ID: 1007123368

View in Genome Browser
Species Human (GRCh38)
Location 6:39401958-39401980
Sequence TGACTCCCAAAATACCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007123368_1007123374 25 Left 1007123368 6:39401958-39401980 CCTGGCTGGTATTTTGGGAGTCA 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1007123374 6:39402006-39402028 GGAGTAACTGTAGCAGCCCTTGG 0: 1
1: 0
2: 1
3: 14
4: 132
1007123368_1007123370 -9 Left 1007123368 6:39401958-39401980 CCTGGCTGGTATTTTGGGAGTCA 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1007123370 6:39401972-39401994 TGGGAGTCAGGTTTGTTTTCTGG No data
1007123368_1007123371 -4 Left 1007123368 6:39401958-39401980 CCTGGCTGGTATTTTGGGAGTCA 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1007123371 6:39401977-39401999 GTCAGGTTTGTTTTCTGGCCTGG No data
1007123368_1007123372 4 Left 1007123368 6:39401958-39401980 CCTGGCTGGTATTTTGGGAGTCA 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1007123372 6:39401985-39402007 TGTTTTCTGGCCTGGCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007123368 Original CRISPR TGACTCCCAAAATACCAGCC AGG (reversed) Intronic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
904853620 1:33478571-33478593 TGACTCCTAAAACTCCAGCAAGG - Intronic
906456867 1:46004861-46004883 GGAGTTCCAAAAGACCAGCCTGG + Intronic
907905940 1:58783853-58783875 ACACTCCCGAAACACCAGCCCGG + Exonic
912689644 1:111794731-111794753 AGACACCAAAAATACCAGCCAGG + Intronic
913480700 1:119286470-119286492 TGACTCCCAAAACACCTCTCTGG + Intergenic
920155575 1:203947761-203947783 AGAATCACAAAATACCAGCCAGG - Intergenic
920956423 1:210623790-210623812 TGACCTCTAAAGTACCAGCCAGG + Intronic
920971346 1:210745940-210745962 TTACTCACAGAATACCAGGCAGG + Intronic
921519621 1:216143943-216143965 TGACTATCAAAATACAAGCCAGG + Intronic
922288513 1:224190565-224190587 GGACTGACAAAATACTAGCCTGG - Intronic
924464920 1:244291167-244291189 TGAAATCTAAAATACCAGCCTGG - Intergenic
1062935933 10:1389531-1389553 GCACTTCCAAAAGACCAGCCTGG + Intronic
1064227545 10:13500763-13500785 TGACTCCCATCACATCAGCCTGG + Intronic
1064480449 10:15735400-15735422 TGACTACAAGAATACAAGCCAGG - Intergenic
1064641319 10:17418420-17418442 TGCTTCCTGAAATACCAGCCTGG + Intronic
1065423923 10:25579180-25579202 TGACTGCCAATTTACCAACCAGG - Intronic
1069074884 10:64028726-64028748 TGACTTCCAGAAAAGCAGCCTGG - Intergenic
1072343448 10:94478590-94478612 AGACTCCCCAAATAGCAGCTGGG - Intronic
1072861225 10:99007228-99007250 TGAGTCCACACATACCAGCCTGG + Intronic
1076312694 10:129519884-129519906 TGACTTAGAAAATTCCAGCCAGG + Intronic
1077326830 11:1967632-1967654 TGCCTCCCAAAATAAAACCCAGG + Intronic
1082703017 11:56456974-56456996 TGTCTCCCATAATACCATCTAGG - Intergenic
1082872699 11:57958243-57958265 TGAATCCCAAAAGTCCAGCCAGG - Intergenic
1090666957 11:128920736-128920758 TGCCTCCCAAACAAACAGCCGGG + Exonic
1202809811 11_KI270721v1_random:22812-22834 TGCCTCCCAAAATAAAACCCAGG + Intergenic
1098350134 12:69550551-69550573 TATCTCCAATAATACCAGCCTGG + Intronic
1099748761 12:86743767-86743789 TGACTCCTGAAATACTAGTCAGG + Intronic
1106803746 13:33284774-33284796 AGCCCCTCAAAATACCAGCCTGG - Intronic
1107873565 13:44769050-44769072 TCACTTCCAAACGACCAGCCTGG + Intergenic
1108540790 13:51442825-51442847 TGTCTTCCACAAAACCAGCCTGG + Intronic
1110653455 13:77970280-77970302 TGACTCAGAAAATACCACCAGGG - Intergenic
1114405346 14:22451177-22451199 TGAGTGCCAAAGTCCCAGCCAGG - Intergenic
1117331846 14:54720472-54720494 TGAGTCCCACAAAAACAGCCAGG - Intronic
1119105992 14:71924252-71924274 TAATTACAAAAATACCAGCCTGG - Intergenic
1126334096 15:47567286-47567308 TTACTCCCAACATAAAAGCCAGG - Intronic
1126476991 15:49075941-49075963 TAACTCCCACAATACCAGCAAGG - Intergenic
1126486566 15:49187857-49187879 TGAGTCCAAAAATGCCATCCAGG + Intronic
1127472513 15:59303069-59303091 GGCTTCTCAAAATACCAGCCAGG - Intronic
1129076561 15:73002012-73002034 TGACTCCAAACATGCCAGCATGG + Intergenic
1131509820 15:93043826-93043848 TCACTCCCAAAAGTGCAGCCAGG - Intronic
1132756932 16:1490040-1490062 TGTAACCAAAAATACCAGCCTGG - Intergenic
1133480635 16:6167071-6167093 TGACTCCCAAAACACAGGCAAGG - Intronic
1134505555 16:14803172-14803194 TGACTCTCAAAATGCCAGCTTGG - Intronic
1134575025 16:15325739-15325761 TGACTCTCAAAATGCCAGCTTGG + Intergenic
1134727420 16:16430752-16430774 TGGCTCTCAAAATGCCAGCTTGG - Intergenic
1134940014 16:18281103-18281125 TGACTCTCAAAATGCCAGCTTGG + Intergenic
1135974633 16:27099971-27099993 TGACTCCTAAATTACCTACCTGG + Intergenic
1139082115 16:63535127-63535149 TAACTCCCTAACTACCACCCTGG - Intergenic
1140545255 16:75801745-75801767 TGACTCCAAAGATACCTGCAGGG + Intergenic
1144773882 17:17774477-17774499 TTCCTCCCAACATGCCAGCCAGG + Intronic
1147139862 17:38454701-38454723 TGACTCACACCCTACCAGCCTGG - Intronic
1148507636 17:48140708-48140730 TGACTCCTGAGATTCCAGCCTGG - Intronic
1148892485 17:50818118-50818140 TGATTCCCCAAATTCGAGCCAGG - Intergenic
1151956691 17:77383667-77383689 AGCCACCCAAAGTACCAGCCAGG - Intronic
1155623919 18:27813016-27813038 TGAATCCCAGATTACCACCCAGG + Intergenic
1156035675 18:32764991-32765013 TCACTCCCCAAATGCTAGCCAGG - Intronic
1157900661 18:51513753-51513775 TCACTCACTAAACACCAGCCAGG + Intergenic
1158226329 18:55205302-55205324 TGAGTCACAAAATAACAGCTTGG - Intergenic
1162915724 19:13873412-13873434 TGAGGCCCAAAATAACCGCCTGG - Intronic
1165337047 19:35178265-35178287 TGACACCCCAAATACCATCAAGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1165878985 19:39029678-39029700 TGACTCCCATAAAACCATCTGGG + Intronic
1168401781 19:56089426-56089448 CGAAACCCAAAACACCAGCCTGG + Intronic
932788446 2:74630230-74630252 TGAATACCTATATACCAGCCTGG - Intronic
933720769 2:85396050-85396072 TTACTCCCATAATGCCAGCAGGG + Intronic
937593360 2:123642249-123642271 AAAATCACAAAATACCAGCCTGG - Intergenic
937858227 2:126687994-126688016 TGACTCTCAAGGTACAAGCCGGG + Intronic
938055078 2:128208578-128208600 GCACTCCCCAAATACCAGACCGG - Intergenic
938684490 2:133724505-133724527 TGACTCCCACTAGGCCAGCCTGG + Intergenic
938802817 2:134778482-134778504 TGACATCCAAAATTCCAGCCAGG + Intergenic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
948701425 2:239762951-239762973 TGACCCCCAAACCACCTGCCCGG - Intronic
1169065003 20:2690216-2690238 TGATTCCCAAACTCCAAGCCTGG + Intergenic
1171992739 20:31708944-31708966 TGAGTCCCAAAATAACAACCAGG + Intronic
1172761551 20:37326889-37326911 TGATTCACAGAAAACCAGCCTGG - Intergenic
1173597670 20:44269899-44269921 TGTCTCCCAAACGCCCAGCCTGG - Intronic
1174368972 20:50073543-50073565 TGATTCTCAAAATTCCTGCCAGG + Intergenic
1179480849 21:41677700-41677722 TGAGCCCAAGAATACCAGCCTGG + Intergenic
1181523791 22:23466608-23466630 TGACTCTTAACAGACCAGCCTGG + Intergenic
949957992 3:9285896-9285918 TCAATCCCAAGAGACCAGCCTGG + Intronic
952750355 3:36820145-36820167 TGACTCCAAAAATCACAGACTGG + Intergenic
953963832 3:47286780-47286802 AGGCTCCCAAAATAACAGCCAGG - Intronic
954293413 3:49661493-49661515 TGACTCACACTATACCAGTCTGG + Exonic
954578847 3:51692094-51692116 CCACTCTCAAAATACCAGCTCGG + Intronic
955330511 3:58043342-58043364 AGAATGCCAAATTACCAGCCTGG - Intronic
959830721 3:110858556-110858578 TGAAGCCCACACTACCAGCCAGG + Intergenic
963281176 3:143385976-143385998 CGTGGCCCAAAATACCAGCCTGG - Intronic
968266766 3:197368843-197368865 CAACTCCCAAGATACCAGCCGGG - Intergenic
969252786 4:5980649-5980671 AGAGTCCCAGAATAACAGCCTGG + Intronic
969378568 4:6779358-6779380 TAACTCCCACAATACCAGGCAGG - Intergenic
969506358 4:7590512-7590534 TGACACCCAACGTCCCAGCCCGG - Intronic
975424310 4:74208688-74208710 TGAATCCCAGATTACCACCCAGG + Intronic
976211980 4:82680828-82680850 TGACCCCCACAATGCCCGCCGGG - Exonic
976448198 4:85156172-85156194 GGATTCCTAAAACACCAGCCTGG - Intergenic
978353348 4:107843915-107843937 TGACTGCAGAAATAACAGCCAGG - Intronic
979821116 4:125172932-125172954 TGCATGCCAAAATACCTGCCTGG - Intergenic
983375606 4:166923605-166923627 TGAGTCCCAAAATATCATCATGG - Intronic
985331255 4:188838275-188838297 TAACTCCCTAAATAGCAGCTAGG - Intergenic
986802935 5:11280331-11280353 TGCCACACAAAATACCAGACTGG + Intronic
995491451 5:112696243-112696265 TGACTAAGAAAATATCAGCCAGG - Intergenic
997728116 5:136139674-136139696 TTATTCTCAACATACCAGCCAGG + Intronic
999843857 5:155457131-155457153 TGACTGCCAGCATGCCAGCCTGG + Intergenic
1001113609 5:168920258-168920280 TGACTCCCAAAATAAAAACCAGG - Intronic
1003738883 6:8911766-8911788 TTACTCCAAAAATACCATACAGG + Intergenic
1004721209 6:18268830-18268852 TGCCTAGCAAAATACCAACCTGG - Intergenic
1007123368 6:39401958-39401980 TGACTCCCAAAATACCAGCCAGG - Intronic
1007496796 6:42265713-42265735 CGTCTCCCAAAATACCAACAAGG + Intronic
1007669732 6:43541536-43541558 TGGCCCCCAAAATAACTGCCAGG + Intronic
1013787089 6:113793829-113793851 TGCCTCCCAAAATAGAGGCCGGG - Intergenic
1015318905 6:131849216-131849238 TGTCTCCCTAAAACCCAGCCAGG - Intronic
1016705386 6:147100906-147100928 TCACTCCCACAATATCAGCGGGG + Intergenic
1019294434 7:266469-266491 TGAGTCCCAAAAGGACAGCCTGG - Intergenic
1020725769 7:11812184-11812206 TGTCTCCCAAAAAACCTGACAGG - Intronic
1021512735 7:21451871-21451893 AGACTCCCAACATGCCAGGCAGG + Intronic
1022335174 7:29415271-29415293 TGACTCCCCAAGTGCCAGCCAGG - Intronic
1027194782 7:76022361-76022383 TGAATCCAGAAATACCAGACTGG + Intronic
1027233831 7:76286508-76286530 TGGCCCCCAAAATCCCAGCCTGG + Exonic
1028563258 7:92198848-92198870 GGACTCCCAAAACATCAGACAGG + Intergenic
1029991915 7:104970124-104970146 TGCTTCCAAAAATAACAGCCTGG - Intergenic
1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG + Intergenic
1032709720 7:134451183-134451205 TGGCTCCACAAACACCAGCCCGG - Intronic
1032849447 7:135781806-135781828 TAACTCCACAAAGACCAGCCTGG + Intergenic
1033174843 7:139114394-139114416 AGGCTCCCAAACTCCCAGCCAGG + Intergenic
1033585590 7:142772225-142772247 TGACTGCAAAACTCCCAGCCAGG + Intergenic
1034206528 7:149320742-149320764 AGACTGCCAAAATACAAGTCAGG + Intergenic
1036592672 8:10183191-10183213 TGACTCCCTCAGTCCCAGCCAGG + Intronic
1037885696 8:22595024-22595046 TGACGCCCAAAATCCTAGGCTGG - Intronic
1040122574 8:43699460-43699482 TGACTCCAAAAAGACCCACCAGG + Intergenic
1044077912 8:87846318-87846340 TGAATTCCAAAATACCATGCTGG + Intergenic
1046701287 8:117403818-117403840 AGGGTCCCAAAATACCATCCAGG + Intergenic
1047791833 8:128211163-128211185 GAACTCCCAAAACACCAGGCAGG + Intergenic
1049958321 9:713430-713452 TGACTTCCAGAAAACCAGTCTGG + Exonic
1059090237 9:111348865-111348887 AGACTCCCAAATTAACTGCCTGG + Intergenic
1059138603 9:111831111-111831133 TGTCTCCTAAAAAACCTGCCTGG + Intergenic
1059409380 9:114122566-114122588 TGGCACCCAGAAGACCAGCCTGG - Intergenic
1062494664 9:136826114-136826136 GGGCTCCCAAAATAGCACCCTGG - Intronic
1186754379 X:12654777-12654799 GGACTGCCAAAATGCCACCCTGG + Intronic
1187902168 X:24035333-24035355 TCACTCCCAACAAACCAGCAGGG + Intergenic
1189029854 X:37439495-37439517 TGAAGCCCAAAATAGGAGCCAGG + Intronic
1193619898 X:83738672-83738694 TGGCTCCAGAAATACCATCCAGG - Intergenic
1193883866 X:86960716-86960738 TGTCTCCCAGAAACCCAGCCTGG - Intergenic
1199085154 X:143619572-143619594 TAACTCCAAAAATACCAGTTAGG - Intergenic