ID: 1007115768

View in Genome Browser
Species Human (GRCh38)
Location 6:39342178-39342200
Sequence GAGCAGCTACGCCGCGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007115768_1007115771 25 Left 1007115768 6:39342178-39342200 CCCAGAACGCGGCGTAGCTGCTC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1007115771 6:39342226-39342248 TAAAGTTATCTTCTCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007115768 Original CRISPR GAGCAGCTACGCCGCGTTCT GGG (reversed) Intronic
911072930 1:93846760-93846782 GGGCAGCTGCGCGGCGTCCTTGG + Intronic
915995421 1:160557860-160557882 AAGCAGCTGTGCCGCGTTGTAGG - Intronic
921914007 1:220586205-220586227 GAGAAGCTACGGCGAGTTCATGG - Intronic
1067889983 10:50126606-50126628 GAGGAGCTCCACAGCGTTCTGGG - Intronic
1072757279 10:98029876-98029898 TAGCAGCTACGCCGCGCGCGGGG + Intronic
1098293543 12:68981400-68981422 GAGTAGCTACCCCAAGTTCTGGG + Intergenic
1101794382 12:107959281-107959303 GAGCAGCTGGGCCTGGTTCTGGG + Intergenic
1103864744 12:124042862-124042884 GAGCAGCCACGCAGGGTACTGGG - Intronic
1104378848 12:128289494-128289516 AACCAGGTACGCCGTGTTCTTGG - Intronic
1118797097 14:69153274-69153296 GGGCGCCGACGCCGCGTTCTCGG - Intergenic
1124600880 15:31132072-31132094 CAGCTGTTACGCCGTGTTCTGGG + Intronic
1140474001 16:75229530-75229552 CAGCAGTTCCGCCGCGTCCTAGG - Exonic
1143866157 17:9925607-9925629 GAGCAGCTTCTCCGTGTCCTTGG - Intronic
1152218407 17:79047668-79047690 GAGCCACTACGCCGCCTTTTCGG + Exonic
1152734421 17:81990429-81990451 GAACAGCCACGCCGAGCTCTGGG + Intronic
1162480524 19:10924481-10924503 GAGCAGCCAGGCCCAGTTCTTGG + Intronic
1167991709 19:53366112-53366134 GAGCTGCGACGCTGCGCTCTAGG - Intronic
935110933 2:100093620-100093642 AAGCAGCTATGCCATGTTCTGGG + Intronic
936124043 2:109771542-109771564 AAGCAGCTATGCCATGTTCTGGG - Intergenic
936220646 2:110599922-110599944 AAGCAGCTATGCCATGTTCTGGG + Intergenic
942665755 2:178315224-178315246 GAGCAGCTCCACAGCTTTCTTGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1174076259 20:47939522-47939544 GAGCACCTACACCACGTACTTGG + Intergenic
1183095794 22:35551611-35551633 GGGCAGCTCCGCCGCCTCCTTGG - Exonic
968442245 4:629843-629865 GAGCAGCTGGGCCTCGCTCTGGG - Intronic
992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG + Intronic
1002309808 5:178307484-178307506 GAGCTGCTCAGCCGCCTTCTGGG + Intronic
1002765148 6:232903-232925 GAGCAACTACGACGTGTGCTGGG + Intergenic
1007115768 6:39342178-39342200 GAGCAGCTACGCCGCGTTCTGGG - Intronic
1011406041 6:87016282-87016304 GAGCATCTACACCGTGTCCTCGG + Exonic
1016624068 6:146145467-146145489 GAGCAGCTGCGCAGTGTGCTTGG - Intronic
1019428263 7:987358-987380 GAGGAGCTAGACCGCGTGCTGGG + Exonic
1048360819 8:133695761-133695783 GAGCAGCTAGGTCTAGTTCTTGG + Intergenic
1053407770 9:37892382-37892404 GAGCAGCGGCATCGCGTTCTTGG + Intronic
1188005569 X:25013766-25013788 GAGCAGCAGCGCCCCGTTCGAGG - Exonic