Intronic
1090349369 11:126097718-126097740 CGGAAAACGAGGAAGGAGCTGGG - Intergenic
1090491217 11:127162591-127162613 CAGAAAAACAAGAGGGGGTAGGG - Intergenic
1090502983 11:127279783-127279805 AAGAAAAAGAAGAAGAAGAAGGG - Intergenic
1090578103 11:128130837-128130859 AATGAAAAGCAGAAGGAGTTGGG - Intergenic
1090853752 11:130593756-130593778 GAGAAAATGAGGAAGGAGGTAGG + Intergenic
1091162692 11:133439432-133439454 CAAAAAAACAAAAAAGAGTTAGG - Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091183034 11:133624595-133624617 CAGAAAAAGATGGTGGAGTCTGG - Intergenic
1091868350 12:3862868-3862890 CTGAAAAAGAAGAACAAGTTTGG - Intronic
1092203532 12:6602036-6602058 AAGAAGAAGAAGAAGAAGCTTGG - Exonic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092731936 12:11542959-11542981 CAGGGAAAGAGGAGGGAGTTGGG - Intergenic
1092793613 12:12089909-12089931 CAGGAAAATAAGACGGATTTGGG + Intronic
1092819319 12:12338485-12338507 CAGAAAAATAGGTAGCAGTTGGG + Exonic
1092947395 12:13469596-13469618 CCGAAAAATACAAAGGAGTTGGG - Intergenic
1093024214 12:14232122-14232144 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1093622971 12:21313995-21314017 CAGAAAAAAAAGAAAGAAATTGG + Intronic
1093627919 12:21372042-21372064 AAGAAAAAGAAAAAGCAATTTGG + Intronic
1093896755 12:24583366-24583388 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095237728 12:39818273-39818295 CAGGAAAAAAAAAATGAGTTGGG + Intronic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095418138 12:41998184-41998206 CTGAGAAAGAAGGAGGAATTTGG - Intergenic
1095429646 12:42119427-42119449 CAGAAAGAGAAGAAAGAGAAAGG + Intronic
1095449901 12:42319431-42319453 CAGTGAAAGATGAAGGAGATGGG - Intronic
1095475662 12:42585027-42585049 CAGAAAAAAAAAAAAAAGTTAGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1095805487 12:46314772-46314794 AAGAAAGAAAAGAAAGAGTTAGG - Intergenic
1096097731 12:48947869-48947891 CAGACAATAAAGAGGGAGTTGGG + Intronic
1096576109 12:52553804-52553826 GAGAAAAGGAGGATGGAGTTGGG + Intergenic
1097097784 12:56563456-56563478 CAGATAAAGAAGGTGGAGATAGG + Intronic
1097163672 12:57069275-57069297 AAGGAAAACAAGAAAGAGTTTGG + Exonic
1097381596 12:58902034-58902056 AAGAAAAAGTGAAAGGAGTTAGG - Intronic
1097548324 12:61033069-61033091 CAGAAAAAGACGAATGAGAGAGG + Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1098053947 12:66483856-66483878 CAAAAAAAAAAAAAGAAGTTAGG - Intronic
1098231478 12:68375810-68375832 GAGAAAAAGATGAAGGAGTATGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098516326 12:71380469-71380491 CATAAAAAGAAGAGAGAGGTTGG - Intronic
1098822720 12:75253126-75253148 CAGAAAAAGAAAAGAGAGTGTGG - Intergenic
1098896581 12:76069586-76069608 CAGCTAAAGAAAAAGGAGTTAGG + Intronic
1098919795 12:76292994-76293016 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1098952094 12:76650244-76650266 AAGAAAATGAAGGAGGAGTGAGG - Intergenic
1099047650 12:77742508-77742530 AAAAAAAATAAGAAAGAGTTAGG + Intergenic
1099205448 12:79721385-79721407 CAGAAAAGGCAGAAGGGGCTAGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1100144048 12:91655341-91655363 CAGAAAAAAAAACAGGAGTTGGG - Intergenic
1100229984 12:92597195-92597217 CAGAAAGAGAATAATGATTTTGG - Intergenic
1100608617 12:96171940-96171962 CAAAAAAAAAAGAAGGAACTGGG - Intergenic
1100666875 12:96764325-96764347 CTGTAAAAGAGAAAGGAGTTGGG + Intronic
1100839412 12:98597036-98597058 CAAAAAAAGTAGTAGGAGTTGGG + Intronic
1101695537 12:107122306-107122328 GAGAAGAAGAGGAAGGAGGTTGG + Intergenic
1102158192 12:110747137-110747159 AAAAAAAAGAAGAAGAAGGTGGG + Intergenic
1102168433 12:110824338-110824360 AAGAAAGAGAGGAAGGAGGTAGG + Intergenic
1102215695 12:111160047-111160069 CAAAAAAAGCAAAAGGAGTTAGG + Intronic
1102377181 12:112432162-112432184 TAGACAAAGATGAAAGAGTTTGG + Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102706433 12:114884838-114884860 AAGAAATGGAAGAAGGCGTTAGG - Intergenic
1102731262 12:115112724-115112746 AAGAAAAGGCAGAAGGAGATTGG - Intergenic
1102749174 12:115277251-115277273 AAGAAAAAGAAGAAGGACGGGGG + Intergenic
1102808078 12:115799650-115799672 CAAAAAAAGAAGAAGAAGGGGGG + Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103129746 12:118457730-118457752 AAGAAAAAGGAGAAAGAATTTGG + Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103652621 12:122444619-122444641 CAGAAAAAGAAAAAGAAATGGGG - Intergenic
1103658921 12:122497846-122497868 CAGAAAAAAAAAAAGTAGCTGGG + Intronic
1103814484 12:123642871-123642893 CAAAAAAAGAAAAAAGAGTATGG - Intronic
1104463738 12:128974138-128974160 CAGAAAAGGAACTAGGAATTTGG - Intronic
1105056034 12:133099971-133099993 AAGAAAAAGAACAAGGAGAGTGG - Intronic
1105390021 13:19967150-19967172 TAAAAAAAGCAAAAGGAGTTAGG - Intronic
1105511811 13:21058373-21058395 CATAAACAGAGGAAGGATTTCGG - Intronic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1106452132 13:29892178-29892200 CAGAAGAAGAAAAGGGAGTTTGG + Intergenic
1107107350 13:36659186-36659208 AAGAAAAAGAAAAGTGAGTTTGG + Intergenic
1107391367 13:39967987-39968009 AAAAAAAGCAAGAAGGAGTTTGG - Intergenic
1107687729 13:42920874-42920896 CAAAGAAAAAAGGAGGAGTTTGG + Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108835044 13:54533966-54533988 CAGATAAGTAAGAAAGAGTTGGG + Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1108977826 13:56471167-56471189 AAGAAAAAGAAAAAAGAATTTGG + Intergenic
1108979205 13:56489414-56489436 CAGAAAAAAAAAAAGGAGAAAGG - Intergenic
1109272778 13:60272800-60272822 CAGTAAAAAAAGATGGGGTTGGG - Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109370322 13:61413955-61413977 CAGAAACAGATGCTGGAGTTGGG + Exonic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1110193579 13:72759802-72759824 AAGAAAAAGAAGATGAAGCTTGG - Exonic
1110298489 13:73898067-73898089 CTGAAGGAGAAGCAGGAGTTAGG - Intronic
1110628844 13:77682759-77682781 AAAAAAAAAAAGAATGAGTTAGG - Intergenic
1110978370 13:81867700-81867722 GAGAGAAAGAAGGAGGATTTGGG - Intergenic
1111512115 13:89279722-89279744 CAGAAATACAAGAAGGAGATTGG + Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112563947 13:100536596-100536618 CAGAGAGAAAAGAGGGAGTTAGG - Intronic
1112641308 13:101278536-101278558 AAAAAAAAAAAGAATGAGTTTGG + Intronic
1112735057 13:102407095-102407117 CAGAGAGAAAAGAAGGGGTTGGG - Intergenic
1112844680 13:103625549-103625571 CAGAGAAAGGAGAATGACTTTGG - Intergenic
1113045026 13:106146419-106146441 CAGAAAGAGCAGAAAGAGCTTGG - Intergenic
1113166290 13:107447235-107447257 AACAAAAAGAAGAAGGAGAAGGG - Intronic
1113196119 13:107808728-107808750 CAGTAAAAGAAAAGGCAGTTTGG + Intronic
1113476762 13:110588454-110588476 CAGAAAAAAATGAAGTACTTAGG + Intergenic
1114221567 14:20702098-20702120 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1115058243 14:29157098-29157120 GAGAACAAGAAGAAGGACTGTGG + Intergenic
1115108051 14:29784999-29785021 CAGTAAAAGGAGATGGAATTTGG - Intronic
1115275644 14:31605993-31606015 GAGAAAAGGAAGAAGGAGAAGGG - Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115551644 14:34510273-34510295 AAAAAAAAGAAGAAGAAGATTGG + Intergenic
1116131723 14:40862800-40862822 AAAAAAAAAAAGAATGAGTTAGG + Intergenic
1116611224 14:47074654-47074676 CAGCAAATGCAGCAGGAGTTTGG - Intronic
1116926000 14:50638196-50638218 CAGAAAAAGAAGGAACACTTAGG - Intronic
1117293334 14:54354534-54354556 GAGAAAAGGAAAAATGAGTTGGG - Intergenic
1117326305 14:54671989-54672011 CAGAAAAGGAAGCAGTAGATGGG - Intronic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117937349 14:60920993-60921015 CAGAAGAAGAAGAGAGACTTAGG - Intronic
1118070562 14:62242806-62242828 CAGAAAAAGAACTAGGACTTAGG + Intergenic
1118116780 14:62786918-62786940 CAGGAGAGGAAGAGGGAGTTGGG - Intronic
1118477806 14:66134719-66134741 TTGAGAAAGAAGAAGGAGTCAGG - Intergenic
1118492513 14:66274915-66274937 CAAGGAAAGAAGGAGGAGTTAGG + Intergenic
1118837785 14:69488697-69488719 TTGATAAAGAAGAAGGACTTGGG + Intronic
1119073928 14:71616609-71616631 CAGAAAAAGAAGCTAGAGTGTGG + Intronic
1119126402 14:72131159-72131181 CAGAATAAGATGATTGAGTTAGG - Intronic
1119415745 14:74468079-74468101 AAGAGAAAGAACAAGGAGTTTGG - Intergenic
1119722415 14:76900157-76900179 CAAAAGTAGAAGAAGGAGATGGG + Intergenic
1119851765 14:77871354-77871376 CAAAAAAAAAAGAAGAAGTTAGG - Intronic
1119938046 14:78611065-78611087 CAGGAAAGCAAGGAGGAGTTGGG - Intronic
1120133264 14:80832674-80832696 CAAGCAAAGGAGAAGGAGTTGGG + Intronic
1120242920 14:81971001-81971023 CTGAAAGAGTTGAAGGAGTTAGG - Intergenic
1120620635 14:86759781-86759803 AAAAAAAAGAAGAAGAAATTTGG - Intergenic
1121193419 14:92048891-92048913 GAGAGAAAGAAGAAAGATTTGGG + Exonic
1121289250 14:92761051-92761073 GAGAGAAAGAAGAAAGATTTAGG - Intergenic
1121391524 14:93580082-93580104 AAAAAGAAGAAGAAGGAGTTTGG - Intronic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122254793 14:100468862-100468884 GAGAAAGAGAGGAAGGAGCTCGG - Intronic
1122390331 14:101376449-101376471 AAGAAAAAAAATAAAGAGTTGGG + Intergenic
1122507520 14:102241162-102241184 GAGAGAAAGAAGAAAGATTTGGG - Intronic
1122513499 14:102289249-102289271 CAGAAAAAAAAAACAGAGTTAGG + Intronic
1122551178 14:102550860-102550882 CAAAAAAAGAAGAAGAAGAAAGG + Intergenic
1122662161 14:103303714-103303736 AAGAAGAAGAAGAAGCAGCTAGG + Intergenic
1122887797 14:104718270-104718292 CAGAAAGCGAAGAGGGCGTTGGG + Intronic
1123145242 14:106123340-106123362 CAGAAGATAAAGCAGGAGTTTGG + Intergenic
1123170131 14:106365092-106365114 GAGAAAAAGAAGGAGGGGATGGG - Intergenic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1202916328 14_GL000194v1_random:176368-176390 AACAAAAAAAAGAAGGGGTTGGG + Intergenic
1202871357 14_GL000225v1_random:167747-167769 CAAAAAAAGAAGGAGCAGCTAGG - Intergenic
1123574324 15:21651728-21651750 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1123610939 15:22094315-22094337 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1124044654 15:26137783-26137805 TAGAAAAAGATGAAGCAGTAAGG - Intergenic
1124382781 15:29180915-29180937 GAGAAAAAGAAAAAGGAATTTGG + Intronic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1125428521 15:39573626-39573648 AAGAAAAAGAGGAAGGAGAAAGG + Intergenic
1125433536 15:39622841-39622863 CAGAAAAATGAGCAGCAGTTGGG - Intronic
1125506618 15:40271246-40271268 CAGAAAGAGCAGAAGGGCTTGGG + Intronic
1125665713 15:41428568-41428590 CAAAAAAAAAAAAAGGAGTAGGG - Intronic
1125795697 15:42402613-42402635 CAGAAAAGGAAGAGGAAGTGAGG + Intronic
1125918984 15:43513336-43513358 AAAAAAAAGAAAAAGGAGCTAGG + Intronic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1126157550 15:45579326-45579348 CAAAAACAGAAGAAAGTGTTGGG - Intergenic
1126337235 15:47599461-47599483 CTCAAAAAGTAGATGGAGTTTGG + Intronic
1126421343 15:48476465-48476487 CAGAAGAAGACAAAGAAGTTGGG + Intronic
1126442058 15:48700006-48700028 AAGAAAAAAAAGAAGGGGTCGGG + Intergenic
1126493783 15:49267870-49267892 CATATAAAGAAGAATGAGATAGG + Intronic
1126804704 15:52335528-52335550 AAAAAAAAAAAAAAGGAGTTTGG + Intronic
1127207375 15:56734185-56734207 CAGAAGAACAAAGAGGAGTTAGG + Intronic
1127560398 15:60130677-60130699 CAGAAACAGAATAAGCAGTAGGG + Intergenic
1128667649 15:69550236-69550258 CAGAAAAAAAATAATGGGTTTGG + Intergenic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1128899340 15:71405679-71405701 CAGAAAAATAAGAGGGCATTTGG + Intronic
1129059950 15:72852907-72852929 AAAAAAAAGAAGAAGTAGTTGGG - Intergenic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1129602227 15:77006885-77006907 TTGAAAAAGAAGAATAAGTTTGG - Intronic
1129633647 15:77290546-77290568 AAAAAAAAGAAGAAGAAGCTGGG - Intronic
1130441384 15:83957495-83957517 GAGAGAATGAAGAAGCAGTTGGG + Intronic
1130560120 15:84951443-84951465 AAAAAAAAAAAGAAGGAGTCTGG + Intergenic
1130659110 15:85816007-85816029 CAGACAAAGAAAATGGAGTGTGG + Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130874544 15:88001777-88001799 CTGAAAAAGAAGAACAAATTTGG - Intronic
1131424628 15:92335422-92335444 CAGAAAAAGAAGAGAGAGGGAGG - Intergenic
1131434365 15:92411375-92411397 TTGAAAAGGAAGAGGGAGTTAGG + Intronic
1131821174 15:96275524-96275546 CAGAAAAAGAAGGAAGCGTGTGG - Intergenic
1132101981 15:99030097-99030119 GAGCAAAGGAACAAGGAGTTTGG + Intergenic
1202983188 15_KI270727v1_random:386071-386093 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1133194435 16:4158970-4158992 GAGAAAAAGAAGGTGGAGTTGGG + Intergenic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133368863 16:5232908-5232930 AAGAAGAAGAAGAAGGAAATGGG - Intergenic
1133669559 16:8005119-8005141 CAGAAATAAAAGATGGGGTTGGG - Intergenic
1133901554 16:9980110-9980132 CAGAAAAAGAAAAATTAGCTGGG + Intronic
1134033780 16:11013951-11013973 AAGAAGAAGAAGAAGAAATTTGG + Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134392261 16:13830837-13830859 AAAAAAAAAAAGAAGGAGGTTGG - Intergenic
1134915907 16:18070792-18070814 CTGAAAATCAAGAAGGAGATTGG - Intergenic
1135259545 16:20969066-20969088 CAGAGAAAGAAAAAGCAGATGGG - Intronic
1135936838 16:26787740-26787762 CAGACAAAGAAGCAGGACTCAGG + Intergenic
1136061461 16:27729514-27729536 GAGAAAAAGAAAAAGGACTTAGG - Intronic
1136102109 16:28003955-28003977 CAGAAAAAGAAGAGTCAGTGTGG + Intronic
1136247325 16:28983482-28983504 GAGAAAAGAAAGGAGGAGTTTGG - Intronic
1136753752 16:32665764-32665786 CAGAAACAGAATAAGCTGTTGGG + Intergenic
1136814360 16:33204601-33204623 CAGAAACAGAATAAGCTGTTGGG - Intronic
1136820836 16:33314681-33314703 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1136827399 16:33371220-33371242 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1136832465 16:33469991-33470013 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1137374701 16:47942644-47942666 AAGAAAAAGAAGAAGAAGAAAGG - Intergenic
1137393342 16:48099556-48099578 GAGGAAAAGAAAATGGAGTTTGG - Intronic
1137550565 16:49434730-49434752 AAGAAGAAGATGAAGGTGTTAGG + Intergenic
1137552228 16:49445493-49445515 CAGAAAAACAAGATAGAATTGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137644376 16:50061301-50061323 TAAAAAAAAAAAAAGGAGTTAGG - Intergenic
1137954808 16:52818485-52818507 AAAAAAAAGAAGAAGAAGATTGG + Intergenic
1138074529 16:54027851-54027873 CAAAAAAACAAGAGGGACTTAGG - Intronic
1138126131 16:54440161-54440183 AAGAAGAAGAAGAAGAAATTGGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138240684 16:55424837-55424859 GAGAAAGAGAAGGAGGAGTAGGG - Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138670689 16:58611900-58611922 GAGAAAAAGAAGTAGGTGTGAGG - Intronic
1138690395 16:58762430-58762452 CAGAAAAAGAAGAATGAAGTTGG - Intergenic
1139057900 16:63208503-63208525 CAGAAAAAGAAGAAAGAAAAAGG + Intergenic
1139731005 16:68945154-68945176 AAGAAGAAGAGGAAGAAGTTTGG + Intronic
1139935187 16:70565338-70565360 CAGAATAAGAAGCAAGAGTAAGG - Intronic
1140053665 16:71505573-71505595 CAGAAAACAAACAAGCAGTTGGG + Intronic
1140491087 16:75336458-75336480 CAGAAACAGAAAAGAGAGTTTGG + Intronic
1140819816 16:78652430-78652452 AAGAAAAAGAAAAAGGTGTTTGG + Intronic
1140857967 16:78994358-78994380 TAAAGAAAGAAGAAGGAGATAGG + Intronic
1141005782 16:80350377-80350399 CTCAAAAAAAAAAAGGAGTTGGG - Intergenic
1141019305 16:80479975-80479997 AAGAAAAAGAAGAGGGAGATTGG + Intergenic
1142336616 16:89493408-89493430 CTCAAAAAAAAAAAGGAGTTGGG + Intronic
1202992936 16_KI270728v1_random:27575-27597 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1142886705 17:2917255-2917277 AAAAAAAAGAAGAAGAAGTGGGG - Intronic
1143017595 17:3899195-3899217 AAAAAAAAGAAAAAGGAGTTGGG - Intronic
1143355205 17:6322754-6322776 AAAAAGAAGAAGAAGAAGTTAGG - Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143414500 17:6736115-6736137 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1143600914 17:7945344-7945366 AAGAAAAAGAAGAAAAAATTAGG + Intronic
1143674043 17:8417760-8417782 CATAAAGGGAAGAAGGATTTGGG - Intronic
1143718530 17:8793818-8793840 GAGAAAAAGAAGCGTGAGTTGGG - Intergenic
1144091041 17:11856705-11856727 CAGAAAAAAAAAAAGAACTTTGG + Intronic
1144291208 17:13828246-13828268 CAGAAGATGAAGTAGGAATTAGG - Intergenic
1144307927 17:13986189-13986211 CAGATAAAGAAAACTGAGTTAGG - Intergenic
1144320233 17:14110002-14110024 CAGAAAAAAAAGAACTATTTTGG + Intronic
1144428899 17:15172561-15172583 TAGAAAAAGAAAAAGAACTTGGG - Intergenic
1144712220 17:17409332-17409354 AAAAAAAAGAAGGAGGAGTCAGG - Intergenic
1145080777 17:19892603-19892625 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1145276156 17:21432249-21432271 CAGCAACAGATGAAGGAGTGGGG - Intergenic
1145314000 17:21718163-21718185 CAGCAACAGATGAAGGAGTGCGG - Intergenic
1145352119 17:22092006-22092028 CAAAAAATGATGAAGAAGTTTGG + Intergenic
1145712448 17:26990140-26990162 CAGCAACAGATGAAGGAGTGAGG - Intergenic
1145986533 17:29050839-29050861 AAGAAAAAGAAAAAAAAGTTTGG + Intronic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1146847955 17:36196458-36196480 AAGAAAAAGACCAAGGTGTTTGG + Intronic
1147219093 17:38918146-38918168 AAAAAAAAAAAGAGGGAGTTGGG + Intronic
1147323940 17:39661490-39661512 CAGAGAAAGATGACGGAGTGAGG - Intronic
1148166464 17:45487372-45487394 CAGGGAAAGATGCAGGAGTTGGG - Intronic
1148254842 17:46121171-46121193 CAAAAAAAAAAAAAAGAGTTAGG - Intronic
1148327410 17:46791210-46791232 CAGAAAAAAAAAAAAGAGTAAGG - Intronic
1148414813 17:47498259-47498281 CAAAAAAAAAAGAAAAAGTTGGG + Intergenic
1148446563 17:47741457-47741479 CAGGAAAAGTAGAGGAAGTTAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717336 17:49725104-49725126 AAGAAAAAGGAGAGGGAGATGGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148884296 17:50760329-50760351 CAGAAAAAGAAAAAAGGGTTGGG + Intergenic
1148972076 17:51492419-51492441 CAGAAAAATAAGCAGAGGTTTGG + Intergenic
1148972821 17:51499259-51499281 CAGAAAATGAAGAAAGACTATGG + Intergenic
1149130878 17:53300739-53300761 CTGAAAAAGAAAAATGAATTTGG + Intergenic
1149190946 17:54061011-54061033 CAGCCAGAGAAGAAGGAGTAAGG - Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149319410 17:55469026-55469048 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1149584595 17:57777208-57777230 TAGAAAAAAAAGAAAGAGTCCGG + Intergenic
1149631549 17:58129378-58129400 CAGGCAAGGAAGAAGGAATTAGG - Intergenic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150282804 17:63939183-63939205 AAGAAAAAGAAGAGGCACTTAGG + Exonic
1150397633 17:64833772-64833794 CAGGGAAAGATGCAGGAGTTGGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150608205 17:66712514-66712536 AAAAATAAGAAGAAAGAGTTAGG + Intronic
1150766937 17:68009890-68009912 AAAAAAAAGAAGAAGAAGGTGGG - Intergenic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150860603 17:68796768-68796790 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151449157 17:74187119-74187141 TAAAAAAAGAAGAAGAACTTAGG + Intergenic
1151546219 17:74794838-74794860 CAGAAAAAGAAATAGGACTTTGG + Intronic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153443507 18:5147201-5147223 CAGAAGGAAAAGAAGGAGCTTGG + Intronic
1154991892 18:21605365-21605387 CAGAAAAGGAACAAGGAAATGGG - Intergenic
1155698264 18:28710698-28710720 CAGAAGAAGTACAAGGATTTAGG + Intergenic
1155843324 18:30673166-30673188 AAGAGAGAGAAGAAAGAGTTTGG + Intergenic
1155947254 18:31868994-31869016 CAAAAAAAAAAAAAGGATTTTGG - Intronic
1155961839 18:32001813-32001835 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1156028376 18:32684015-32684037 TAGAAAAAGAAAAAGCAGTTTGG - Intronic
1156033067 18:32735575-32735597 CTGAAGGATAAGAAGGAGTTAGG - Intronic
1156739334 18:40304963-40304985 CAGAGAAAGAAGCAGAGGTTAGG + Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157484694 18:48078520-48078542 CAGCATAAGAAGAGTGAGTTGGG + Intronic
1157984197 18:52418822-52418844 AAGAAAAAGAAAAAGGATCTCGG - Intronic
1158151689 18:54381188-54381210 CAAAAAAAGAAAAAGGAAATGGG - Exonic
1158285802 18:55881123-55881145 CAGATAAATAAAAAGGAGTTTGG + Intergenic
1158289015 18:55917828-55917850 CAGACAGAAAAGAAGGAATTTGG + Intergenic
1158377455 18:56887084-56887106 TAGAAAAAGAGGAAAGAATTAGG + Intronic
1158576811 18:58645135-58645157 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1159072156 18:63637311-63637333 TAGAAACATAAGAAGGATTTAGG + Exonic
1159073625 18:63655249-63655271 TAGAAACATAAGAAGGATTTAGG + Exonic
1159596563 18:70388191-70388213 AAAAAAAAGAAGAAGAAGTATGG - Intergenic
1159718210 18:71851297-71851319 CAGAAAAATAAAATGGAGATGGG - Intergenic
1159779180 18:72641810-72641832 CAAAAAAAAAAAAAAGAGTTTGG - Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159885583 18:73901263-73901285 AAGAAAAAGCAAAAGGAGCTTGG - Intergenic
1159929110 18:74294014-74294036 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1161084132 19:2326294-2326316 CACAAAAAGCAGAAAGGGTTTGG - Intronic
1161308607 19:3581106-3581128 AAGAAGAAGAAGAAGCAGTGTGG - Intergenic
1161364756 19:3871984-3872006 AAAAAAAAGAAGAAGAAGATGGG + Intergenic
1161711925 19:5853638-5853660 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162585589 19:11556296-11556318 CAAAAAAAAAAGAAAGAGTTGGG - Intronic
1163427780 19:17248455-17248477 CAGAAACAGAACAAGAAGTATGG - Intronic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1164080689 19:21859314-21859336 GAGAGAAAGAAGAAAGATTTCGG - Intergenic
1164258656 19:23550794-23550816 GAGAGAAAGAAGAAAGATTTGGG - Intronic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164858646 19:31545021-31545043 GAGAAAGAGAAGAAGGAGGAGGG - Intergenic
1165759567 19:38312945-38312967 AAAAAAAAGAAGAAGAAGTAGGG - Intronic
1165794338 19:38510302-38510324 CAAGAAAAAAAAAAGGAGTTGGG + Intronic
1165982727 19:39738229-39738251 CAGATAAAGACGATGGAGTGAGG + Intergenic
1165983365 19:39745833-39745855 GAGAAAAAGAGGAAGCAGTAAGG - Intergenic
1166099719 19:40564674-40564696 CAGAAAATGAAAAATTAGTTGGG + Intronic
1166602428 19:44109417-44109439 CAGGAAGAGAAAATGGAGTTTGG + Exonic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1166845281 19:45723652-45723674 AAAAAAAAGAAGAATTAGTTGGG - Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167345916 19:48945654-48945676 CAAAAAAAAAAGAATGATTTTGG + Intergenic
1167504773 19:49865430-49865452 CAGAAAGAGAGGGAGGAGCTGGG + Intronic
1167539090 19:50074086-50074108 AAGAAGAAGAAGAAGAAGCTGGG + Intergenic
1167791955 19:51688761-51688783 CAGAGAAAGAGGATGGAGATAGG + Intergenic
1168058251 19:53875546-53875568 AAAAAAAAAAAGAAGGAGTCGGG + Exonic
924960286 2:28687-28709 GACAAAAAGAAAAAGGCGTTTGG + Intergenic
925433960 2:3820057-3820079 GAGAGAAAGAAGAAAGATTTGGG + Intronic
925451162 2:3970113-3970135 TAGAAAAAGAAGATGAATTTAGG + Intergenic
925621852 2:5801765-5801787 CAGAAAAAGATGGTGAAGTTAGG + Intergenic
925644593 2:6022733-6022755 CAAAAAAATAAAAAAGAGTTTGG + Intergenic
925928913 2:8691962-8691984 CAGAAAAAGAAAAAGGGAGTAGG + Intergenic
926307091 2:11645758-11645780 AAAAAAAAAAAGAATGAGTTTGG - Intergenic
926604740 2:14886199-14886221 CAGAAAGAGAGGCAGGAATTAGG - Intergenic
926715865 2:15922990-15923012 AAGAAAAAAAAGAAGGTGTCAGG - Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
927292828 2:21421467-21421489 AGGAAGAAGAAGAAGGAGCTTGG + Intergenic
927399211 2:22691270-22691292 CAGAAAAAGAAGAAAAAGGGAGG + Intergenic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG + Intronic
927861866 2:26565088-26565110 TAAAAAAAGAAGAAGGGGTAGGG - Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928476414 2:31631856-31631878 CAGAATCAGAACAAGGAGATTGG + Intergenic
928490241 2:31776248-31776270 CTGAAAAAGAAGAACAAATTTGG + Intergenic
928530602 2:32187018-32187040 AAGAAAAAGAAAAATGAGTTCGG + Intronic
928646837 2:33363350-33363372 GAGAAATACAAAAAGGAGTTAGG - Intronic
929113890 2:38428342-38428364 AAAAAATAGAAGAAGGAGATAGG - Intergenic
929158073 2:38805705-38805727 CAGAAAGAGAAGAGTGAATTGGG + Intronic
929374080 2:41262952-41262974 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
929381228 2:41356572-41356594 CACAAACAGAAGATGAAGTTTGG + Intergenic
929460531 2:42099675-42099697 GAGAGAAAGAGGAAGGAATTGGG - Intergenic
929567330 2:42997742-42997764 AAGAAGAAGAAGAAGAAGATTGG - Intergenic
929684644 2:44023213-44023235 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
929829484 2:45335471-45335493 CAGAAAGAGAAGACAGAGCTGGG + Intergenic
930063659 2:47311178-47311200 CCGACAAACAAGGAGGAGTTGGG - Intergenic
930188790 2:48436844-48436866 CAGAAAAACAGGAAGAAATTAGG - Intergenic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
930807553 2:55506505-55506527 AAAAAAAAAAAGAAGGATTTTGG - Intergenic
931693245 2:64852962-64852984 AAGAAAAAGAGGAAGGAGAGGGG + Intergenic
931746921 2:65298946-65298968 CAAAAAAAGAAAAAGAAGCTGGG - Intergenic
931860046 2:66345551-66345573 AAGTAACAGAAGATGGAGTTGGG + Intergenic
931862418 2:66369999-66370021 AAGAAAAAGAAGAAATAATTAGG - Intergenic
932214758 2:69959439-69959461 CAGAAAAAGAAACAGAAATTTGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932425880 2:71634882-71634904 CAGGAAAACTAGAAGGATTTGGG - Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932664937 2:73689620-73689642 CATAAAGAGAAGAATCAGTTGGG - Intergenic
932674627 2:73768654-73768676 CTTAAAAAGAATAAGGAGTCTGG + Intronic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
932814309 2:74849577-74849599 CAGAAAGAGAAGGAATAGTTTGG + Intronic
933106191 2:78328527-78328549 CATCAAAAGAATAAGGAATTTGG - Intergenic
933137825 2:78759430-78759452 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
933263297 2:80153575-80153597 CAGGAAAAGAAGGAGCAGTGAGG - Intronic
933287436 2:80399719-80399741 TAAAAATAGAAGAAGGTGTTGGG - Intronic
933445097 2:82369742-82369764 CAGAGAAAGAAGTAGAGGTTAGG + Intergenic
933661722 2:84933050-84933072 AATAAAAAGAAGAAGAAGTAGGG + Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933844250 2:86312637-86312659 CAAAAAAAGAAAAAAGAGCTGGG + Intronic
934093301 2:88574163-88574185 CAGAAAAAGAAGCAAAAGTGTGG + Intronic
934175698 2:89578532-89578554 AAGAAAAAGAAAAAGAGGTTGGG + Intergenic
934286014 2:91652896-91652918 AAGAAAAAGAAAAAGAGGTTGGG + Intergenic
935114594 2:100124520-100124542 CAGAAAAACAAGACTGAGATAGG + Intronic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
935505604 2:103898381-103898403 AAGAGAAAGAAGGAGGAGTCTGG + Intergenic
935578258 2:104733363-104733385 CAGGTCAAGAAGAAGGTGTTGGG + Intergenic
935778804 2:106494148-106494170 CAAAAAAAAAAAAAGGTGTTGGG - Intergenic
935937296 2:108200578-108200600 AAGAAAAAGAAAAATCAGTTAGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
936870684 2:117131848-117131870 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
937164392 2:119797869-119797891 CAAAAAAAGAAGAAGCGCTTAGG - Intronic
937269106 2:120636518-120636540 CAGAAAAAGAACAAAGATTATGG - Intergenic
937403515 2:121606760-121606782 CACAAAAAGAGAAAGGAGGTGGG + Intronic
937408453 2:121651678-121651700 CACAAGGAGAACAAGGAGTTTGG - Intergenic
937629990 2:124090680-124090702 TAAAAAAAGAAGAAGGAAGTAGG + Intronic
937768812 2:125694930-125694952 CAGGGAGAGAAGAAGGAGTGAGG + Intergenic
938064703 2:128274976-128274998 AAAAAAAAAAAAAAGGAGTTGGG + Intronic
938396857 2:130957237-130957259 AAAAAAAAAAAGAATGAGTTGGG - Intronic
938784561 2:134614024-134614046 CAGAGAAAGAAGAAAAAGGTAGG + Intronic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
939160674 2:138584783-138584805 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
939172256 2:138709693-138709715 CAGTAAAAGAATTAGGGGTTGGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939588804 2:144037768-144037790 CAGAAAAAGAAAACGGACTCTGG + Intronic
939717939 2:145609266-145609288 AAGAAAAGGAAGAAGGTTTTGGG - Intergenic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940182831 2:150954587-150954609 AAGAGAAAGAAGAAAGATTTGGG - Intergenic
940216701 2:151310366-151310388 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
940983896 2:160033786-160033808 CAGAAAATTAAGACTGAGTTTGG + Intronic
941542113 2:166799800-166799822 CAGATAAAGAAGAGGGATTGTGG - Intergenic
941865615 2:170331388-170331410 GAGAAAAACAAGAAGGACATTGG + Intronic
941874155 2:170416615-170416637 AAAAAAAAAAAAAAGGAGTTTGG - Intronic
942220814 2:173767366-173767388 AAGAGCAAGAAGCAGGAGTTGGG + Intergenic
942332067 2:174836936-174836958 CTAAAAATGAAGAAAGAGTTGGG + Intronic
942367341 2:175241349-175241371 CAAAAAAAGAAGTAGAAGTGGGG - Intergenic
942471102 2:176261312-176261334 AAGAAAAAGAAAAAGGAAGTTGG + Intergenic
942588174 2:177509671-177509693 AAAAAAAAAAAGAAGCAGTTTGG + Intronic
942718022 2:178916596-178916618 CAAAAATAGAAGCTGGAGTTTGG - Intronic
942825117 2:180166595-180166617 CAGAAAAAAAGGAAGGAATATGG - Intergenic
942969226 2:181937707-181937729 AAGAAAAAGAAGAGGCACTTAGG + Intergenic
943020420 2:182565943-182565965 AAGAAAAAGAAGAAAGAGACAGG + Intergenic
943293836 2:186111839-186111861 TAGAAAAAGAAGAATAAGCTAGG - Intergenic
943394015 2:187309915-187309937 GAGTAAAAGAAGGAGGAGATAGG - Intergenic
943460288 2:188165026-188165048 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
943573524 2:189602818-189602840 CCTTTAAAGAAGAAGGAGTTGGG + Intergenic
943619982 2:190138603-190138625 CAGATAAATAGGAATGAGTTAGG - Intronic
943709737 2:191077812-191077834 AAGAGAAAAAAGAAAGAGTTTGG - Intronic
943731717 2:191309188-191309210 GAGAAAGAGAAGAGGGAGTGGGG - Intronic
944071119 2:195670223-195670245 CAAAAAAAAAAAAAGGAATTAGG - Intronic
944469081 2:200033625-200033647 CGGAGAAAGAACAGGGAGTTTGG - Intergenic
944563035 2:200960773-200960795 GAAAAAAAAAAGAAGAAGTTAGG - Intronic
944574482 2:201078306-201078328 AATAAGAAGAAGAAGAAGTTAGG + Intronic
944740697 2:202609369-202609391 CAGAATAAGAAGGGGAAGTTTGG + Intergenic
944784507 2:203054567-203054589 AAGAAAAAGAAAAAGAGGTTGGG - Intronic
944984895 2:205165189-205165211 CAGAAAATCAGGAAGGAGATAGG + Intronic
945057815 2:205883707-205883729 AAAAAAAAAAAAAAGGAGTTAGG - Intergenic
945243607 2:207698543-207698565 AAGAAGAAGAAGAGGAAGTTTGG - Intergenic
945253733 2:207786392-207786414 CAGAAAAAAAAAAAGGAGCATGG + Intergenic
945393518 2:209294350-209294372 CAGAAAATCAAAAAGGAGTATGG + Intergenic
945554589 2:211263037-211263059 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
945559216 2:211317440-211317462 AACAAAAAAAAGAAGGAGATGGG - Intergenic
945629998 2:212262649-212262671 TAAAAGAAGAAGAAGGAGTAAGG + Intronic
945752626 2:213807225-213807247 AAGAAAAACATGAAGGAGTATGG - Intronic
945794910 2:214350580-214350602 AAGAAAAAGAAGCCTGAGTTGGG + Intronic
946064692 2:216976406-216976428 AAAAAAAAGAAAAAGGGGTTGGG - Intergenic
946237354 2:218332365-218332387 CAGAAAGAGAAGAAGCAGGATGG + Intronic
946299373 2:218813190-218813212 CAGAAAAAGAAGCAGGTCCTTGG - Intronic
946348084 2:219127361-219127383 CAGAGAAAGAGGGAGGAGTAAGG - Intronic
946439285 2:219681442-219681464 AAGGAAAATAAGAAGGAGATAGG - Intergenic
946523066 2:220487530-220487552 AAGAAAAAAGAGAAGTAGTTAGG - Intergenic
946622578 2:221574491-221574513 CAGAAAAAGAAGACGAATATTGG + Intergenic
946687181 2:222282104-222282126 CAGAAATAGGAGAACAAGTTAGG - Intronic
946714858 2:222542795-222542817 AAGGAAAAGAAAAAGAAGTTTGG - Intronic
947007817 2:225532606-225532628 TAGTGCAAGAAGAAGGAGTTTGG - Intronic
947403267 2:229749752-229749774 AAAAAAAAGAAGAAGAAGATAGG + Intergenic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947879143 2:233489959-233489981 CAGAATTAGAACAAGCAGTTTGG - Intronic
947919694 2:233858776-233858798 AAAAAAAAAAAGAATGAGTTTGG - Intergenic
947977910 2:234383738-234383760 CAGAAAAACAACAAAGACTTAGG + Intergenic
948758631 2:240175278-240175300 TAGAAAAAGAAGAATGAAATCGG - Intergenic
948819470 2:240532510-240532532 CAGAAACACAAGAAGGAGTAAGG + Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1168745220 20:233486-233508 AAGAAAAAGAGAAAGGAGGTTGG + Intergenic
1169705583 20:8500683-8500705 AAAATAAAGAAGAAAGAGTTTGG - Intronic
1170122317 20:12924563-12924585 AAGATAAGGAAGAAGGGGTTGGG + Intergenic
1170491733 20:16883967-16883989 CACAAAAAGAAGAAAGAGAAAGG - Intergenic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170680552 20:18521784-18521806 GAGAGAAAGAAGAAAGATTTGGG + Intronic
1170698028 20:18677758-18677780 GAGAAAAATAAGAGGGAATTCGG - Intronic
1170805051 20:19622201-19622223 CAGAAAAAGAAACTGGAGCTGGG + Intronic
1170848188 20:19980205-19980227 GAGAAAAAGAAGAAAGATTGTGG + Intronic
1171095917 20:22332181-22332203 GAGAAAAAAAAGAAGGACTGAGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171453894 20:25255729-25255751 CAAAAAAAAAAAAAAGAGTTGGG - Intronic
1171469000 20:25354921-25354943 CAGAAAGAGAAGAAAGAGATAGG - Intronic
1171979531 20:31617787-31617809 AAAAAAAAAAAGAAGGAGATGGG - Intergenic
1172201334 20:33128529-33128551 CAAAAAAAAAAGAATGACTTTGG - Intergenic
1172416236 20:34770627-34770649 CAAAAAAAAAAAAAGAAGTTTGG - Intronic
1172643162 20:36453972-36453994 AAGAAAAAGAAAAAAGAGTCCGG + Intronic
1172848084 20:37941887-37941909 AAAAAAAAAAAAAAGGAGTTGGG - Intronic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1172951779 20:38727076-38727098 CAGGAACAGAATGAGGAGTTGGG - Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1173005219 20:39135051-39135073 AAAAAAAAGAAGAAGTAGTATGG - Intergenic
1173163916 20:40672617-40672639 AAGAAAAAGAAGAAGAAGGTGGG + Intergenic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173531844 20:43775695-43775717 CAGAAACAGTACATGGAGTTTGG + Intergenic
1173587491 20:44193837-44193859 GAGAAAAAGAATTAGGAGATAGG - Intergenic
1173764730 20:45597082-45597104 AAAAAAAAAAAGAAGGAATTGGG - Intergenic
1174008895 20:47433031-47433053 GAGAAAGAGAAGAGGGAGTGAGG + Intergenic
1174370814 20:50086150-50086172 GAGTAAAAGAAGAGGCAGTTAGG - Intronic
1174536849 20:51257932-51257954 CAGAAAAAAAAGAAAGTGCTAGG + Intergenic
1175179944 20:57138939-57138961 CAAAAAAAAAAAAAAGAGTTGGG - Intergenic
1175338078 20:58209472-58209494 AAGAAAAGCAAGAAGGAATTAGG - Intergenic
1175768701 20:61609023-61609045 CAGGAAAAGATGGAGGAGCTGGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176635681 21:9191014-9191036 AACAAAAAAAAGAAGGGGTTGGG + Intergenic
1176648889 21:9528353-9528375 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1177123132 21:17163455-17163477 AAGAAGAAGAAGAAATAGTTTGG + Intergenic
1177181008 21:17744955-17744977 AAAAAAAAAAAAAAGGAGTTCGG + Intergenic
1177382845 21:20367973-20367995 GAGAAAAATAAGAAAAAGTTAGG - Intergenic
1177899274 21:26893870-26893892 AAGTAAAGGAGGAAGGAGTTGGG - Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178428905 21:32502098-32502120 AAGAAAAAGAAGAAAAAGTAAGG - Intronic
1178456924 21:32763660-32763682 CAGAAAAGTAAAAAGGAGTGTGG + Intronic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1178587036 21:33879350-33879372 CAGAAAAAAAAGAAAGATTGAGG + Intronic
1179288671 21:39999458-39999480 CAGAGAAAGATGAAGGAAATTGG + Intergenic
1179316660 21:40249834-40249856 CAAAGAAGGATGAAGGAGTTAGG + Intronic
1179348000 21:40579309-40579331 CAGAAGAAAAAGAAGCAGTGAGG + Intronic
1180371251 22:12039292-12039314 AATAAAAATAAGAAGGAGGTTGG + Intergenic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1180591444 22:16941026-16941048 CAGAAAAAGATGAAAAAGTGAGG - Intergenic
1180604788 22:17049687-17049709 CTGAAAAAGAAGAACAAGATTGG + Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1180924302 22:19543297-19543319 CTGCAAAAGAAAAAGAAGTTTGG - Intergenic
1181319939 22:21996660-21996682 CAGAAAAAAAAGAGGAATTTGGG - Intergenic
1181389236 22:22567631-22567653 AAGAAAAAGAAAAAGAAGGTGGG - Intergenic
1181574653 22:23786173-23786195 CAAAAAAAAAAAAAAGAGTTGGG + Intergenic
1181735713 22:24879918-24879940 CAGAAAGAGCAGAAAGAGTAAGG + Intronic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182230915 22:28836950-28836972 AAGAAAATAAAGATGGAGTTGGG - Intergenic
1182505053 22:30776090-30776112 AAGAAAAAGAAAAATGAGTCTGG - Intronic
1183127018 22:35792363-35792385 AAGAAAAAGAAAAAGAAATTAGG + Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184057004 22:42059412-42059434 AAGGAAAAGAAGTAGGGGTTGGG + Exonic
1184801749 22:46765154-46765176 CAGAAGAAGAAGGAGAGGTTGGG + Intronic
1184963842 22:47951967-47951989 CAGAAAAACATGAAGAGGTTAGG + Intergenic
1185207138 22:49546389-49546411 CAGAAAAAGAAGTATGTGTGTGG - Intronic
1185230835 22:49680506-49680528 CTAAAAAAGAAGAAGGAAGTTGG - Intergenic
949126286 3:448534-448556 CACAAAAGGAAGATGGAGATAGG + Intergenic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
950334332 3:12181717-12181739 AAGAAAAAGATGAAAGAATTAGG + Intronic
950577265 3:13839699-13839721 GAGAAAAAGAAGGAGGAATTTGG - Intronic
951051956 3:18103819-18103841 CATAGAAAGAAAAAGGAGTAGGG - Intronic
951298920 3:20971675-20971697 GAGAGAAAGAAGGAGGATTTGGG + Intergenic
951367913 3:21806980-21807002 CAGAAAAATAAGAGGGAAGTTGG - Intronic
951398526 3:22201522-22201544 CAGAAAAAAAGAAAGAAGTTAGG + Intronic
951531674 3:23704118-23704140 CAAAAAAAGAACAAGGAGCTTGG + Intergenic
951618554 3:24575667-24575689 CAGGAAAAGAAAAAGGAGATTGG + Intergenic
951894758 3:27600271-27600293 AAGAGAAAGAAGAAAGATTTGGG - Intergenic
952009729 3:28886688-28886710 AAGAAAAAAAGGAAGGAGTGAGG - Intergenic
952314899 3:32224091-32224113 CAAGAAAAGAAAAAGGAGTGGGG + Intergenic
952992064 3:38839326-38839348 CAGAAAAAGAAGAAAAAAGTTGG - Intergenic
952993330 3:38852621-38852643 CAGTAATAGAACAAGGGGTTTGG - Intronic
953066618 3:39478558-39478580 AAGAAACAGAGGTAGGAGTTAGG - Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953306127 3:41831314-41831336 CATAAAAAGAAGAGGGAGCAGGG + Intronic
953309105 3:41859639-41859661 CAAACAAAAAAGAAGGAATTTGG - Intronic
953546481 3:43867332-43867354 CACATAAAGAAGAAGGAATGGGG - Intergenic
953599552 3:44349175-44349197 GAGAGAAAGAAGAAAGATTTGGG + Intronic
953834572 3:46331583-46331605 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
954161908 3:48728881-48728903 GAGAAAAAGAAGAAAGATTTGGG + Intronic
954365316 3:50142953-50142975 AAGAAAAAGAAAAAGAAGTGTGG - Intergenic
954462343 3:50634477-50634499 AAAAAAAAGAAGAAGAAGATAGG - Intronic
954549706 3:51471178-51471200 AAAAAAAAAAAGAATGAGTTTGG - Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955523389 3:59796519-59796541 CAGAAAAACAAGACAGAGTAAGG - Intronic
955599960 3:60634699-60634721 GAGAAAGAGGAGAAGAAGTTTGG + Intronic
955977403 3:64491669-64491691 CAGGGGAAGAAGAGGGAGTTGGG - Intergenic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956090840 3:65665282-65665304 CAGAAAAAGAAAACGGAAATTGG + Intronic
956274634 3:67484740-67484762 ATGAAAAAGAAAAAGGAGATAGG + Intronic
956304227 3:67806089-67806111 CAGAAAAAGAAGGAAGAGAAAGG - Intergenic
956364431 3:68484597-68484619 CAGAAGCAGAATGAGGAGTTTGG + Intronic
956428801 3:69164132-69164154 CAAAACAATAAAAAGGAGTTGGG - Intergenic
956525173 3:70151210-70151232 AAGAAAAAGGGGAAGAAGTTGGG + Intergenic
956572942 3:70717267-70717289 CAGAAACAGAGGAATGATTTAGG + Intergenic
956671284 3:71693396-71693418 GAGAACAAGACGAAGGGGTTAGG + Intronic
956960387 3:74392399-74392421 AAGAAAAAGAAGAAGCAGGGTGG - Intronic
957205273 3:77190044-77190066 ATGAAAAAGAGGAAGTAGTTTGG + Intronic
957230645 3:77509921-77509943 CAGCATAAGCAGAAGTAGTTGGG + Intronic
957290797 3:78275994-78276016 CAGAAAAAAAAAAAGGTGTGGGG + Intergenic
957589915 3:82182971-82182993 CAGTAAAAGAATAAAGAGTGAGG - Intergenic
957690117 3:83556085-83556107 AAAAAAAAAAAGAAGCAGTTTGG + Intergenic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958103239 3:89040871-89040893 CAGCAAAAGAAAAAATAGTTTGG + Intergenic
958133027 3:89454103-89454125 CAGGAAAAGAGAATGGAGTTTGG + Intronic
958579603 3:96000999-96001021 AAGAAAAGGAAGAATCAGTTAGG + Intergenic
958725563 3:97901747-97901769 TAAAAAAAGAACAAGGAGGTAGG - Intronic
958874104 3:99596140-99596162 CAGAAAAAGAAAAAAAAATTAGG - Intergenic
959166965 3:102792512-102792534 AAGAAAAAGAAGGAGGAGTGAGG + Intergenic
959468921 3:106724516-106724538 CAAAAAAATAAAAAGAAGTTTGG - Intergenic
959543816 3:107570823-107570845 GAGAGAAAGAAGAAGGATTTGGG + Intronic
959791580 3:110368092-110368114 AAGAAAAAGATGATGGAGGTGGG - Intergenic
959794775 3:110412679-110412701 CAGACAAATAAAAAAGAGTTGGG + Intergenic
959825222 3:110786341-110786363 CAGAAAAAGAACAAAGTGGTAGG - Intergenic
959832351 3:110879752-110879774 CAGAAAAAGAATATGGCTTTTGG + Intergenic
961056486 3:123793373-123793395 CAGAAAAAGAAGACGCGGTCCGG - Intronic
961068704 3:123899787-123899809 CAGAAAAAAGATCAGGAGTTTGG - Intronic
961712878 3:128840710-128840732 CAGAGAAAGAAGAAAGATTTGGG + Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961972771 3:130987995-130988017 CAGAAAAAGAAGAATGAAAGAGG - Intronic
962381626 3:134902980-134903002 CAGATAATGAACATGGAGTTAGG + Intronic
962445801 3:135463451-135463473 AAGAAAAAGAAGAGAGAGTGAGG + Intergenic
962509264 3:136082605-136082627 CAGATGTAGGAGAAGGAGTTTGG + Intronic
962775927 3:138659516-138659538 CAGAAAAAAAAAAAAAAGTTTGG + Intronic
962815028 3:138989726-138989748 CAGAAAAAAAAAAAAAAGTTGGG - Intergenic
963093253 3:141506931-141506953 AAGAAAAAGAAAAAAGAATTTGG + Intronic
963354170 3:144189381-144189403 TAGGGAAAGAAGAAAGAGTTTGG - Intergenic
963693899 3:148540586-148540608 CAGAAAATGGAGCTGGAGTTGGG + Intergenic
964201995 3:154128241-154128263 AAAAAAAAGAAGAAGAAGATGGG - Intronic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
964466489 3:156998825-156998847 AAGAAAAAGATGAAGGAGAGAGG - Intronic
964909253 3:161758072-161758094 GAGAAAGAGAAGAAGGTGGTTGG + Intergenic
965264517 3:166523719-166523741 CAGAAAAGGATGAGGGATTTGGG + Intergenic
965297063 3:166961106-166961128 CAGACAAAAAAGATGGAATTTGG - Intergenic
965437036 3:168665255-168665277 CAGAAAAAGCAGAAGATATTAGG + Intergenic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966159065 3:176949074-176949096 TAGAAGAAGAGAAAGGAGTTTGG - Intergenic
966169028 3:177056741-177056763 CCGAGAGAGAAGAGGGAGTTAGG - Intronic
966398555 3:179525088-179525110 GAGAGAAAGAAGAAGGATATCGG + Intergenic
966480817 3:180406448-180406470 CAAAAGGAGAAGAAGGAGATGGG + Intergenic
966503915 3:180678138-180678160 CAAAAAAAGAAGCAGGATTAGGG + Intronic
966570362 3:181435189-181435211 CAGGGAGAGAAGAAGTAGTTTGG - Intergenic
966770409 3:183498981-183499003 CAGAAAAAGAAGAGGGAAAGTGG - Intronic
966844811 3:184120330-184120352 CAAAAAAAGAAGAAGAAGAAAGG + Intergenic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
967005477 3:185378699-185378721 GAGAGAAAGAAGAAAGATTTGGG + Intronic
968193926 3:196691387-196691409 GATAAAAAGAATAAGGAGGTGGG - Intronic
968282827 3:197490058-197490080 CAGAAAAAGTAGAGGGAGCTGGG - Intergenic
968413424 4:408024-408046 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
968685564 4:1956032-1956054 CAGAAAATGAAGCACGAGATTGG + Exonic
969137296 4:5040288-5040310 CTGAAAAAAATGAAGGAGTTGGG - Intergenic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
969915697 4:10489661-10489683 CAAAAAAAAAAAAAGGTGTTGGG - Exonic
970147757 4:13054732-13054754 CAGGGCAAGAAGAATGAGTTTGG - Intergenic
970365355 4:15352772-15352794 CAGGGAAGGAGGAAGGAGTTAGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970473305 4:16397927-16397949 CAGAATTAGAAGAACAAGTTTGG + Intergenic
970593592 4:17579670-17579692 CAAAAAAAGAAGCAGGTGCTGGG - Intronic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
970826182 4:20278880-20278902 CAGAAGAAGAATAAGTATTTAGG + Intronic
970838052 4:20434493-20434515 AAGAAAAAGAAGAAGAAAATGGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971100323 4:23459313-23459335 CAGAAAAAAAAGAAAGATTTGGG - Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971644817 4:29185386-29185408 AAAAAGAAGAAAAAGGAGTTGGG - Intergenic
972037176 4:34539618-34539640 CACAAAGAGAAGGAGGAGGTGGG - Intergenic
972185881 4:36527778-36527800 ATGAGAAAGAGGAAGGAGTTAGG - Intergenic
972289641 4:37679346-37679368 CAGAAAAAGAAGTACAACTTTGG - Intronic
972466690 4:39364095-39364117 AAAAAAAAGAAGAAGAAGATAGG + Intronic
972675274 4:41254535-41254557 AAGAAGAAGAAGAAGAAGTAGGG - Intergenic
973751015 4:54021342-54021364 GAGAGAAAGAAGAAAGATTTGGG - Intronic
974058038 4:57003864-57003886 AAGAAGAAGAAGAAATAGTTGGG + Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974525564 4:63046110-63046132 CAGAAAAAGTAGAAAGAGATGGG - Intergenic
974630065 4:64478140-64478162 AAAAAAAAAAAGAAAGAGTTAGG - Intergenic
974938084 4:68431627-68431649 AAAAAAAAAAAGAAGGAGGTGGG + Intergenic
975151961 4:71032755-71032777 GAGAGAAAGAAGAAGGATTTGGG - Intergenic
975152017 4:71033069-71033091 GAGAGAAAGAAGAAGGATTTGGG - Intergenic
976740068 4:88347905-88347927 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
976827557 4:89277613-89277635 CAGAGGATGAAAAAGGAGTTTGG - Intronic
976987892 4:91325794-91325816 CAGACAAAGAAAAAAGAGTTTGG + Intronic
977150922 4:93510317-93510339 AAGACAAAGAAGATGGAGATGGG + Intronic
977251757 4:94696079-94696101 CAGAAAAAGAAGAAATAACTTGG - Intergenic
977595000 4:98868920-98868942 AAGAAGAAGAAGAAGAAGTTGGG + Intergenic
978303343 4:107294607-107294629 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978371162 4:108030550-108030572 CAGACAAAGAAGCAGATGTTGGG + Intronic
978474220 4:109107819-109107841 GAGAAAAAGAACAAAGAGCTTGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979109503 4:116734158-116734180 GAGAGAAAGAAGAAGGAAATGGG + Intergenic
979245641 4:118500929-118500951 AAAAAAAAGAAGAAGAAGATAGG + Intergenic
979694513 4:123597440-123597462 GACAAAAAGTAGATGGAGTTGGG - Intergenic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
980262249 4:130466046-130466068 CAGAAAAAAATAAAGAAGTTTGG - Intergenic
980553975 4:134378731-134378753 AAGAAAAAGAAAAAGGTGTCTGG + Intergenic
980597997 4:134980875-134980897 GAGAAAAAGAAGAAGTAATCAGG - Intergenic
981056004 4:140362273-140362295 AAGAAGAAGAAGAAGAAGTAAGG - Intronic
981083082 4:140654455-140654477 GAGAAAAAGAAGAAAGGGGTGGG + Intronic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981678909 4:147371859-147371881 CAGAACAGGAAGAAGCAGTTAGG - Intergenic
981735439 4:147945282-147945304 CAGGAAAAAAAAAAGGAGATGGG - Intronic
981824876 4:148928553-148928575 CACAAAAAGTTGAAGGAATTGGG + Intergenic
981953086 4:150434858-150434880 AAGAAAAAAAAAAAAGAGTTCGG + Intronic
981990528 4:150914348-150914370 AAGAAAAAAAAAAAGGAATTAGG + Intronic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982975455 4:162051934-162051956 AAGAAAAACAAGAAGGAAATAGG + Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983032406 4:162819146-162819168 CAAAAAAGGATGAGGGAGTTTGG + Intergenic
983155330 4:164340224-164340246 AAAAAAAAGAAAAATGAGTTTGG - Intronic
983314348 4:166109693-166109715 GAGAAAGAGAAGGAGGAGATTGG - Intergenic
983516886 4:168666844-168666866 CAGAAAAAAAAGAAAGAGACTGG + Intronic
983667048 4:170194085-170194107 CAGAATCAGAACAAGGAGATTGG - Intergenic
983806877 4:172004894-172004916 AAAAAAAAGAAGAAAAAGTTTGG + Intronic
983918375 4:173316394-173316416 AAGGAAAAGAAGAGGAAGTTAGG - Intronic
983956335 4:173702886-173702908 CCAAAAAAGAAGAGGGAGATGGG + Intergenic
984139454 4:175985040-175985062 CTGAAAAAGAAAAAGAAGGTGGG - Intronic
984411610 4:179404752-179404774 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
984587747 4:181582272-181582294 GAGAAAAAGAAAAAGGAGCAGGG + Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
985031528 4:185795292-185795314 CAAAAATAGAAGAAAGAGGTCGG + Intronic
985187255 4:187331119-187331141 CAGAAAAAGAACAATGATTGTGG + Intergenic
985352821 4:189084390-189084412 AAAAAAAAGAAAAAGAAGTTTGG + Intergenic
985379634 4:189379087-189379109 CAGAAAAAGAAAAAGGTTATGGG + Intergenic
986134549 5:4963008-4963030 CCGAAAAAGAAGAAGAAAGTTGG + Intergenic
986183053 5:5411550-5411572 AAAAAAAAGAAGAAGGAGTGAGG - Intergenic
986805733 5:11307097-11307119 CAGAAAAAAAAAAAGGCTTTGGG - Intronic
986826365 5:11527051-11527073 AAGAAAAAGAAGGTGGGGTTGGG + Intronic
987585310 5:19847440-19847462 TATAAAAAGAAGCAAGAGTTTGG - Intronic
987676040 5:21073541-21073563 AAAAAGAAGAAGAAGGAATTTGG - Intergenic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988164861 5:27574259-27574281 AAGAAAAAAAAAACGGAGTTTGG + Intergenic
988181021 5:27793875-27793897 TAGAAAAAAGAAAAGGAGTTAGG + Intergenic
988198983 5:28047165-28047187 GAGAGAAAGAAGAAAGAATTGGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988414775 5:30932270-30932292 CACATAAAGAACAAAGAGTTTGG - Intergenic
988690439 5:33566720-33566742 CAGAAGAAGAAAAAGGATTATGG - Intronic
988734518 5:34007501-34007523 TAGAAAAAAAAGGAGGAATTTGG + Intronic
988819865 5:34872125-34872147 AAAAAAAAGAAGAAGAAGCTGGG + Intronic
989164378 5:38420376-38420398 CACAGAAAGAAGATGGATTTTGG - Intronic
989615268 5:43332126-43332148 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
989760053 5:45004075-45004097 AAGAAAAATAATGAGGAGTTTGG - Intergenic
990280748 5:54248339-54248361 GAGAAAGAGAAGATGGAGATAGG - Intronic
990760926 5:59128282-59128304 AAGAAAAAGAAATAGGAGGTTGG + Intronic
991132741 5:63143291-63143313 CAGAAAAAAAATAATCAGTTGGG - Intergenic
991152392 5:63385714-63385736 GAGAGAAAAAAGAAAGAGTTAGG + Intergenic
991354923 5:65758533-65758555 CAGAAAAAGAATAAGAATTAGGG - Intronic
991398108 5:66225592-66225614 CAGGGAAAGAAGCAGGAGTTTGG + Intergenic
992452164 5:76884907-76884929 GAGAGAAAGAAGAAAGATTTGGG + Intronic
992638638 5:78749555-78749577 CAAAAAAAGAACAAGGAATCTGG - Intronic
992746161 5:79823076-79823098 CAAAAAAAAAAGAAAAAGTTTGG - Intergenic
992814661 5:80424458-80424480 CAAAAAAAAAAAAAGGAATTTGG - Intronic
992965284 5:81993175-81993197 CAGATAAAGAAAATAGAGTTTGG - Intronic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
993850143 5:92998425-92998447 CAGAGAAACAAGAAGAAGATGGG - Intergenic
994324708 5:98435773-98435795 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
994375903 5:99015502-99015524 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
994981922 5:106886177-106886199 AAGAAGAAGAAGAAGAAGATAGG + Intergenic
995023214 5:107389880-107389902 CAGAAAATGAGGAAGTAGTGGGG - Intronic
995283487 5:110360740-110360762 CAGAAATGGAAGAAGAAGTGGGG - Intronic
995466786 5:112458163-112458185 CAGAAAGAGAAGAAAGAGACAGG + Intergenic
995605209 5:113846927-113846949 CTGAAAAACAAAGAGGAGTTTGG + Intergenic
995648204 5:114337609-114337631 AAGACAAAGAAGAAGAACTTTGG - Intergenic
995769272 5:115652058-115652080 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
995874920 5:116780458-116780480 AAAAAAAAGAAGAAGAAGCTGGG - Intergenic
995915998 5:117245624-117245646 GAGAGAATGAAGAAGGAGATGGG + Intergenic
996052785 5:118951393-118951415 GAGAGAAAGAAGAAAGATTTGGG + Intronic
996084790 5:119294023-119294045 AAGAAAAAAAAGAAGGTATTGGG - Intronic
996363499 5:122676293-122676315 GAGAAAAAGCATAAGGACTTGGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996714009 5:126571850-126571872 CAGACACAAAAGAAGGAGCTGGG + Intronic
997180617 5:131825037-131825059 AAGAAGAAGAAGAAGAAGCTGGG + Intronic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998174773 5:139894997-139895019 CAGATAAAGAAGAAGGGGAAGGG + Intronic
998232660 5:140371243-140371265 CAGAAAAGAAAAAAGGAGTAGGG - Intronic
998318611 5:141208103-141208125 CAGAAAATGAAGCAAGAGATTGG - Intergenic
998358033 5:141557910-141557932 CAGGAATAAAAAAAGGAGTTAGG - Intronic
998604141 5:143616195-143616217 CAGAAATAGTACAAGGAGTGGGG - Intergenic
998745692 5:145257460-145257482 CAGAAAAACAAAAAGTAGGTAGG + Intergenic
998949127 5:147374121-147374143 CAGAAAAAGAAAAAAAAATTAGG + Intronic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999443535 5:151621003-151621025 CAGAAAAAGAAGCAGAGGTGGGG + Intergenic
1000141885 5:158412860-158412882 CAGAGAAAGTAGAAGTAATTGGG - Intergenic
1000190118 5:158902399-158902421 AAGAAAAAGAAGCAGGCTTTTGG - Intronic
1000843907 5:166255288-166255310 AAAAAAAAGAAAAAGCAGTTTGG + Intergenic
1001082386 5:168676898-168676920 CAGGAAGGGAAGAAGGAGTTGGG - Intronic
1001189225 5:169611753-169611775 AAGAAAAAGAAGAACAACTTAGG - Intergenic
1001204520 5:169749843-169749865 CAGAGAATGATGAAGGGGTTAGG - Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002136739 5:177112465-177112487 CCGAAAGAGGAGGAGGAGTTTGG - Intergenic
1002186394 5:177456728-177456750 CAAGCAAAGAGGAAGGAGTTGGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002477780 5:179478513-179478535 AAGAAAAGGAAGAAGGACATTGG + Intergenic
1002693328 5:181066143-181066165 CAGGAAAAGAACAAGAATTTGGG - Intergenic
1002942317 6:1728825-1728847 CAGAAAAAGAAAGAGGAGAAAGG - Intronic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003143632 6:3491965-3491987 GAGAAAGAGAAAGAGGAGTTTGG - Intergenic
1003571609 6:7259865-7259887 GAAAAAAAAAAAAAGGAGTTGGG + Intergenic
1003677474 6:8219492-8219514 CAGAAAAAGAAAATGCCGTTGGG - Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004102166 6:12624706-12624728 CAGGAAGAGAAGACAGAGTTTGG + Intergenic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1004680609 6:17890616-17890638 AAAAAAAAGAAGAAGGAGAAGGG - Intronic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1005212099 6:23478184-23478206 CAAAAAAAGAGAAAGGAATTAGG - Intergenic
1005979017 6:30821879-30821901 AAGAAAAAGAAGGACAAGTTAGG - Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006243041 6:32703482-32703504 CAGGAAGAGAAGACGGAGGTTGG - Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006905637 6:37531556-37531578 GAGAAAAAGAAGAATGTGTTTGG + Intergenic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1006941073 6:37752829-37752851 CAGAAAAACAAGCAGGAGCTGGG + Intergenic
1006944158 6:37773424-37773446 CAGAAAAAGAAGAACAGGCTGGG + Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007084705 6:39135183-39135205 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007365286 6:41387364-41387386 AAGAAAAAGGAGAAAGAATTTGG - Intergenic
1007492447 6:42233924-42233946 GATAAAAAGAAGAAGGATCTTGG + Intronic
1007570021 6:42882910-42882932 AAAAAAAAGAACAAGGAGTGAGG + Intronic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1007654911 6:43446069-43446091 AAGCAACAGAAGAAGGAGATAGG + Intronic
1007667939 6:43527146-43527168 CAAAAATAGCAGAAGGAATTTGG - Intronic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1008217791 6:48816472-48816494 CAGAAAAAATATAGGGAGTTAGG + Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008286223 6:49654247-49654269 AAGAAAAAGAAGAAGAAGAAAGG - Intergenic
1008827103 6:55709543-55709565 CAAAATAAGAAGCATGAGTTTGG - Intergenic
1009394265 6:63179633-63179655 AAGAAAAAGAAGAAAGTGATAGG + Intergenic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1009621886 6:66087954-66087976 TAGAAAAAGAAATAGGATTTGGG + Intergenic
1010818117 6:80384325-80384347 AAGAAGAAGAAGAAGAAGATCGG - Intergenic
1010825726 6:80471640-80471662 CAGAAATACAAGAAGAAATTTGG - Intergenic
1010897006 6:81377143-81377165 CAGAAAATGAAACAGGAGTTTGG + Intergenic
1011112145 6:83850488-83850510 CAGGAAAAAAATAATGAGTTTGG - Intergenic
1011221430 6:85058315-85058337 CAGAAGAAGCAGAAGGGCTTGGG + Intergenic
1011230679 6:85158222-85158244 CATAAGCAGAAGAAGCAGTTAGG - Intergenic
1011242986 6:85291910-85291932 TAAAAAAAAAAAAAGGAGTTGGG - Intergenic
1011727726 6:90227565-90227587 CAAGAAAAGAAAAAGGGGTTAGG - Intronic
1012011532 6:93792796-93792818 TAGAAGAAGAAGAAGCAGTGTGG + Intergenic
1012283709 6:97362666-97362688 CAGAACAGGTACAAGGAGTTTGG + Intergenic
1012579435 6:100848469-100848491 CAGAAAAAGAACATGGCGATAGG - Exonic
1012946215 6:105468698-105468720 AAAAAAAAGAAGAAGGATATAGG - Intergenic
1013270407 6:108540324-108540346 TAGAAAAAGAAAAAGTACTTTGG + Intergenic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013550721 6:111205190-111205212 GAGAAAAAGGAGATGGTGTTGGG + Intronic
1013976338 6:116083059-116083081 CAGTCAATGAAGAAGGAGTAGGG + Intergenic
1014115459 6:117663868-117663890 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1014156950 6:118122205-118122227 GAGAAAAAAATGAAGGAATTGGG - Intronic
1014354440 6:120387266-120387288 TAAAAAAATAAAAAGGAGTTGGG + Intergenic
1014497750 6:122147522-122147544 CTGAAAAAGAAAAAAAAGTTTGG + Intergenic
1014518300 6:122406173-122406195 CAGACAATGAAGAATGAATTTGG + Intronic
1014558628 6:122863647-122863669 CATAAAGAGAGGAAGGAATTTGG + Intergenic
1014648201 6:124002467-124002489 AAGAAAATGAAGTAGGAGATTGG - Intronic
1014695504 6:124616132-124616154 CAGAAGAAGAGGATAGAGTTTGG - Intronic
1015088210 6:129321877-129321899 CATGAAAAGAAAAAGGAATTTGG + Intronic
1015601190 6:134912482-134912504 CTAACAAAGAAGAGGGAGTTTGG + Intergenic
1015989511 6:138922539-138922561 CAGAAAAAGAAGAAAAAGAGAGG + Intronic
1016324499 6:142884670-142884692 GAGAAAGAAAAGGAGGAGTTAGG + Intronic
1016646417 6:146414342-146414364 CAATAAAAGAAGAAAGAATTTGG - Intronic
1016902428 6:149115606-149115628 CTGAAAAAGAAGGAAGTGTTTGG + Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017116198 6:150979238-150979260 CAAAAAAATAAGAAGAATTTTGG + Intronic
1017506404 6:155072583-155072605 TTGAAAAAGAATAACGAGTTTGG + Intronic
1017591039 6:155978209-155978231 GAAAAAAAGAAGGAGGAGTAGGG - Intergenic
1017663495 6:156696186-156696208 AAGAAAAAGAAAAAGAAGTAGGG - Intergenic
1017781467 6:157718858-157718880 GAGAGGAGGAAGAAGGAGTTGGG - Intronic
1018079830 6:160249222-160249244 TAGAGCAAGAAGAAGAAGTTGGG + Exonic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018333252 6:162755730-162755752 CAAAAAAAGAAGAAAGGGCTAGG - Intronic
1018461690 6:164004773-164004795 AAGAAAAAGAAGAGGGAGGGAGG + Intergenic
1018564566 6:165137619-165137641 CAGAGCAAGAGGAAGGAGTAGGG - Intergenic
1018625054 6:165770165-165770187 AAAAAAAAAAAAAAGGAGTTAGG + Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019771713 7:2887492-2887514 AAAAAAAAGAAGAATGAGTTGGG - Intergenic
1019876167 7:3812931-3812953 AAGCAAAAGAAGAAAGAATTTGG - Intronic
1019937738 7:4267331-4267353 GAGAAAAGGAAGAAGGAATAGGG - Exonic
1020332236 7:7031445-7031467 AAAACAAAGAAGAAGGAATTTGG - Intergenic
1020790514 7:12622296-12622318 CAGAAAACGAAGCATGATTTGGG + Intronic
1020794092 7:12661120-12661142 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1020821267 7:12971308-12971330 AAAAAAAAGAAGAAGGAATGAGG - Intergenic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1020991912 7:15208529-15208551 CAGAAAAATAACAAGGCATTTGG + Intronic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021255518 7:18387555-18387577 TAGAAAATGAGGAAGGAGGTAGG + Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021438399 7:20648792-20648814 CAGAAAAAAAATAAGGAAGTAGG - Intronic
1021508898 7:21414155-21414177 CAGAAAGGTAAGAAGGAGTGAGG - Intergenic
1021660507 7:22914675-22914697 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1021844247 7:24748665-24748687 AAGAAAGAGAAGGAGGAGTGGGG - Intronic
1022014242 7:26335417-26335439 CACAAAAAGAAGAAAGGGCTGGG - Intronic
1022071056 7:26914661-26914683 AAAAAAAAGAAAAAGGATTTAGG + Intronic
1022723730 7:32962859-32962881 GAGAAAAAGCAGTAGGAGTGAGG + Intronic
1022736845 7:33084103-33084125 AAAAAAAAAAAAAAGGAGTTGGG + Intergenic
1023018747 7:35990664-35990686 CAGAAAAAGAAGAACAAAATTGG + Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023515636 7:40998365-40998387 CTGAAAAAAAAAAAGGAGCTAGG + Intergenic
1023624281 7:42100741-42100763 AAGAAAAAGAAGAGGGGGTGGGG + Intronic
1023643070 7:42280959-42280981 CAGAAAATGAAAAGGTAGTTGGG - Intergenic
1023710799 7:42990547-42990569 CAAAAACAAAAGAAGAAGTTGGG - Intergenic
1024161798 7:46683521-46683543 CAAGAAAAGGATAAGGAGTTTGG + Intronic
1024182428 7:46909516-46909538 CAGAAAATGAAGGAAGAGATAGG + Intergenic
1024724981 7:52183744-52183766 AAGAAAAACAAAAAGAAGTTTGG + Intergenic
1025049894 7:55725056-55725078 GAGAAAAAGCAGTAGGAGTGAGG - Intergenic
1025275403 7:57578424-57578446 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025791212 7:64688551-64688573 AAGAAGAGGAAGAAGGGGTTGGG - Intronic
1025843351 7:65172606-65172628 AAAAAAAAGAAGAAAGAGTTTGG + Intergenic
1025879693 7:65523362-65523384 AAAAAAAAGAAGAAAGAGTTTGG - Intergenic
1025893744 7:65679228-65679250 AAAAAAAAGAAGAAAGAGTTTGG + Intergenic
1026076712 7:67178168-67178190 CAGAAAAAAAAACAGGAGGTGGG + Intronic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026262836 7:68770633-68770655 CAGAGAGAGAAGAAGGAAATAGG + Intergenic
1026321481 7:69271718-69271740 CAGAAAAAGAGGAAGGAAAAAGG - Intergenic
1026728470 7:72890985-72891007 TGGGAAAAGAAGAAGGACTTGGG - Exonic
1026814268 7:73497563-73497585 TAAAAAAAGAACAAAGAGTTAGG - Intronic
1026917109 7:74127187-74127209 AAAAAAAAGAAGAAGAATTTAGG + Intergenic
1027115363 7:75474807-75474829 TGGGAAAAGAAGAAGGACTTGGG + Exonic
1027120546 7:75515836-75515858 TGGGAAAAGAAGAAGGACTTGGG + Intergenic
1027158117 7:75782819-75782841 GAGAGAAAGAAGAAAGATTTGGG - Intronic
1027286491 7:76650501-76650523 TGGGAAAAGAAGAAGGACTTGGG + Intergenic
1027797957 7:82717556-82717578 CAGAAAAAGAAACTGGATTTAGG - Intergenic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1028188987 7:87823593-87823615 AAGAAAGAGACAAAGGAGTTTGG - Intronic
1028317786 7:89425044-89425066 CTGAAAAAGAAAAAGCTGTTTGG + Intergenic
1028356236 7:89913403-89913425 AAGAAAAAGTAGAAGCAGTTGGG + Intergenic
1028471547 7:91211831-91211853 GAGAAATAGAAGAAGCACTTGGG - Intergenic
1028480599 7:91300589-91300611 GAGACAAAGAAGAAGCAGCTAGG - Intergenic
1028590022 7:92483969-92483991 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1028623636 7:92852224-92852246 CAGAAAACAAAGAGGGAGATGGG + Intergenic
1028731554 7:94157018-94157040 CATATAAAAAAGAAGGATTTAGG + Intergenic
1028889230 7:95968185-95968207 CCGAAAAAAAAAAAGGAGGTGGG + Intronic
1028941299 7:96525252-96525274 CAAAAAAAAAAAAAGGAGTCAGG - Intronic
1029083935 7:97996848-97996870 CATGAAGAGAAGAAGAAGTTAGG - Intergenic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029271174 7:99377606-99377628 AAGAAGAAGAAGAAGAAGCTGGG - Intronic
1029316989 7:99724456-99724478 GAGAGAAAGAAGAAAGATTTGGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029501100 7:100930421-100930443 CATAAAAAGAAGAAAAAGCTGGG - Intergenic
1029632028 7:101758577-101758599 CAGAAAGAGAAGAATGGGCTAGG + Intergenic
1029722241 7:102376182-102376204 TGGGAAAAGAAGAAGGACTTGGG - Intronic
1029986590 7:104928456-104928478 AAGAAGAAGAAGAAGAAATTTGG + Intergenic
1030206234 7:106954893-106954915 CAAAAAAAGAAGAAGAAATATGG + Intergenic
1030349792 7:108471202-108471224 AAAAAAAAAAAGAAGAAGTTAGG - Intronic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1030740890 7:113108583-113108605 TTGAAAATGAAGAAGTAGTTTGG + Intergenic
1031013555 7:116548640-116548662 CATAAACAGCACAAGGAGTTTGG + Intronic
1031041845 7:116846738-116846760 CAGACAAATAAGAAGGGGCTGGG + Intronic
1031065383 7:117099075-117099097 AAGAAGAAGAAGAAGGTGCTTGG + Intronic
1031267039 7:119594103-119594125 CAGAATAAGAAGAAGAAGTTGGG + Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031413780 7:121471701-121471723 TAGAGAACGAAGCAGGAGTTTGG + Intergenic
1031750242 7:125562709-125562731 CAGCAATAGAAGAAGGTGGTGGG + Intergenic
1032434709 7:131890376-131890398 CAGAAAAACAAGGAGGCCTTTGG - Intergenic
1032758778 7:134917800-134917822 TGGAAAGAGAGGAAGGAGTTTGG + Intronic
1032955368 7:136964542-136964564 CAAAGAAAGAAGAAAGAATTTGG - Intronic
1033084600 7:138330557-138330579 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1033164485 7:139028044-139028066 AGGAAAAAGAGGAAGGAGATGGG - Intronic
1033356835 7:140607128-140607150 TGGAAACTGAAGAAGGAGTTGGG - Intronic
1033400587 7:141020038-141020060 CAGAAAAAGAAGAAGGGACTAGG + Intergenic
1033625469 7:143106377-143106399 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034133516 7:148742897-148742919 CAGAAAAGGTAGAAAGAGTTGGG - Intronic
1034333969 7:150308543-150308565 GAGAGAAAGAAGAAGGATTTGGG - Intronic
1036178595 8:6563669-6563691 CAAATAAAGAGGAAGAAGTTTGG + Intronic
1036549550 8:9804495-9804517 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1036685522 8:10907057-10907079 AAGAAAAAGAAGAAGAAGAAGGG + Intronic
1036777251 8:11622109-11622131 AAGAAGAAGAAGAAGAAGTGAGG - Intergenic
1037124494 8:15330205-15330227 AAAAAAAAGAAGAAGGAAATTGG - Intergenic
1037195626 8:16185959-16185981 GAGAAAAACAAGAAGCAGTCAGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037708680 8:21337926-21337948 AAAAAAAAGAAGAAGGAGAAAGG + Intergenic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038075251 8:24066020-24066042 AAGAACAAAAAGGAGGAGTTTGG + Intergenic
1038076319 8:24079397-24079419 CAAAAAGAGAAAAAGAAGTTGGG - Intergenic
1038076444 8:24080432-24080454 CAGAAAATGTAAAAGGAGTGAGG - Intergenic
1038147290 8:24910334-24910356 AAGATAAAAAATAAGGAGTTAGG - Intergenic
1038602079 8:28954801-28954823 GTGGAAAAGAAGAAGGACTTTGG + Intronic
1038700369 8:29843975-29843997 CAAAAAAAGAAGAAACACTTAGG - Intergenic
1038894707 8:31769502-31769524 CAGAAAAAGAGGGTGGCGTTAGG + Intronic
1039278976 8:35961633-35961655 CAGAAAAAGAAGAAGCCATGAGG - Intergenic
1039398863 8:37250837-37250859 CTCAAAAAGAAGAATCAGTTTGG + Intergenic
1039502076 8:38026009-38026031 GAGAAGAAGAAGAAGAATTTGGG + Intergenic
1039534168 8:38293151-38293173 AAGAAAAAGAAAAAGAAGTGGGG + Intronic
1039722271 8:40176878-40176900 CATAAGAAGAAGAGGGAGTAGGG + Intergenic
1039767378 8:40643789-40643811 CAAAAAAAAAAAAAGGAGTAAGG + Intronic
1039824837 8:41164157-41164179 AAAAAAAAGAAGAAGGCATTTGG - Intergenic
1039931541 8:41995175-41995197 CATAGAAAGAACAATGAGTTGGG + Intronic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041609934 8:59833724-59833746 CATAAAAAGAAGAACAAATTTGG + Intergenic
1041809750 8:61895140-61895162 AAGAAGAAGAAGAAGAAGTTGGG - Intergenic
1041917655 8:63152486-63152508 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1042398779 8:68321558-68321580 CAGTAAAAGAAGAATGAGTGTGG + Intronic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1042451473 8:68952148-68952170 CAGAAAGAGAAAAAAGAGATAGG + Intergenic
1042460688 8:69062139-69062161 CAGAAAAATAAGAGGAATTTGGG + Intergenic
1042691297 8:71502306-71502328 CAGACAAAGAAGAATGAGAGGGG - Intronic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1042861854 8:73322352-73322374 TAGAAAGAGGAGAAGGTGTTTGG - Intronic
1042928183 8:73988159-73988181 AAAAAAAAGAAGAAGGTGATGGG + Intergenic
1042936047 8:74059403-74059425 CTAAAAAAGAAGCAGGAGGTGGG + Intergenic
1043058797 8:75473979-75474001 GAGAACAAAAAGTAGGAGTTAGG + Intronic
1043597565 8:81902690-81902712 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1044334220 8:90959246-90959268 CAGAAACAGAAGAACAGGTTTGG - Exonic
1044580813 8:93824479-93824501 CAGAATAAGAGGAATGGGTTTGG - Intergenic
1044704413 8:94994541-94994563 AAAAAAAAGAAGATGGACTTCGG + Intronic
1044872110 8:96629539-96629561 CCGTAGAAGAAGAAGGGGTTGGG + Intergenic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1044994946 8:97830009-97830031 CAGAAAGTGAAGAAGATGTTCGG + Intronic
1045071427 8:98508458-98508480 TAGAAAAAGAAAAGGGTGTTGGG + Intronic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1045228717 8:100278897-100278919 CATAAAAACATGAAGGGGTTTGG + Intronic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045873239 8:106949559-106949581 CAGAAAAAGAACAAAGTGTCTGG + Intergenic
1046074782 8:109302371-109302393 CAGAGAAAGAAGAAAGATTTGGG - Intronic
1046594886 8:116249578-116249600 CAGAAAAGGGAGATTGAGTTAGG - Intergenic
1046708725 8:117485994-117486016 CAGAAAAATAAGAATGACCTAGG - Intergenic
1048629698 8:136228702-136228724 AAGAATAAGAAGGATGAGTTAGG - Intergenic
1048966357 8:139617807-139617829 TAGGAAAAGAGAAAGGAGTTAGG + Intronic
1049067194 8:140326232-140326254 AAAAAAAAGAAGAAGAAGTTGGG + Intronic
1049594849 8:143478497-143478519 CAAAAAAATAAGAAGGAGCGGGG - Intronic
1049648724 8:143752909-143752931 CAGAAAGAGAAGAAAGAGAAAGG - Intergenic
1050140359 9:2510950-2510972 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1050478998 9:6070386-6070408 CAGGAAAAGATGAAGAATTTAGG - Intergenic
1051141003 9:13978870-13978892 AAGAAAAAGAAGAAGGGGAGTGG - Intergenic
1051171030 9:14317505-14317527 CAGAAAAAGGAAAATGAGATAGG + Intronic
1051906074 9:22096305-22096327 GAGAAAAAGATGAATGAGATTGG + Intergenic
1052124414 9:24757062-24757084 CAGACAAAGAAAAACAAGTTTGG + Intergenic
1052374251 9:27699913-27699935 AAGAAAAAGAAGAAGGGATGTGG + Intergenic
1052610696 9:30769774-30769796 CACAGAAAGAAGAAAGAGTGGGG + Intergenic
1052813713 9:33083709-33083731 AAGAAAAAGAAAATGGGGTTGGG + Intergenic
1052968763 9:34363588-34363610 TAGAAAAGAAAGAACGAGTTGGG - Intergenic
1052977063 9:34419193-34419215 CAGCAAAATAAGAAGGTGTGTGG + Intronic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053060081 9:35023800-35023822 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053109521 9:35445739-35445761 AAAAAAAAGAATAAGGAGTATGG - Intergenic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053512221 9:38697435-38697457 AAGGAGAAAAAGAAGGAGTTAGG - Intergenic
1055145919 9:72934549-72934571 CACAAAAGTAAGAAGGAGTTGGG - Intronic
1055181304 9:73390000-73390022 CAGAAAAACAAGAAGTAGAAGGG - Intergenic
1055436047 9:76293252-76293274 AAGAAAAAGTAAAAGGAGTGTGG + Intronic
1055752127 9:79518351-79518373 AAGGAAAAGAAGAAGGAAGTTGG - Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056141644 9:83686573-83686595 CATAAAAAGAATAAGGATATTGG - Intronic
1056178257 9:84056875-84056897 CAGATAGAAAATAAGGAGTTGGG - Intergenic
1056234790 9:84584044-84584066 CAAAGAATGAGGAAGGAGTTAGG - Intergenic
1056277489 9:85007294-85007316 CAGAAAGAGCTAAAGGAGTTTGG + Intronic
1056391765 9:86147333-86147355 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1056430995 9:86527615-86527637 AAGAACAAGAAGAAGAGGTTGGG + Intergenic
1056510801 9:87303365-87303387 CAAAAAAAAAAAAAGCAGTTGGG - Intergenic
1056804502 9:89718205-89718227 CAGAAAAATCAGAAAGAGTTTGG + Intergenic
1057184018 9:93046330-93046352 AAGAAAAAGAAAAAGGCGTGGGG + Intergenic
1057368367 9:94445788-94445810 CAAAAAAAGAACCAGCAGTTTGG + Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057707190 9:97403951-97403973 CAGAAAGAGTAGAGAGAGTTGGG - Intergenic
1057777467 9:98022483-98022505 AAGAAAAAGAAAAAGGGGCTGGG - Intergenic
1057814353 9:98283489-98283511 TAGAAAAAGAACTAGAAGTTTGG - Intergenic
1057946605 9:99335504-99335526 CAAAAAAAGATGAAAGAGTAAGG - Intergenic
1058075227 9:100643995-100644017 AAGAAAAAAAAGAAGAAATTGGG + Intergenic
1058378286 9:104350287-104350309 AAGAAAATGGAGAAAGAGTTGGG + Intergenic
1058387415 9:104454105-104454127 GAGAAAAAGAACAAGGAACTGGG + Intergenic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059225866 9:112672396-112672418 CAAAAAAAAAAGAGGGAGTCCGG + Intergenic
1059618105 9:115973059-115973081 CTGAAAAACAACAAGGAATTTGG - Intergenic
1059641792 9:116224246-116224268 CAGATAAAAATAAAGGAGTTAGG - Intronic
1059714208 9:116898409-116898431 CAAAAAAAAAAAAAAGAGTTTGG + Intronic
1059885355 9:118739474-118739496 AAGAAAGGGAAAAAGGAGTTTGG - Intergenic
1060489450 9:124071762-124071784 AAGAAAAAGAACAAGGAGAAGGG - Intergenic
1060805514 9:126573471-126573493 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061287727 9:129633663-129633685 CAAAAAAAAAAAAATGAGTTGGG + Intronic
1061486543 9:130923317-130923339 CAGAAGAAAAAGGAGGAGTGTGG - Intronic
1203626625 Un_KI270750v1:31902-31924 CAAAAAATGATGAAGAAGTTTGG - Intergenic
1185637792 X:1566095-1566117 AAAAAAAAAAAAAAGGAGTTGGG + Intergenic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186287707 X:8063707-8063729 AAGAAAAAGAAGAGGCAGTGTGG - Intergenic
1186505294 X:10086717-10086739 CAAAAAAAAATGAAGCAGTTTGG - Intronic
1186965173 X:14779185-14779207 GAGAAAATGGTGAAGGAGTTAGG - Intergenic
1187293944 X:17981031-17981053 TAAAAAAAGAAGAGGGTGTTAGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188173206 X:26954566-26954588 CAGTATAAGAAGAAGAATTTGGG - Intergenic
1188201118 X:27293679-27293701 CAGGGAAAGAAGGAGGATTTGGG + Intergenic
1188292409 X:28405747-28405769 CAGACAAAGAAAAAGGATTTAGG + Intergenic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190831422 X:54062482-54062504 AAAAAAAAGAAGAAGAAGCTGGG - Intergenic
1190875544 X:54457755-54457777 CAGAAAAAGATGAAAGAAGTAGG - Intronic
1190963885 X:55279359-55279381 CAGAAAAAGAGAAAGGAATGAGG + Intronic
1191178645 X:57535947-57535969 CACAAGAAGAAGAATGAGATTGG - Intergenic
1192104967 X:68306719-68306741 CAAAAAAAGAAGATGAATTTGGG - Intronic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192288335 X:69762964-69762986 CAGAAAAATAGGAATGATTTTGG + Intronic
1192363453 X:70453245-70453267 CACAAGAAGAGGAAGCAGTTAGG - Intronic
1192731630 X:73807071-73807093 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1192818703 X:74620268-74620290 CATAAAAAGAATATGGGGTTAGG - Intergenic
1192914249 X:75636437-75636459 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1192935968 X:75858769-75858791 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1193023473 X:76818327-76818349 CAGAAAAACAAAAAGGATATTGG + Intergenic
1193285090 X:79703774-79703796 CAGAAAAAGGCCAAGAAGTTAGG + Intergenic
1193536945 X:82728080-82728102 GAGAAAAAGAAGAAAGATTTGGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1193913045 X:87328351-87328373 CAGAAAAATCAGGTGGAGTTGGG - Intergenic
1194003317 X:88458773-88458795 CATAAAGAGAAAAAAGAGTTGGG + Intergenic
1194033039 X:88839276-88839298 CAGAAGAAGAAGAAAGAATGGGG + Intergenic
1194101399 X:89709979-89710001 CATAAAAAGAAAAAGGACATTGG + Intergenic
1194570915 X:95553692-95553714 CAGAAAATGAGGTAGGAGGTGGG - Intergenic
1194721626 X:97346981-97347003 CAGAGAAGGAAGAAGGTGATGGG - Intronic
1195017066 X:100790599-100790621 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1195023314 X:100850833-100850855 AAAAAAAAGAAGAAGAACTTGGG - Intronic
1195056823 X:101154184-101154206 TTGAAAAAGAAGAACAAGTTGGG - Intronic
1195343272 X:103925453-103925475 CAAAAATGGCAGAAGGAGTTGGG + Intronic
1195363722 X:104108014-104108036 CAAAAATGGCAGAAGGAGTTGGG - Intronic
1195641546 X:107181075-107181097 CAGAAAAAAAAAAAAAAGTTGGG - Intronic
1195868830 X:109464284-109464306 TAGAGAAAGAAAAAGGAGTGAGG - Intronic
1196177318 X:112653504-112653526 CACAGAAAAAAGAAAGAGTTAGG + Intronic
1196347677 X:114683817-114683839 CAAAAAAAGAAGAATCATTTAGG + Intronic
1196585003 X:117419192-117419214 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1196603957 X:117634281-117634303 CATAAAAACATGAAGTAGTTTGG + Intergenic
1197226480 X:123960798-123960820 CTGAGAAAGAAGGAGGAGTGGGG + Exonic
1197447471 X:126567972-126567994 CAGGCATAGATGAAGGAGTTGGG - Intergenic
1198109645 X:133491704-133491726 CAGAAAAAAAAGTAGGAATGGGG + Intergenic
1198130467 X:133689218-133689240 CAGAAATATAAATAGGAGTTTGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198572171 X:137969429-137969451 CAAAAAAAGAAGAGAGATTTAGG + Intergenic
1198607495 X:138357537-138357559 GAGAAAAAGAAAAAGAACTTTGG - Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199347207 X:146755678-146755700 GAGAAGGAGAAGGAGGAGTTGGG + Intergenic
1199405885 X:147460046-147460068 CTGAAAAAGAATAAGGTTTTAGG + Intergenic
1199539342 X:148941672-148941694 CTGAAGCTGAAGAAGGAGTTGGG + Intronic
1199559023 X:149142916-149142938 CAGAAGAAAAATAATGAGTTTGG + Intergenic
1199619730 X:149688372-149688394 GAGAAAAAGAAGAAGGTGAAAGG + Intronic
1199854511 X:151749732-151749754 CACCAAAAGAAGAAGGAGTGTGG - Intergenic
1199888870 X:152054326-152054348 CTGAAAAAGAAGAGTGAATTTGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200454351 Y:3371063-3371085 CATAAAAAGAAAAAGGACATTGG + Intergenic
1200812697 Y:7501919-7501941 GAGAGAAAGAAGAAAGATTTGGG - Intergenic
1200881491 Y:8217461-8217483 AAAAAAAAGAAGAAGAATTTTGG - Intergenic
1201061767 Y:10052462-10052484 GAGAGAAAGAAGAAAGATTTGGG + Intergenic
1201171978 Y:11275858-11275880 AAAAAAAAAAAGAAGGAGGTTGG + Intergenic
1201601678 Y:15736403-15736425 CAGAAACAGAAGAGACAGTTGGG + Intergenic
1201890475 Y:18938336-18938358 CAACACAAGAAGAAGGAATTTGG + Intergenic
1202143497 Y:21753518-21753540 AAGAAAAAGAAAAAGTAGATAGG - Intergenic
1202247224 Y:22832546-22832568 TAGTAAAAGAAGCAGGAGCTTGG + Intergenic
1202274499 Y:23101682-23101704 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202291528 Y:23319004-23319026 AAGAAAAATAAAATGGAGTTGGG - Intergenic
1202400213 Y:24466294-24466316 TAGTAAAAGAAGCAGGAGCTTGG + Intergenic
1202427492 Y:24735417-24735439 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202443299 Y:24934677-24934699 AAGAAAAATAAAATGGAGTTGGG - Intergenic
1202470568 Y:25203792-25203814 TAGTAAAAGAAGCAGGAGCTTGG - Intergenic