ID: 1007116733

View in Genome Browser
Species Human (GRCh38)
Location 6:39348346-39348368
Sequence GATCACACCGTGGCCAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007116733 Original CRISPR GATCACACCGTGGCCAATAG GGG Intronic
906806834 1:48787313-48787335 GATCTCACCTGGACCAATAGGGG - Intronic
912163840 1:107019056-107019078 GATGCCACTGTGGCCAACAGGGG + Intergenic
1067059885 10:43072866-43072888 GATGACACCGAGGCCCAGAGAGG + Intergenic
1083179765 11:60977571-60977593 GATGACACCTTGGCCAACACTGG - Intronic
1098241481 12:68471861-68471883 GAACACAATGTGGCCAAAAGAGG + Intergenic
1098405478 12:70121798-70121820 GTCCACACCCTGGCCAGTAGAGG + Intergenic
1101387680 12:104272266-104272288 GATCTAACCTTAGCCAATAGGGG - Intronic
1105076125 13:16025816-16025838 GAGCGCTCTGTGGCCAATAGTGG + Intergenic
1105076518 13:16033656-16033678 GAGCGCTCTGTGGCCAATAGTGG + Intergenic
1105077339 13:16049324-16049346 GAGCACTCTGTGGCCCATAGTGG + Intergenic
1105078540 13:16072470-16072492 GAGCGCTCTGTGGCCAATAGTGG + Intergenic
1105079138 13:16084046-16084068 GAGCGCTCTGTGGCCAATAGTGG + Intergenic
1107997580 13:45876032-45876054 GATCTAACCTTAGCCAATAGGGG - Intergenic
1112241263 13:97683859-97683881 CAAGACACCGTGGCCAATACGGG - Intergenic
1113463624 13:110498457-110498479 GTGCACACAGTGGCCCATAGAGG + Intronic
1114587539 14:23827850-23827872 CATCACCCAGTGGCCTATAGTGG + Intergenic
1120395717 14:83964673-83964695 GGTCTAACCCTGGCCAATAGGGG + Intergenic
1136370899 16:29835445-29835467 GATCACAGCCTGGGCAACAGAGG + Intronic
1136907371 16:34110398-34110420 GAGCACTTTGTGGCCAATAGTGG + Intergenic
1143510162 17:7390916-7390938 GATCACTCGGTGACCATTAGAGG - Intronic
1143795774 17:9335165-9335187 GATCCAACCCTAGCCAATAGGGG + Intronic
1151321389 17:73354665-73354687 GGTCACCCAGTGGCCAACAGTGG + Intronic
1157802979 18:50635902-50635924 GACCACACCATGGACTATAGTGG - Intronic
1164112088 19:22175037-22175059 GATCACACAGTGGCCAGTCATGG - Intergenic
1164196573 19:22970767-22970789 GATCACACAGTGGCCAGTCATGG - Intergenic
1164347997 19:27292088-27292110 GAGCACATTGTGGCCTATAGTGG + Intergenic
927575543 2:24199211-24199233 GGTCTAACCCTGGCCAATAGGGG - Intronic
1171734565 20:28760219-28760241 GAGCACTCTGTGGCCTATAGTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1176533550 21:8005544-8005566 GAGCACTCTGTGGCCCATAGTGG - Intergenic
1176533961 21:8013369-8013391 GAGCGCTCTGTGGCCAATAGTGG - Intergenic
1176534161 21:8017283-8017305 GAGCGCTCTGTGGCCAATAGTGG - Intergenic
1176534475 21:8023578-8023600 GAGCGCTCTGTGGCCAATAGTGG - Intergenic
1176534646 21:8026819-8026841 GAGCGCTCTGTGGCCAATAGTGG - Intergenic
1176534820 21:8030058-8030080 GAGCGCTCTGTGGCCAATAGTGG - Intergenic
1176535222 21:8037884-8037906 GAGCGCTCTGTGGCCAATAGTGG - Intergenic
1176535414 21:8041625-8041647 GAGCCCTCTGTGGCCAATAGTGG - Intergenic
1176979618 21:15366064-15366086 GGTCCAACCGTAGCCAATAGAGG - Intergenic
1177120168 21:17128268-17128290 GATCAGCCCGTGGACAATACCGG + Intergenic
1179505651 21:41838497-41838519 GATCACATCATCGCCAATACTGG + Intronic
958201237 3:90318050-90318072 GAGCACATTGTGGCCTATAGTGG - Intergenic
960720904 3:120623493-120623515 GATCTAACCCTAGCCAATAGGGG - Intergenic
961871608 3:129992669-129992691 GATCACACCCTGACCCACAGAGG - Intergenic
970219066 4:13789522-13789544 GATCACACCGTGCCCAAATAAGG - Intergenic
973006768 4:45017525-45017547 GATCTAACCCTAGCCAATAGAGG + Intergenic
976011377 4:80493371-80493393 GATCTAACCCTAGCCAATAGGGG - Intronic
976909173 4:90279167-90279189 GATTACACCATGCCCAATATAGG - Intronic
980934578 4:139214120-139214142 GATCTCAGAGTGGCCAACAGTGG - Intergenic
986987340 5:13514531-13514553 GTTCAAACCGTGGCCAAAAGGGG + Intergenic
997204128 5:132031669-132031691 GACCACACAGTGGCCAATCTAGG + Intergenic
997978090 5:138452001-138452023 AATCACACCGTGGGAAATCGAGG - Intergenic
1003459353 6:6315848-6315870 GTTCACCCAGTGGCCACTAGTGG - Intronic
1003901870 6:10662044-10662066 GATCCCACCGCTGCCAAAAGGGG - Intergenic
1006282896 6:33069507-33069529 GATCAGCCCATGGCCACTAGGGG + Intronic
1007116733 6:39348346-39348368 GATCACACCGTGGCCAATAGGGG + Intronic
1015457322 6:133441573-133441595 CATCTCACCATAGCCAATAGGGG - Intronic
1024354331 7:48398930-48398952 GATCACACCCTCACCATTAGTGG - Intronic
1026656246 7:72259177-72259199 GATCACAAGGTGGTCAATGGTGG - Intronic
1043598374 8:81911409-81911431 CATCCAACCGTAGCCAATAGGGG - Intergenic
1047326277 8:123839306-123839328 GATCACACAGTGGCCAAGTCAGG + Intergenic
1048382853 8:133883407-133883429 GATCACACAGAGGTCAATTGTGG - Intergenic
1051430362 9:16975697-16975719 GCTCACACCTTTGCCAACAGTGG - Intergenic
1053448343 9:38170955-38170977 GATCCAACCCTAGCCAATAGGGG - Intergenic
1054800388 9:69342404-69342426 CATCTCACTGTGGCCAACAGTGG + Intronic
1056722112 9:89081547-89081569 GGTCACACAGTGGCCAGAAGAGG - Intronic
1203381345 Un_KI270435v1:48985-49007 GAGCACTCTGTGGCCGATAGTGG + Intergenic
1203385036 Un_KI270438v1:29292-29314 GAGCGCTCTGTGGCCAATAGTGG + Intergenic
1188449189 X:30291058-30291080 GAAGACACCGTGGGCAATATGGG - Intergenic
1189596440 X:42571260-42571282 GACCACACCGTGGCAAACATTGG + Intergenic
1191570602 X:62612153-62612175 GAGCACACTGTGGCCGATGGCGG + Intergenic
1195846614 X:109236134-109236156 GATCTAACCCTAGCCAATAGGGG - Intergenic