ID: 1007122679

View in Genome Browser
Species Human (GRCh38)
Location 6:39396413-39396435
Sequence CCGAGCCCAGCAGGTGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007122672_1007122679 0 Left 1007122672 6:39396390-39396412 CCATCCAAGGGAGCCAACGGGGG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG 0: 1
1: 0
2: 1
3: 15
4: 227
1007122674_1007122679 -4 Left 1007122674 6:39396394-39396416 CCAAGGGAGCCAACGGGGGCCGA 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG 0: 1
1: 0
2: 1
3: 15
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007122679 Original CRISPR CCGAGCCCAGCAGGTGCACT GGG Intronic
900386535 1:2413319-2413341 CTGAGCCCCGCAGGTGCTCTGGG + Intronic
900699411 1:4034811-4034833 CGGAGCCCAGTAGCTCCACTGGG + Intergenic
900941234 1:5799974-5799996 CCCAGCCCAGCAGGTGAGGTGGG + Intergenic
901205672 1:7494470-7494492 CAGACCCCAGCAGCTGCTCTTGG - Intronic
907593046 1:55694040-55694062 CCCAACCCAGCAGGTGATCTGGG + Intergenic
909735343 1:78952356-78952378 ATGAGCCCAGCAGCTGCATTGGG - Intronic
910805855 1:91189340-91189362 ACGAGCCCAGCAGGAGCAGGGGG + Intergenic
911088061 1:93996038-93996060 CAGAGCCCAGCTGGTTCACTGGG - Intronic
913079154 1:115365747-115365769 CCCACCCCAGCAGGTACACAAGG - Intergenic
913326611 1:117633647-117633669 CCCAGCCCAGCAGCTGGACACGG - Intergenic
918040898 1:180913182-180913204 CCGAACCCAGCAGCTGGCCTGGG + Exonic
919928944 1:202208803-202208825 CCACCCCCAGCAGGTGCCCTGGG - Intronic
920746957 1:208637974-208637996 CTGATCCCAGCATGTCCACTAGG + Intergenic
924093536 1:240526506-240526528 CCGAGGCTAGCAGCTGCACCAGG - Intronic
1063148951 10:3320042-3320064 CCCAGGCCAGCAGGTGCAGAGGG - Intergenic
1067434411 10:46266776-46266798 CAGAGCCCAGCTGCTGCTCTGGG + Intergenic
1070688340 10:78506688-78506710 GAGAGCCCTGCAGGTGCTCTGGG - Intergenic
1071903007 10:90140926-90140948 CAGAGCCCTGCAGGATCACTGGG - Intergenic
1072381687 10:94879173-94879195 CTGAGCCCAGTAGCTCCACTGGG - Intergenic
1073484864 10:103810355-103810377 CACAGCCCAGCAGGGGCAGTGGG + Intronic
1074232072 10:111547508-111547530 CAGAGGCCAGCATGTGCACTTGG + Intergenic
1076805474 10:132855993-132856015 CTGAGCCCTGCAGGAGCTCTTGG - Intronic
1076829483 10:132986760-132986782 CTGAGGCCAGCAGGTGCAGCGGG + Intergenic
1077492624 11:2869092-2869114 CCCAGCCCAGCTGATGGACTGGG - Intergenic
1081644506 11:44780334-44780356 CCAAGCCCAGCAGGGGCTCCAGG + Intronic
1081666289 11:44918851-44918873 CAGAGCCAAGCAGATGCCCTGGG - Intronic
1081667765 11:44926597-44926619 CAGAGTCCAGCATGTGGACTAGG - Intronic
1083472890 11:62896088-62896110 CCGCGCCCAGCTGGAGCACCTGG + Intergenic
1084410608 11:69004126-69004148 CCGAGCTGAGAAGGGGCACTGGG + Intergenic
1085350730 11:75796546-75796568 CAGTGCCCAGCAGGAGCACAGGG - Intronic
1086844427 11:91730766-91730788 CAGAGCCCAGTAGCTCCACTGGG + Intergenic
1087804393 11:102539713-102539735 CAGAGCCCAGTAGCTACACTGGG + Intergenic
1088797037 11:113273291-113273313 CCGACACCAGCAGGGGCGCTTGG - Intronic
1088951229 11:114572108-114572130 CAGAGCCCAGTAGCTCCACTGGG + Intronic
1089980763 11:122770402-122770424 CCCAGACCAGCAGGTTCTCTAGG - Intronic
1091178053 11:133579442-133579464 CCGAGCACAGCAGGGGCACGGGG - Intergenic
1091563368 12:1630541-1630563 CCTTGCCCAGCAGCTGCACCGGG - Intronic
1091599323 12:1908482-1908504 CCGAGTCCCGCAGCTGCCCTCGG + Intronic
1093291024 12:17322288-17322310 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
1093604433 12:21073334-21073356 CAGAGCCCAGTAGCTCCACTGGG - Intronic
1098110964 12:67121380-67121402 CACAGCCTAGCAGGTGCAATGGG + Intergenic
1103003421 12:117403419-117403441 CTGTGCCCAGCAGGAGCAGTCGG + Intronic
1103727497 12:123005316-123005338 CGGAGCCCAGCAGCAGCAATGGG - Exonic
1103865078 12:124045211-124045233 CCAAGCACAGCAGGTGTCCTTGG + Intronic
1104464212 12:128977604-128977626 CGGGGCCCAGCAGGTGAAGTGGG - Intronic
1104477371 12:129081881-129081903 CTGAGCCCAGCAGGTGGGCCAGG + Exonic
1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG + Intronic
1105834020 13:24192876-24192898 CAGAGCCCAGCAGGTGGTCCTGG + Intronic
1106961358 13:35002160-35002182 CTGAGACCAGCAGTTGCAGTTGG + Intronic
1107426749 13:40301641-40301663 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
1108777411 13:53783702-53783724 CCCTGGGCAGCAGGTGCACTTGG + Intergenic
1111965721 13:94859521-94859543 CAGAGCTCTGCAGCTGCACTTGG - Intergenic
1113109128 13:106803064-106803086 CGAAGCCCACCAGGTGCAATCGG - Intergenic
1117271436 14:54147438-54147460 CAGAGCCCAGTAGCTCCACTGGG + Intergenic
1123450436 15:20356606-20356628 CCCAGCCCTGGAGGTGCCCTCGG - Intergenic
1126850720 15:52795294-52795316 CCAAGAGCAGCAGCTGCACTTGG + Intergenic
1128075658 15:64823909-64823931 GCGGGCCCAGCAGCTGCGCTCGG + Exonic
1130023571 15:80251686-80251708 CCGAGCCCCGCAGTGGAACTCGG + Intergenic
1132207085 15:99993633-99993655 CCAAGCACAGCATGTGCACCTGG - Intronic
1132649119 16:1012607-1012629 CAGAGCCCAGCAGCTCCTCTGGG + Intergenic
1132747634 16:1443571-1443593 CTGAGCCCTGCAGCTGCACGCGG + Exonic
1133259249 16:4537991-4538013 CCGAGCCCCGCGGGTGACCTTGG - Intronic
1135622801 16:23970345-23970367 CAGAGCCCAGGTGGTGCTCTGGG - Intronic
1137677050 16:50308897-50308919 CCGAGCTCAGCAGGTGGATGTGG + Intronic
1139153705 16:64415477-64415499 CCCAGCCCTGCAGTGGCACTTGG + Intergenic
1139377682 16:66510516-66510538 ACTGGCCCAGCAGGGGCACTTGG + Exonic
1139466206 16:67155367-67155389 CCTAGCCCAGCAGGTGCGGCCGG - Exonic
1142709350 17:1715142-1715164 CTGTGCCAAGCAGGTGCCCTTGG + Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1144504331 17:15817343-15817365 CAGAGCCCAGGAGGGGCGCTGGG + Intergenic
1144634084 17:16893011-16893033 CAGAGCCCAGGAGGGGCGCTGGG + Intergenic
1144880711 17:18429160-18429182 GAGAGCACAGCAGGCGCACTGGG + Intergenic
1145151524 17:20515227-20515249 GAGAGCACAGCAGGCGCACTGGG - Intergenic
1146162872 17:30569477-30569499 CAGAGCAGAGCAGGCGCACTGGG - Intergenic
1147909975 17:43849549-43849571 CTTAGCTCAGCAGGTCCACTTGG - Intronic
1149414450 17:56444750-56444772 CAGAGCCCAGCATTTGAACTGGG + Intronic
1151850197 17:76685446-76685468 CCCTGCCCAGCAGGTCCTCTCGG + Intronic
1152157336 17:78643517-78643539 TCGAGCCCCGCAGGCGCCCTCGG - Intergenic
1152338006 17:79708733-79708755 CCCAGCCCTGGAGGTGCCCTCGG + Intergenic
1152429127 17:80237626-80237648 CCTAGCCCAGCCGGCGCACTGGG - Intronic
1152594067 17:81229652-81229674 ACCAGCCCAGCAGCTGCTCTCGG - Intronic
1152895103 17:82906335-82906357 CTGAGACCAGGAGGTGCACAAGG - Intronic
1159005348 18:63005519-63005541 CCGGGCCCAGCAGGTGCTTCTGG + Intergenic
1159176656 18:64844833-64844855 CAGAGCTCAGAAGGTGCACAAGG - Intergenic
1159369339 18:67511601-67511623 CTGAGCACAGGACGTGCACTTGG + Exonic
1160663870 19:313785-313807 CCAAGCCCAGGAGGAGCACAGGG - Intronic
1160947981 19:1652290-1652312 CCGCGCCCAGCAGGTGAGCCCGG - Exonic
1161014839 19:1978456-1978478 CCGGGCCCCGCAGCTGCACCTGG + Exonic
1161263384 19:3350448-3350470 CACAGCCAAGCAGGTGCAATGGG + Intergenic
1161302222 19:3548194-3548216 ACGAGCCCTGCAGGTGCAGCAGG + Exonic
1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG + Intronic
1162147379 19:8621082-8621104 GCCACCCCAGCAGGTGCACCAGG - Intergenic
1162262053 19:9541548-9541570 CCCAGGCCAGCAGCTGCACAGGG - Intergenic
1163565669 19:18049700-18049722 CAGAGCCCAGCAGCTGGACCAGG + Intergenic
1163967974 19:20765613-20765635 CAGAGCCCAGTAGCTCCACTGGG + Intronic
1164519622 19:28968704-28968726 CCCAGCACAGCAAGTGCAGTGGG - Intergenic
1165930523 19:39355477-39355499 CTGAGCCCAGTAGGTTCAATGGG + Intronic
1166358766 19:42242940-42242962 CCGAGACCCGCAGGTTCACGCGG - Intronic
1168523171 19:57068799-57068821 CCAAGCCCAGGAGGTGGGCTGGG + Intergenic
925065412 2:925884-925906 CCAACCCCAGCAGGTGCTCTCGG - Intergenic
925173479 2:1766983-1767005 CAGAGCTCAGCAGGGGGACTGGG - Intergenic
925813381 2:7723597-7723619 CCGCTCCCAGCAGGTGCAGCAGG - Intergenic
926113357 2:10196400-10196422 CAGAGACCAGCAGGAGCCCTGGG + Intronic
926131311 2:10304450-10304472 CCGAGGCCAGCAGCTGGACTCGG - Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
931535887 2:63276084-63276106 CAGAGCCCAGTAGCTCCACTGGG + Intronic
932335335 2:70927910-70927932 GACAGCCCAGAAGGTGCACTGGG + Intronic
932672861 2:73753382-73753404 CCCAGCCCAGGAGGGGCACTGGG - Intergenic
933952372 2:87342106-87342128 TCGAGCCTGGAAGGTGCACTGGG + Intergenic
936067518 2:109343631-109343653 TCGAGCCCAGCAGGTGGGTTGGG + Intronic
936164394 2:110107206-110107228 CAGAGCCCAGAAGCTGCCCTTGG - Intronic
936504895 2:113098378-113098400 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
937348645 2:121144382-121144404 CTGACTCCAGCAAGTGCACTGGG + Intergenic
938216519 2:129522467-129522489 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
938588599 2:132715828-132715850 GCCTGCCCAGCAGGTGCACCAGG - Intronic
940271168 2:151891964-151891986 CTGATCCCGGCAGTTGCACTTGG + Intronic
941131204 2:161651860-161651882 CTCAGCTGAGCAGGTGCACTCGG - Intronic
942569778 2:177302259-177302281 CCCAGCCCAGCAGGTTTAGTGGG + Intronic
945285667 2:208078869-208078891 CAGAGCCCAGTAGCTCCACTGGG + Intergenic
948280456 2:236743310-236743332 CGGAGCACAGCTGGTGTACTAGG + Intergenic
1169136922 20:3203252-3203274 TCGAGCCCAGCGGGTGGCCTGGG - Exonic
1173361386 20:42347525-42347547 CCGAGCACACCAGATGCACCAGG + Intronic
1173539185 20:43838583-43838605 CCCAGCCCTGCAGGTGCTCAGGG + Intergenic
1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG + Intergenic
1174452848 20:50630438-50630460 CTGAGCTTAGCAGGTCCACTTGG - Intronic
1175669650 20:60890929-60890951 CCGGGCCCTTCAGGTGAACTGGG + Intergenic
1178315001 21:31559863-31559885 CCGTGCCCAGCAAGCGAACTTGG + Intronic
1178826924 21:36024937-36024959 CCGAGCTCCACAGGTGCATTAGG - Intergenic
1179256756 21:39723358-39723380 CCCTTCTCAGCAGGTGCACTTGG - Intergenic
1179382090 21:40909106-40909128 GGGAGCCAAGCAGGTGCTCTGGG - Intergenic
1179888531 21:44324766-44324788 CCGGGGCCAGCAGGAGCACTGGG - Intronic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1181009675 22:20032985-20033007 CCAAGCCCTGCAGGTTCCCTAGG - Intronic
1181747547 22:24966330-24966352 GGGAGCCCAGCGGGTGCATTGGG + Intronic
1183522630 22:38304154-38304176 GCGAGCCCAGCAGGAGGAGTAGG + Intronic
1184433897 22:44458504-44458526 CAGAGCCCTGCAGCTGCCCTGGG - Intergenic
1185176572 22:49330733-49330755 CCGAGACCAGCAGGCACCCTGGG + Intergenic
950891116 3:16405196-16405218 ACCAGCCCATCAGGTGCACCTGG - Intronic
950958142 3:17077088-17077110 CAGAGCCCAGCAGTCCCACTGGG - Intronic
959932377 3:111998735-111998757 ACGAGGCCAGCAGCTGCACAAGG - Exonic
960756536 3:121019629-121019651 CAGAGCCCAGTAGCTCCACTAGG + Intronic
961602527 3:128072587-128072609 CTGAGGCCAGCAGGTGCAGAGGG - Intronic
961635568 3:128330693-128330715 CCGAGCCCAGCCTGGGCACAAGG + Intronic
963082780 3:141409916-141409938 CCCAGCCCTGCAGGGGCTCTGGG - Intronic
964017555 3:151965439-151965461 CAGAGCCCAGTAGATCCACTGGG + Intergenic
965060961 3:163785868-163785890 CAGAGCTCAGCAGCTCCACTGGG - Intergenic
966352672 3:179047211-179047233 CAGAGCCCAGTAGCTCCACTAGG + Intronic
966839397 3:184076551-184076573 TGGAGCCCAGAAGGTGTACTTGG + Intergenic
967284812 3:187858749-187858771 CCGCTGTCAGCAGGTGCACTGGG - Intergenic
968733163 4:2281205-2281227 CCAAGCCCAGCCGGTTCCCTTGG - Intronic
968846068 4:3042180-3042202 CCGGCTCCAGCAGGGGCACTGGG + Intergenic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
969700744 4:8766308-8766330 CAGAGCCCTGCATGTGTACTGGG - Intergenic
969778926 4:9381128-9381150 CCGGGCCCAGCGGGGGCACCCGG + Intergenic
971104779 4:23512411-23512433 ACCAGCCCAGCAGGGGCATTGGG + Intergenic
971370405 4:26014579-26014601 ACAAGCCCAGCAGGTGGAATGGG + Intergenic
975203162 4:71615237-71615259 CAGAGCCCAGTAGCTCCACTGGG + Intergenic
975270773 4:72430350-72430372 CAGAGCCCAGCAGCCACACTGGG + Intronic
975928632 4:79491457-79491479 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
977885160 4:102245181-102245203 CCCAGGCCAGCAGGTGCAGAGGG + Intergenic
980077636 4:128310313-128310335 CCGAGGCCAGCTGTTGCTCTTGG + Intergenic
981429958 4:144646603-144646625 CACTGCCCAGCAGGGGCACTAGG - Exonic
982800224 4:159697184-159697206 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
985675501 5:1229523-1229545 TCCAGGCCAGCAGGTGCCCTGGG - Intronic
985798654 5:1985872-1985894 CCTAGCCCAGCAGATGCTCCAGG + Intergenic
987475661 5:18389410-18389432 CCGTGCCCAGCACATGGACTGGG - Intergenic
989147028 5:38258885-38258907 CGGAGCCCAGCAGGGGCGCTCGG - Intronic
992599779 5:78387743-78387765 CAGAGCCCAGTAGCTCCACTGGG - Intronic
994117813 5:96080841-96080863 CCTAGCTCAGCTGGGGCACTTGG - Intergenic
995374970 5:111463697-111463719 CAGACCCCAGCAGCTCCACTGGG + Intronic
997262748 5:132476862-132476884 ACAAGCCAAGCAGGAGCACTTGG + Intergenic
997340849 5:133143495-133143517 CTGAACCCAGCAGGTGTAGTGGG + Intergenic
997798267 5:136833679-136833701 CAGAGCCCAGTAGATCCACTGGG - Intergenic
997831898 5:137157545-137157567 CCCAGCCCAGCAAAAGCACTGGG - Intronic
998499222 5:142617472-142617494 CAGAGCCCAGCAGGTCCTCAGGG + Intronic
999147927 5:149407985-149408007 CCGAGCCCTCCAGATGAACTTGG + Intergenic
999263562 5:150252183-150252205 CCCTGCCCCTCAGGTGCACTTGG + Intronic
1002067864 5:176661216-176661238 CCCAGCCCAGCAAGTGGGCTCGG - Intergenic
1002122618 5:177017112-177017134 CCAAGCCCAGCAGGGGCCCAGGG - Intronic
1002160647 5:177312260-177312282 CCGGGCCCAGCCGCTGCACGTGG + Exonic
1002895684 6:1378839-1378861 CGGAGCGAAGCAGGTGCACGCGG - Intergenic
1004516256 6:16324838-16324860 CCAAGCCCAGCAGGTCACCTGGG + Intronic
1005567293 6:27109194-27109216 CAGAGCCCTTCAGGTGCACTTGG + Intergenic
1006585272 6:35106451-35106473 CCAAGCCCTGCAGGTGCATAAGG + Intergenic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1007357659 6:41333011-41333033 CTGAGCCCAGGAGGAGCACCAGG + Intergenic
1007498618 6:42279175-42279197 CAGGGCCCAGGAGGTGCAGTAGG + Intronic
1007857909 6:44877174-44877196 CCGTGCCCAGCCCATGCACTGGG - Intronic
1011771551 6:90678887-90678909 CCTTGCAGAGCAGGTGCACTGGG - Intergenic
1012299165 6:97563297-97563319 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
1015830490 6:137363457-137363479 CCGACCCAAGCTGTTGCACTGGG - Intergenic
1016210960 6:141532433-141532455 CTCAGCCCAGCAGGACCACTTGG - Intergenic
1018832768 6:167457708-167457730 CCCCGCCCAGCAGGAGCTCTGGG + Intergenic
1019119826 6:169793704-169793726 CCGAGCACATCAGGGGCCCTGGG - Intergenic
1024044104 7:45575620-45575642 GCGAGCCCAGCACGCGCTCTAGG - Intronic
1024253097 7:47521022-47521044 TAGAGCCCAGTAGGTGCACAGGG - Intronic
1026527908 7:71171759-71171781 CCAAGCCCAGCAGCAGCTCTAGG - Intronic
1031261435 7:119525552-119525574 CAGAGCCCAGTAGCTCCACTGGG + Intergenic
1033243814 7:139702365-139702387 CTGAGCCCAGCATGTGGCCTTGG + Intronic
1034417147 7:150971226-150971248 CTGAGGCCTGCAGGAGCACTGGG + Intronic
1034725713 7:153333354-153333376 CCAAGCCAAGCAGGTGAATTAGG - Intergenic
1034933474 7:155182697-155182719 CCAAGCCCAGCAGGTCACCTGGG + Intergenic
1035175263 7:157045663-157045685 CCGGGCACAGCAGCAGCACTAGG - Intergenic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1037784464 8:21894430-21894452 CCAGGCCCAGCAGCTCCACTTGG - Intergenic
1037784581 8:21895023-21895045 CCAGGCCCAGCAGCTCCACTTGG + Intergenic
1037893664 8:22637430-22637452 CTGAGCCCAGCAGGGGCAGGTGG - Intronic
1038908821 8:31938262-31938284 CAGAGCCCAGTAGCTCCACTGGG + Intronic
1040399387 8:47033375-47033397 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
1040629692 8:49196303-49196325 CATAGCCCAGGAGGTGCACTGGG + Intergenic
1043785711 8:84397166-84397188 CAGATCCCAGAAGGTGCCCTTGG - Intronic
1045507575 8:102789360-102789382 CGGGGCCCAGCAGCTGCAGTAGG - Intergenic
1047186596 8:122638914-122638936 CGGAGCCCAGCAGGGACACGTGG + Intergenic
1047901810 8:129431346-129431368 CAGAGCCCAGTAGCTCCACTGGG - Intergenic
1049221585 8:141431125-141431147 CCCAGCCCAGCAGGGGCTCCAGG + Exonic
1049607839 8:143537918-143537940 CCGAGCTCAGCAGATCCATTAGG + Intronic
1049834001 8:144721346-144721368 GTGAGCCCAGCTGGTGCTCTGGG - Exonic
1049968255 9:798594-798616 CAGAGCACAGTACGTGCACTAGG - Intergenic
1051687622 9:19675142-19675164 CAGAGCCCAGTAGCTCCACTGGG - Intronic
1053160477 9:35810391-35810413 CAGAGCCCAGCTGGTGCAAGTGG + Intronic
1060311113 9:122463712-122463734 CAGAGCCCAGTAGCTTCACTGGG - Intergenic
1060849283 9:126860938-126860960 CTGACCCCAGCAGGTGCCCGGGG - Intronic
1061062590 9:128258084-128258106 CCGAGGCCAGCAGGTGAGCCAGG + Exonic
1061443988 9:130627230-130627252 CCGAGCCCTGCTGCTACACTGGG - Intronic
1061800017 9:133108697-133108719 CCTGGCCCAGCTGGAGCACTCGG - Exonic
1061808609 9:133149661-133149683 CCGAGTCCAGCAGGTGGCATCGG - Intergenic
1061850647 9:133412959-133412981 CCCACCCCACCAGTTGCACTAGG - Intronic
1062035710 9:134381686-134381708 CAGAGCCCCTCAGGTGGACTTGG + Intronic
1062140144 9:134951643-134951665 CCCAGCCCCGCCGGTGCTCTGGG + Intergenic
1062218591 9:135402476-135402498 CAGAGCCTAGCATGTGGACTGGG + Intergenic
1062228126 9:135465406-135465428 CCCAGACCAGCAGGAGCACGGGG + Intergenic
1062336791 9:136074790-136074812 CCGAGCCCCGCAGGTGAGCTGGG - Intronic
1062609294 9:137366798-137366820 CAGAGCCCAGCAGGAGCCTTGGG - Intronic
1062680642 9:137777955-137777977 CCAAGCCCAGCAGGTCCCGTTGG - Exonic
1186349978 X:8731367-8731389 CCCAGCCCCGCAGGTGCCCGCGG - Intronic
1187770137 X:22686432-22686454 GCAAGCCTTGCAGGTGCACTTGG + Intergenic
1189032892 X:37467862-37467884 CCTGGCCCAGGAGGGGCACTGGG - Intronic
1191937038 X:66437415-66437437 CCAAGGCCTGCAGGTGCTCTGGG - Intergenic
1192157858 X:68759645-68759667 CCCACCCCAGCAGCAGCACTGGG - Intergenic
1195237165 X:102911710-102911732 CGGAGCCCAGTAGCTCCACTGGG + Intergenic
1195308096 X:103605580-103605602 CCTAGCCCAGCTTTTGCACTAGG + Intergenic
1198420710 X:136468832-136468854 CCTAGCCCAGTACCTGCACTTGG + Intergenic
1199829854 X:151538626-151538648 TGGAGCCCAGCATATGCACTGGG - Intergenic
1200083858 X:153593151-153593173 CCGAGGACAGCATGTGCCCTTGG - Intronic