ID: 1007114830

View in Genome Browser
Species Human (GRCh38)
Location 6:39336020-39336042
Sequence CCCAGCCACAGGCAAGGCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2094
Summary {0: 1, 1: 1, 2: 5, 3: 107, 4: 1980}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007114830_1007114835 1 Left 1007114830 6:39336020-39336042 CCACTGCCTTGCCTGTGGCTGGG 0: 1
1: 1
2: 5
3: 107
4: 1980
Right 1007114835 6:39336044-39336066 CATCCTGCCTGGACCTGTCATGG 0: 1
1: 0
2: 2
3: 22
4: 242
1007114830_1007114838 11 Left 1007114830 6:39336020-39336042 CCACTGCCTTGCCTGTGGCTGGG 0: 1
1: 1
2: 5
3: 107
4: 1980
Right 1007114838 6:39336054-39336076 GGACCTGTCATGGCCATTTCTGG 0: 1
1: 1
2: 0
3: 11
4: 110
1007114830_1007114834 -10 Left 1007114830 6:39336020-39336042 CCACTGCCTTGCCTGTGGCTGGG 0: 1
1: 1
2: 5
3: 107
4: 1980
Right 1007114834 6:39336033-39336055 TGTGGCTGGGACATCCTGCCTGG 0: 1
1: 0
2: 0
3: 36
4: 230
1007114830_1007114839 12 Left 1007114830 6:39336020-39336042 CCACTGCCTTGCCTGTGGCTGGG 0: 1
1: 1
2: 5
3: 107
4: 1980
Right 1007114839 6:39336055-39336077 GACCTGTCATGGCCATTTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007114830 Original CRISPR CCCAGCCACAGGCAAGGCAG TGG (reversed) Exonic
Too many off-targets to display for this crispr