ID: 1007123131

View in Genome Browser
Species Human (GRCh38)
Location 6:39400151-39400173
Sequence GCACCCTGTTTGGCTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007123128_1007123131 6 Left 1007123128 6:39400122-39400144 CCATAATATTTTGGGAATAAGAA 0: 1
1: 0
2: 2
3: 47
4: 399
Right 1007123131 6:39400151-39400173 GCACCCTGTTTGGCTGTCACAGG 0: 1
1: 0
2: 0
3: 17
4: 377
1007123125_1007123131 22 Left 1007123125 6:39400106-39400128 CCAGGAGGGACTTTGGCCATAAT 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1007123131 6:39400151-39400173 GCACCCTGTTTGGCTGTCACAGG 0: 1
1: 0
2: 0
3: 17
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007123131 Original CRISPR GCACCCTGTTTGGCTGTCAC AGG Intronic
900158305 1:1212257-1212279 GCAGCGTCCTTGGCTGTCACTGG - Intronic
900598664 1:3493818-3493840 GCACCCTGTGACCCTGTCACCGG - Exonic
901800541 1:11705567-11705589 GAACCCCGTGTGGCTGTCCCAGG - Intronic
903107132 1:21091783-21091805 GCTCTCTGTTTGTCTGTCATTGG + Intronic
904901386 1:33860153-33860175 GCCCACTTTTTGTCTGTCACAGG + Intronic
906801018 1:48736994-48737016 CCACCATGCCTGGCTGTCACTGG - Intronic
906862831 1:49380201-49380223 GCTCTCTGTTTGGCTGTTATTGG - Intronic
908305625 1:62812821-62812843 GCTCTCTGTTTGTCTATCACTGG - Intronic
909260896 1:73488088-73488110 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
909697014 1:78479204-78479226 GCCCTCTGTTTGTCTGTTACTGG + Intronic
909739949 1:79015653-79015675 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
909807531 1:79890351-79890373 GCACTCTGTTTGTCTGTTATTGG + Intergenic
910296028 1:85646209-85646231 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
910929862 1:92432551-92432573 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
911766455 1:101681423-101681445 GCACCCTGCCTGACTGCCACTGG + Intergenic
911813087 1:102308955-102308977 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
912186275 1:107279948-107279970 CCACCATGTTTGGCTTTCAATGG + Intronic
912760416 1:112361155-112361177 GCACCCTGTTAGACTGGCAGAGG + Intergenic
913066727 1:115262706-115262728 GCACCCTGTTTTCCAGCCACAGG + Intergenic
913411129 1:118552993-118553015 GCTCTCAGTTTGGCTGTCATTGG - Intergenic
913943148 1:125127269-125127291 GCACTCTGTTTGTCTGTTATTGG - Intergenic
916726166 1:167526075-167526097 GATGCCTGATTGGCTGTCACAGG - Intergenic
916976934 1:170090965-170090987 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
916978592 1:170109270-170109292 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
918537559 1:185590732-185590754 GCACTCTGTTTGTCTGTTATTGG - Intergenic
918733790 1:188032928-188032950 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
920853932 1:209648535-209648557 GCACCCTGTTTTGCTCTCAAGGG + Intronic
921007316 1:211107286-211107308 GCAAGCTGTCTGGCTATCACAGG - Exonic
921406306 1:214783505-214783527 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
921626584 1:217384045-217384067 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
922091081 1:222395705-222395727 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
922387627 1:225103681-225103703 GCTCTCTGTTTGTCTGTCATTGG + Intronic
922397169 1:225213698-225213720 GCTCTCTGTTTGTCTGTTACTGG + Intronic
922826290 1:228522484-228522506 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1063562379 10:7141141-7141163 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1065127836 10:22591233-22591255 GAATCCTATTTTGCTGTCACTGG - Intronic
1066001493 10:31108175-31108197 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1066035106 10:31473409-31473431 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1066138991 10:32484287-32484309 GCTCCCTGTTTGTCTGTTATTGG + Intronic
1066148949 10:32594340-32594362 GCTCCCTGTTTGTCTGTTATTGG + Intronic
1068196990 10:53730028-53730050 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1068652709 10:59540227-59540249 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1068970541 10:62953954-62953976 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1071001138 10:80831784-80831806 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1071152191 10:82648797-82648819 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1071928632 10:90440521-90440543 ACAGCCTGTTTGGCTGTGATTGG + Intergenic
1072013124 10:91321840-91321862 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
1072366419 10:94714969-94714991 GCACTCTGTTTGTCTGTTATTGG + Intronic
1072383503 10:94899511-94899533 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1072480262 10:95804477-95804499 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1074123344 10:110509450-110509472 GCACCCTGTCTGGCTGTGCCAGG - Intronic
1075224022 10:120609118-120609140 GCACACTGTTTTTCTGTCCCGGG + Intergenic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1077691952 11:4351243-4351265 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1077830870 11:5868636-5868658 GCACCCTGTTTGTCTGTTATTGG + Intronic
1079625124 11:22607931-22607953 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1081165279 11:39800799-39800821 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1081265084 11:41010992-41011014 GCCCTCTGTCTGGCTGTTACTGG + Intronic
1081459096 11:43254596-43254618 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085547105 11:77329984-77330006 GCTCTCTGTTTGTCTGTCATTGG - Intronic
1085908388 11:80792119-80792141 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1085965979 11:81526911-81526933 GCTCTCTGCTTGGCTGTCATTGG + Intergenic
1086687378 11:89748403-89748425 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1087003053 11:93440857-93440879 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1087179604 11:95128740-95128762 GCAGCCTGTTGTGCTGTCCCTGG + Exonic
1087483693 11:98734011-98734033 GGACCCTGGTGGGGTGTCACTGG + Intergenic
1088196704 11:107281762-107281784 GCTCTCTGTTTGTCTGTCACTGG + Intergenic
1088824350 11:113481454-113481476 GCACCCTGTTATGCTGTTCCTGG + Intergenic
1088948288 11:114537631-114537653 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1091052691 11:132387755-132387777 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1091108165 11:132942561-132942583 GCCCCTTGGATGGCTGTCACAGG - Intronic
1091307897 11:134550890-134550912 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
1091356713 11:134943275-134943297 GCACACTGTCTGGCTGGCTCAGG - Intergenic
1092661650 12:10745055-10745077 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1093008955 12:14083756-14083778 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1093579752 12:20773292-20773314 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1095603321 12:44038391-44038413 GCTCCCTGTGAGGCTGTGACTGG - Intronic
1097898446 12:64850063-64850085 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1098287971 12:68927719-68927741 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1099108297 12:78523294-78523316 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1100110309 12:91233848-91233870 GCTCTCTGTTTGTCTGTTACAGG - Intergenic
1100243489 12:92733236-92733258 TCACCCTGTGAGGCTGGCACTGG - Intronic
1102309172 12:111830953-111830975 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1102933231 12:116878291-116878313 CCACCCTATATGGCTGGCACAGG + Intronic
1103262085 12:119596192-119596214 GCAGACTGTCTGGCTGGCACTGG + Intronic
1104694728 12:130854613-130854635 TCACCCTGTGTGGGTATCACAGG + Intergenic
1106411661 13:29515152-29515174 CCACCTTGTGTGGCTGACACAGG + Intronic
1107314406 13:39115786-39115808 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
1109051128 13:57482573-57482595 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
1109381653 13:61569171-61569193 GCTCACTGTTTGTCTGTTACTGG - Intergenic
1111412816 13:87898235-87898257 GCTCTCTGTTTGGCTGTTATTGG - Intergenic
1111595509 13:90404859-90404881 GCTCCCTGTAAGGCTGTCCCTGG - Intergenic
1112222346 13:97503703-97503725 GCAACCTTTTTGGTAGTCACAGG + Intergenic
1113627694 13:111858634-111858656 TCACCCTGCTTGGCTGTCGGAGG + Intergenic
1115335006 14:32236387-32236409 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1116398221 14:44472980-44473002 GCTCTCTGTTTGGCTGTTATTGG + Intergenic
1116404687 14:44553341-44553363 GCTCTCTGTTTGGCTGTTATTGG + Intergenic
1116720061 14:48484684-48484706 GCTCTCTGTTTGGCTGTTATTGG - Intergenic
1117936211 14:60910115-60910137 GCTCTCTGTTTGTCTGTGACTGG + Intronic
1120950949 14:90041401-90041423 GAACGCTGTTTGTCTGTCTCTGG - Intronic
1120971153 14:90208567-90208589 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1123444449 15:20315236-20315258 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1124948037 15:34288775-34288797 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1126542109 15:49835013-49835035 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
1126867108 15:52948483-52948505 GCAGCCTGTCTGGCTGTTCCAGG + Intergenic
1128339208 15:66808660-66808682 GCACCATGTTTGGTGGTCATGGG + Intergenic
1129548415 15:76422410-76422432 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1131924318 15:97365202-97365224 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1132505489 16:306430-306452 CCACCCTGCTTGCTTGTCACAGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133692014 16:8224920-8224942 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1134237774 16:12481087-12481109 GCACATTGCTTGGCTGACACAGG - Intronic
1136602821 16:31307438-31307460 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1136770755 16:32838475-32838497 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1137083369 16:36093712-36093734 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1137304666 16:47186961-47186983 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1137824641 16:51481043-51481065 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1137972340 16:52998508-52998530 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1138102265 16:54262343-54262365 GCTCCCTGTTTGTCTGTTATTGG + Intronic
1138230027 16:55329944-55329966 GGACACTGATTGGCAGTCACTGG - Intronic
1138517266 16:57543049-57543071 GCACCTTGGATGGCTGTCAGGGG + Exonic
1138968827 16:62119720-62119742 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1139800247 16:69516645-69516667 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1203073177 16_KI270728v1_random:1100584-1100606 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1142595984 17:1030287-1030309 GCGCCCTGTTTGGCTGGCGCTGG + Intronic
1143293462 17:5851627-5851649 GCTCCCTGTTTGTCTGTTATTGG - Intronic
1145691074 17:26740042-26740064 GCACTCTGTTTGTCTGTTATTGG - Intergenic
1150091083 17:62325556-62325578 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1150568373 17:66363136-66363158 TCATCCTGTTTTGCTTTCACAGG + Intronic
1152426930 17:80223094-80223116 ACACCCTGTTTGGCTGTTTTTGG - Intronic
1152579806 17:81160828-81160850 CCACGCTGTTCTGCTGTCACCGG - Intronic
1154497956 18:14976029-14976051 GCACACTGTCTGGCTGGCTCAGG + Intergenic
1155318973 18:24599592-24599614 GCACCCTGCATGGTTGTCAGTGG - Intergenic
1157454069 18:47810520-47810542 GGACCTTGATTTGCTGTCACAGG - Exonic
1157773016 18:50366749-50366771 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1158114091 18:53975551-53975573 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1158494031 18:57937547-57937569 GCAGCCTGTTTTGCTCTCTCAGG - Intergenic
1158575531 18:58634430-58634452 CCACCCTGTTCTGCTGTCACAGG + Intergenic
1158615598 18:58983629-58983651 CCACCCTGCTTGGCTGTCCTGGG + Intronic
1160659803 19:292555-292577 GCACCCTGTTTTGGTGTTGCTGG - Intergenic
1160688975 19:452008-452030 GCCCCGTCTGTGGCTGTCACAGG + Intronic
1161326667 19:3667561-3667583 TCACCCTGGTTGGCAGCCACTGG + Intronic
1163630218 19:18414631-18414653 GCACCTTGTGTGGCTTTCACCGG - Intergenic
1164265980 19:23617850-23617872 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1166172348 19:41038438-41038460 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
925093935 2:1179416-1179438 GCTCCCTGTTTGTCTGTTATTGG - Intronic
925107722 2:1307532-1307554 GTAACGTGTTTGGATGTCACAGG + Intronic
925166442 2:1718810-1718832 TCAGCCTGTTTGGCTGTGGCAGG - Intronic
926312196 2:11682875-11682897 GCACCCTCTTTTGCTGTCATAGG + Intronic
928495305 2:31825492-31825514 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
928565070 2:32537052-32537074 GCTCTCTGTTTGTCTGTTACTGG + Intronic
928811692 2:35235225-35235247 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
930615709 2:53591240-53591262 GCTCTCTGTTTGGCTGTTATTGG - Intronic
930845207 2:55895959-55895981 GCACCTTGTCTGGCTGGCTCAGG + Intronic
931124855 2:59263797-59263819 GCTCTCTGTTTGGCTGTTATTGG - Intergenic
931130539 2:59330640-59330662 GCTCTCTGTTTGGCTGTTATTGG - Intergenic
931194582 2:60039193-60039215 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
931716810 2:65035622-65035644 GCACCCTGTTAGGCTGTGAGAGG + Intergenic
933018895 2:77166158-77166180 GCTCTCTGTTTGTCTGTCATTGG - Intronic
934617451 2:95782805-95782827 GCACTCTGTTTGTCTGTTATTGG - Intergenic
934643442 2:96041754-96041776 GCACTCTGTTTGTCTGTTATTGG + Intergenic
934765251 2:96876838-96876860 GCACCCTGCTGGGCTGGCTCGGG - Intronic
935200255 2:100850579-100850601 GCAACCCGTGTGTCTGTCACTGG + Intronic
935574475 2:104694678-104694700 CCACCCTGTTTTTGTGTCACTGG + Intergenic
935650002 2:105374082-105374104 GCAGTCTGTTTCTCTGTCACCGG - Intronic
937765531 2:125656400-125656422 GCACCCACTTTGGTTCTCACTGG + Intergenic
937865491 2:126748418-126748440 TCACTCAGCTTGGCTGTCACAGG + Intergenic
941041071 2:160624382-160624404 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
941236928 2:162986620-162986642 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
941259830 2:163283862-163283884 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
941896448 2:170633816-170633838 GCTCTCTGTTTGTCTGTTACTGG - Intronic
943306456 2:186268464-186268486 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
944178944 2:196865824-196865846 GCTCTCTGTTTGTCTGTTACTGG - Intronic
947061611 2:226172578-226172600 GGACCCTGTGAGGCTGTCATGGG - Intergenic
947529592 2:230900435-230900457 CCACCCTGTGTGCCTGGCACAGG - Intergenic
948955932 2:241291335-241291357 GCTCCCTGCCTGCCTGTCACAGG - Intronic
1169283258 20:4285516-4285538 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1171111269 20:22484588-22484610 GCTCCCTGATTGGCTGTCTGAGG - Intergenic
1171155707 20:22871381-22871403 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1171566903 20:26203049-26203071 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1173932000 20:46828451-46828473 GCACACTGCTTGGCAGTCACAGG - Intergenic
1175125778 20:56750618-56750640 GCACCCTGATTGGCTTAGACAGG + Intergenic
1175638463 20:60605603-60605625 TCACCCTGTTCTGGTGTCACTGG + Intergenic
1176094775 20:63335425-63335447 CCAGCCTGTTTGGCTGTCCTTGG + Intergenic
1176451518 21:6866246-6866268 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1176638293 21:9270256-9270278 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1176829686 21:13731297-13731319 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1177721764 21:24916390-24916412 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1178362189 21:31957953-31957975 GCTCACAGTTTGGCTGTGACTGG + Intronic
1178368990 21:32011501-32011523 GGGCCCTCTTTTGCTGTCACCGG + Intronic
1178967993 21:37142451-37142473 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1180422335 22:12877753-12877775 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1180947732 22:19705842-19705864 GGACCCTGTCTGCCTGGCACTGG + Intergenic
1181323549 22:22026632-22026654 GCACCCTCTTTGTTTGTCATAGG - Intergenic
1203236410 22_KI270732v1_random:6068-6090 GCACTCTGTTTGTCTGTTATTGG - Intergenic
1203324190 22_KI270737v1_random:101667-101689 GCACTCTGTTTGTCTGTGATTGG + Intergenic
949209585 3:1481815-1481837 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
949583785 3:5417097-5417119 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
949620305 3:5803367-5803389 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
949743511 3:7263441-7263463 GCACCCTCATTGGCTGTGACAGG + Intronic
949866053 3:8548607-8548629 GCACCCTCTGTGCCTGTCACTGG - Exonic
954563156 3:51575639-51575661 GCTCTCTGTTTGTCTGTCATTGG + Intronic
954835240 3:53461052-53461074 GAACCCTGTTTGCTTTTCACTGG + Intergenic
955606888 3:60714634-60714656 GCTCTCTGTTTGTCTGTCATTGG - Intronic
955902549 3:63772676-63772698 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
957308702 3:78491353-78491375 GCACTCTGTTTGTCTGTTATTGG - Intergenic
957583513 3:82106677-82106699 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
957747246 3:84361721-84361743 GCACTCTGTTTGTCTGTTATTGG + Intergenic
957908268 3:86585327-86585349 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
957917485 3:86705086-86705108 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
961310982 3:126000874-126000896 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
961630950 3:128297969-128297991 GCACCCTCCTTGGCTGTCCCAGG - Intronic
961637798 3:128343951-128343973 TCACCCTGTGAGGCTGTCCCTGG - Intronic
962524856 3:136228630-136228652 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
962548983 3:136469334-136469356 GCTCTCTGTTTGTCTGTTACTGG - Intronic
962553692 3:136524386-136524408 GCTCTCTGTTTGTCTGTTACTGG + Intronic
962604231 3:137018982-137019004 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
962831435 3:139145373-139145395 GCTCTCTGTTTGTCTGTTACTGG + Intronic
963109451 3:141674525-141674547 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
963679132 3:148351604-148351626 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
963902117 3:150742932-150742954 GCCCCCTGTTCCGCTGTCAAAGG + Intronic
964150745 3:153521116-153521138 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
964245549 3:154648577-154648599 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
964596472 3:158438018-158438040 GCTCTCTGTTTGTCTGTTACTGG - Intronic
965527310 3:169734691-169734713 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
966070540 3:175872121-175872143 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
966492165 3:180540159-180540181 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1202748603 3_GL000221v1_random:134765-134787 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
970333415 4:15005134-15005156 GCCGCCTCCTTGGCTGTCACAGG + Intronic
971172214 4:24245120-24245142 GCAGCCTGTTGTGCTGTCACTGG - Intergenic
971303192 4:25458501-25458523 AAGCCCTGTTTGCCTGTCACAGG + Intergenic
971466773 4:26972031-26972053 GCTCTCTGTTTGTCTGTTACTGG + Intronic
972476391 4:39453996-39454018 GCCTCATGTTTGCCTGTCACTGG + Intergenic
973145858 4:46825231-46825253 GCTCTCGGTTTGGCTGTCATTGG - Intronic
973596911 4:52501154-52501176 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
973806450 4:54530728-54530750 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
974242925 4:59274574-59274596 GCACCTTGCTTGGGTGCCACCGG - Intergenic
974491235 4:62567731-62567753 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
974565139 4:63571455-63571477 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
974584088 4:63846856-63846878 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
976761125 4:88550484-88550506 GCTCTCTGTTTGTCTGTTACTGG - Intronic
976795142 4:88923903-88923925 GCTCTCTGTTTGTCTGTTACTGG - Intronic
976969053 4:91081763-91081785 GCACTCTGTTTGTCTGTTATTGG - Intronic
977137499 4:93323838-93323860 GCTCTCTGTTTGTCTGTTACTGG + Intronic
977824030 4:101508704-101508726 GCTCTCTGTTTGTCTGTCATTGG + Intronic
978858930 4:113426305-113426327 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
979298802 4:119063694-119063716 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
979300176 4:119077974-119077996 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
979869863 4:125805558-125805580 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
979886545 4:126034299-126034321 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
981161624 4:141505679-141505701 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
981344615 4:143660875-143660897 GCTCTCTGTTTGTCTGTCATTGG + Intronic
981571384 4:146154417-146154439 GCACTCTGTTTTACTGTCAAAGG + Intergenic
981619552 4:146678818-146678840 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
981697757 4:147575708-147575730 CCACCATGTCTGGCTGACACTGG + Intergenic
981814702 4:148817241-148817263 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
981885714 4:149670268-149670290 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
982308341 4:153957513-153957535 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
984136255 4:175943172-175943194 GCTCTCTGTTTGTCTGTCATTGG + Intronic
990127599 5:52537572-52537594 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
991160200 5:63490435-63490457 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
991646192 5:68802712-68802734 GTGCCCTGTCTGGCTGTGACTGG - Intergenic
992358248 5:76008282-76008304 GCAGCCTGTTTGAATTTCACAGG - Intergenic
992701202 5:79343363-79343385 GCTCGCTGTGTGGCTTTCACTGG + Intergenic
992926784 5:81596188-81596210 GCTCTCTGTTTGTCTGTTACTGG - Intronic
993796468 5:92273756-92273778 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
994015445 5:94959619-94959641 GCTCTCTGTTTGTCTGTTACTGG - Intronic
994037005 5:95213213-95213235 GCTCTCTGTTTGTCTGTTACTGG - Intronic
994307463 5:98224092-98224114 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
994788370 5:104192019-104192041 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
995567205 5:113443288-113443310 GCTCTCTGTTTGTCTGTTACTGG + Intronic
996003107 5:118387308-118387330 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
997187274 5:131894690-131894712 GCTCCCTGTTTGTCTGTTATTGG + Intronic
998694656 5:144625605-144625627 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1000144498 5:158440586-158440608 GCTCTCTGTTTGTCTGTCAACGG + Intergenic
1000553240 5:162692558-162692580 GCTCTCTGTTTGGCTGTTATTGG + Intergenic
1003630122 6:7779221-7779243 GCACCATGGTTGCCTGGCACTGG - Intronic
1006999900 6:38300650-38300672 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1007123131 6:39400151-39400173 GCACCCTGTTTGGCTGTCACAGG + Intronic
1007598481 6:43066638-43066660 GCACCCTGTTGGGGTGTATCTGG - Intronic
1008080561 6:47190329-47190351 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1008484814 6:52024720-52024742 TCACCCTGTGTGGGTGTCTCTGG - Exonic
1008575101 6:52852825-52852847 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1009517166 6:64635114-64635136 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1009534217 6:64860473-64860495 GCTCCCTGTGTGGTTGTGACTGG + Intronic
1009643400 6:66366761-66366783 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1009722237 6:67487303-67487325 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1009741113 6:67747328-67747350 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1009795644 6:68463342-68463364 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1010348015 6:74836105-74836127 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1010856962 6:80851958-80851980 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1011578614 6:88831789-88831811 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1011735448 6:90305745-90305767 GCACCTTTTTTGACTGTTACTGG + Intergenic
1012018352 6:93882217-93882239 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1012389097 6:98716699-98716721 GTAGCATGTTTGGCTGCCACAGG - Intergenic
1014146228 6:118000799-118000821 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1014332510 6:120087314-120087336 GCTCTCTGTTTGTCTGTCACTGG - Intergenic
1015905086 6:138108057-138108079 GCACCGTGTTTGGATCTCAAGGG + Intergenic
1016656248 6:146521577-146521599 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
1016986896 6:149901743-149901765 CCAGCCTCTTTGGCTGCCACAGG - Intergenic
1017066933 6:150537695-150537717 GCTCACTGCTTGGCTGGCACAGG - Intergenic
1017626480 6:156354388-156354410 GCACCCTATTTGACTATTACAGG + Intergenic
1017657989 6:156648365-156648387 CCACCCTGTTTGGCTTTGATGGG + Intergenic
1020844916 7:13270479-13270501 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1020985502 7:15129063-15129085 GAAGCATGTTTGGCTTTCACTGG + Intergenic
1021321447 7:19217797-19217819 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1021661042 7:22918182-22918204 GCACTCTGATTGGATGTCATGGG + Intergenic
1021793475 7:24229288-24229310 CCAGCCTGTGTGGCTGTTACAGG - Intergenic
1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG + Intronic
1023692206 7:42801543-42801565 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1023699925 7:42882847-42882869 GCTCCCTGTTAGGCTGTGGCTGG + Intergenic
1024281411 7:47722450-47722472 GCACCCTTTTTCCCTGTCCCAGG - Intronic
1024372822 7:48606515-48606537 AGACCCTGTTTGGGTGTCAGTGG + Intronic
1024514444 7:50233232-50233254 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
1024670875 7:51593361-51593383 GCCCCGTGTTTGCATGTCACAGG + Intergenic
1027417198 7:77985812-77985834 GCACCCTGTCTCCCTGTCCCAGG - Intergenic
1029778898 7:102710551-102710573 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1031157468 7:118126557-118126579 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1031705509 7:124976245-124976267 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1032994347 7:137428752-137428774 GCTCTCTGTTTGTCTGTCATTGG - Intronic
1033493562 7:141870185-141870207 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1034366348 7:150551779-150551801 GCACACTCTTTGGCTGTGGCAGG - Intergenic
1035558411 8:585560-585582 GCTCTCTGTTTGCCTGTTACTGG + Intergenic
1037055995 8:14443010-14443032 GCTCTCTGTTTGGCTGTTATTGG - Intronic
1038286900 8:26213285-26213307 GCTCACTGCTTGGATGTCACTGG + Intergenic
1040315445 8:46258483-46258505 GCAGCCTGCTGGGCTGTCCCAGG + Intergenic
1040506640 8:48054943-48054965 GCACCCTGTTGGTATTTCACAGG + Intronic
1041035205 8:53782332-53782354 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1041427457 8:57738718-57738740 GCACCCTGTTTGGCCATCCAAGG + Intergenic
1041583571 8:59490924-59490946 GCTCCCTGTTTGTCTATTACTGG + Intergenic
1041884202 8:62789324-62789346 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1042738337 8:72014035-72014057 TCAGGCTGTTTGGCTTTCACAGG - Intronic
1042887958 8:73573102-73573124 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1043339794 8:79223932-79223954 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1043677889 8:82982487-82982509 GCACCCAGTGTTGCTGTCATTGG + Intergenic
1045570816 8:103367588-103367610 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1045572686 8:103385832-103385854 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1045978593 8:108157816-108157838 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1046122430 8:109862966-109862988 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1046285326 8:112086165-112086187 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1047386127 8:124411142-124411164 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1048533123 8:135268793-135268815 GCCCCTTGCTTGGCTGTCACTGG + Intergenic
1050049250 9:1581871-1581893 GCACTCAGTTTCCCTGTCACTGG - Intergenic
1050373757 9:4949499-4949521 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1050976548 9:11945781-11945803 GCTCTCTGTTTGACTGTTACTGG - Intergenic
1051116489 9:13699985-13700007 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1051296003 9:15596936-15596958 GCTCCCTGTTTGTCTGTTATTGG + Intronic
1051738849 9:20231525-20231547 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1052056030 9:23908784-23908806 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1053042023 9:34882563-34882585 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1055855067 9:80675934-80675956 GCAGCCTCTTTTGCTGTCAAAGG + Intergenic
1056923232 9:90810318-90810340 GCTCCCTGTGTGCCTGTCTCTGG + Intronic
1057125766 9:92614873-92614895 TCTCCCTGTTAGGCTGCCACAGG - Exonic
1057191936 9:93093303-93093325 GCACCCTGATTGGGTATCAAGGG - Intergenic
1058493452 9:105527995-105528017 GCTCTCTGTTTGCCTGTCATTGG - Intronic
1059594645 9:115706365-115706387 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1059918188 9:119127455-119127477 GCCTACTGTTTAGCTGTCACTGG + Intergenic
1061671809 9:132193015-132193037 GCACCCGGCCTGTCTGTCACTGG - Intronic
1062379584 9:136280797-136280819 GCACCCTCCTTGGCTGGCAGCGG - Intergenic
1203517663 Un_GL000213v1:18271-18293 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1203717241 Un_KI270742v1:164855-164877 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
1187245046 X:17546300-17546322 GCACCCTGTTTGGCCCTGCCAGG - Intronic
1187410987 X:19050344-19050366 GCAGCCTGCTCAGCTGTCACAGG - Intronic
1190457336 X:50639023-50639045 GCACCATGTTAGGCTGACAGAGG + Intronic
1191015711 X:55807843-55807865 GCTCCCTGTTTGTCTGTTATTGG + Intergenic
1192015271 X:67323104-67323126 GCTCTCTGTTTGTCTGTCATTGG + Intergenic
1192636751 X:72826999-72827021 GCTCTCTGTTTGTCTGTTACGGG + Intronic
1192644963 X:72893815-72893837 GCTCTCTGTTTGTCTGTTACGGG - Intronic
1192926028 X:75756086-75756108 GCTCCCTGTTTGTCTGTTATTGG - Intergenic
1192957705 X:76091033-76091055 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1194339748 X:92693809-92693831 GAACCCTGATTGGTTGGCACAGG - Intergenic
1194508685 X:94765381-94765403 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1195041873 X:101021940-101021962 TCAGCCTATTTGGCTGTCCCAGG + Intronic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic
1195787559 X:108543899-108543921 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1195882541 X:109607742-109607764 GCTCTCTGTTTGTCTGTCATTGG - Intergenic
1196139207 X:112242487-112242509 GCACTCTGTTTGTCTGTTATTGG + Intergenic
1196167106 X:112547598-112547620 GCTCTCTGTTTGACTGTTACTGG + Intergenic
1197298771 X:124753279-124753301 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1197384827 X:125789800-125789822 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1198191297 X:134309456-134309478 GCTCTCTGTTTGGCTGTTATTGG - Intergenic
1198347674 X:135774775-135774797 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198349579 X:135792036-135792058 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198351484 X:135809309-135809331 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198353393 X:135826575-135826597 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198355300 X:135843829-135843851 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198357210 X:135861112-135861134 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198359124 X:135878391-135878413 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198365717 X:135937647-135937669 GCTCTCTGTTTGGCTGTTATTGG + Intergenic
1199028145 X:142963475-142963497 GGAGCCTGTTTGGCTGTGAATGG - Intergenic
1199165176 X:144664147-144664169 GCTCTCAGCTTGGCTGTCACTGG + Intergenic
1200648132 Y:5810592-5810614 GAACCCTGATTGGTTGGCACAGG - Intergenic
1201740669 Y:17321552-17321574 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1202022605 Y:20481396-20481418 GCTCTCTGTTTGTCTGTTACTGG - Intergenic