ID: 1007127021

View in Genome Browser
Species Human (GRCh38)
Location 6:39433866-39433888
Sequence CTGAACAAGCAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007127021_1007127025 -1 Left 1007127021 6:39433866-39433888 CCATCCCCATTCTGCTTGTTCAG 0: 1
1: 0
2: 1
3: 30
4: 301
Right 1007127025 6:39433888-39433910 GAGCTCATGCGCAGCTCCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007127021 Original CRISPR CTGAACAAGCAGAATGGGGA TGG (reversed) Intronic
901716454 1:11158768-11158790 ATGAACAAGCAGAGGGGAGAGGG + Intronic
901885279 1:12218382-12218404 CTGAGAAAGCAGACTGGGTATGG + Intergenic
903017217 1:20368949-20368971 CTGGGCAAGCATCATGGGGAAGG + Intergenic
903681075 1:25097513-25097535 CTTAACAAGCAGATTGGAGATGG + Intergenic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904432414 1:30472976-30472998 CTGAAGGAGCAGAAAGGGAAGGG - Intergenic
905311362 1:37051400-37051422 ATGAACACGCAGAATGCAGAAGG - Intergenic
906033886 1:42739160-42739182 CTGAACTGGCACAATGGGGCTGG + Intronic
906543100 1:46603293-46603315 CTGACCCTGCAGAATGGGAAGGG - Intronic
906698242 1:47839264-47839286 GTGAGCAAGCAGAGTGGGCACGG + Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
906822563 1:48944727-48944749 TTGATCAAGAAGAAAGGGGAAGG - Intronic
907705375 1:56828020-56828042 TTGAACAAGAGGACTGGGGATGG + Intergenic
908152683 1:61319731-61319753 CTGAAGAAGTAGAATGGATATGG + Intronic
910730054 1:90385286-90385308 CTGAGAAGGCAGCATGGGGAAGG + Intergenic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
915328901 1:155097066-155097088 GACAACAGGCAGAATGGGGAGGG - Intergenic
915427318 1:155837441-155837463 CTGAAAAGGCAGAAAGGGAAAGG - Intronic
915496509 1:156285966-156285988 CTCACCCAGCACAATGGGGAAGG - Exonic
915605309 1:156946788-156946810 CTGAAGAGGCAGAATGGACACGG + Intronic
917105921 1:171491960-171491982 TTGAAGAAGCACAATAGGGAAGG + Intronic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
918903651 1:190460903-190460925 CTGATCAAGTAAAATGGGGGTGG - Intronic
919507352 1:198416131-198416153 CTGAAAAAACAAAAAGGGGAAGG + Intergenic
920214898 1:204355121-204355143 TTGAACAAGGAGACTTGGGAGGG + Intronic
920959110 1:210648571-210648593 CTGAATAAGCAGATTGGATACGG - Intronic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924509936 1:244721910-244721932 CTGAAGCAGCAAAGTGGGGAAGG - Intergenic
1062952748 10:1516946-1516968 CTGAAGTAGCAGAAAAGGGATGG + Intronic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1063614393 10:7589669-7589691 CTGAACAAGCAGAGTGTCGGGGG - Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064718818 10:18206750-18206772 CTTAGCAAGCAAAGTGGGGAGGG + Intronic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067784137 10:49230128-49230150 TTGAGCCAGGAGAATGGGGAGGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1069940079 10:71949305-71949327 CCCAACAGGCAGCATGGGGAAGG - Intergenic
1069942016 10:71963044-71963066 CCCAACAGGCAGCATGGGGAAGG - Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1071669864 10:87598306-87598328 CAGAAAAAGCAGACTGGGCATGG + Intergenic
1072039064 10:91590482-91590504 CTGGACCCGCAGGATGGGGAGGG + Intergenic
1072230707 10:93411894-93411916 CTGAAAAAGCAGATCGGGGGAGG - Intronic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1073225944 10:101919128-101919150 CAGAACAAGCAAAAAGGGGGAGG + Intronic
1074174013 10:110977533-110977555 CTAAACATGCAGGATGGGTACGG - Intronic
1074307522 10:112292742-112292764 CTGATCAAGAAGACTGGGGCTGG - Intronic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1075173129 10:120134373-120134395 CTGAACATGCAGCAGGGGCATGG + Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1077035157 11:490946-490968 CTGACCAGGCAGAAAGGGGAGGG - Exonic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080726829 11:34906390-34906412 CTGAAAGAGCAGACTGGGGAGGG + Intronic
1081319987 11:41680073-41680095 CTTAAAATGCAGAATGGTGAAGG + Intergenic
1082761902 11:57135746-57135768 CCGACCAAGCTGGATGGGGATGG - Intergenic
1084022394 11:66425447-66425469 TTGAACAAGCAGACTTGGCAGGG + Intronic
1084910397 11:72382692-72382714 CTGGACAGGCTGAATGGTGAAGG + Intronic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1086107961 11:83167954-83167976 ATGAACAAGCTAAGTGGGGATGG + Intronic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1088494327 11:110418450-110418472 CTAAACAACCAGAATGGGAGAGG + Intergenic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091871725 12:3897023-3897045 CTGAGCAGGAAGAATAGGGAAGG + Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092791672 12:12076057-12076079 CAGTACAAGCAGAATGGACAGGG + Intronic
1096456076 12:51788135-51788157 CTGAAGGAGTAGAATTGGGAAGG + Intronic
1096723704 12:53544273-53544295 CTAAAAAAGCAGGATTGGGAGGG - Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097229505 12:57501194-57501216 CTGAAAAGGCAGAATTGGCAAGG + Intronic
1097880260 12:64680372-64680394 CTGCACAAGTGGAGTGGGGAAGG - Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1104334731 12:127883412-127883434 TTGAACAAGTAAAGTGGGGAAGG - Intergenic
1105934694 13:25088215-25088237 ATGAACAAGCACAATGGGATGGG - Intergenic
1106644052 13:31614089-31614111 CTGAACTAGCAGAGTGCAGAAGG - Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1108016668 13:46083861-46083883 CTGAAAAAGCAGCTTCGGGAGGG - Intronic
1108102533 13:46972177-46972199 CTGAAGAAGCATAATGTGTAAGG - Intergenic
1109713691 13:66192058-66192080 CTTAACACACAAAATGGGGAGGG + Intergenic
1110557457 13:76876625-76876647 CCCAAAAAGCAGAATGGAGAAGG + Intergenic
1111899645 13:94185129-94185151 GTGAACTAGCAGAGTGGGGAAGG + Intronic
1112235424 13:97631464-97631486 CTGATCAATCAGAATGGACATGG - Intergenic
1112295201 13:98180161-98180183 CTGTACAAGCAGCATGGCGTTGG + Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1114196827 14:20485499-20485521 CTGAACAAGGGGAATGGTGATGG + Intergenic
1114209025 14:20600242-20600264 TTCACCAGGCAGAATGGGGAAGG + Intronic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1116006129 14:39293365-39293387 CTGAACAAGATGAATTGGTAAGG + Exonic
1117833845 14:59781215-59781237 GTGAACAAGCAGAAGGGAGCTGG - Intronic
1118541041 14:66825894-66825916 CTGAAAAAGTACAATTGGGAAGG + Intronic
1118541094 14:66826581-66826603 CTGAAAATGCAGAGTGGGGTGGG - Intronic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119847771 14:77843286-77843308 CTGAGCAAGCATGGTGGGGAAGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1125130482 15:36278873-36278895 CTGAACAGAAAGAATGGGGCAGG + Intergenic
1126413991 15:48398991-48399013 GTAAACATGCAGAATTGGGAAGG - Intergenic
1126530866 15:49710373-49710395 CTGGACAAGCTGACTGGTGAAGG - Intergenic
1127233622 15:57023404-57023426 TTTTTCAAGCAGAATGGGGAGGG - Intronic
1128963726 15:72036585-72036607 CTGAAGAATCAGAACAGGGATGG + Intronic
1129759804 15:78122844-78122866 CTGAATGAGCAGAATGGTTAGGG + Intronic
1130104033 15:80915668-80915690 CTCAACAACCAGGTTGGGGAGGG - Intronic
1130823645 15:87521005-87521027 CTGAACTGGGACAATGGGGAAGG - Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131156187 15:90077179-90077201 CTTAATAAACAAAATGGGGACGG + Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1132853996 16:2036728-2036750 GTGAACGGGCAGAATGTGGAGGG + Exonic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1139470492 16:67175473-67175495 CTGAACATGGAGCAAGGGGAGGG + Exonic
1139743200 16:69053263-69053285 CTAAATAGGGAGAATGGGGAGGG - Intronic
1142581911 17:948561-948583 GTGAACAAGCAGCCTGGGAAAGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143681363 17:8478224-8478246 CTGAAACATCAGAATCGGGAGGG + Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1153720128 18:7893394-7893416 TAGAACAAGTAGAATGGGAAAGG - Intronic
1157889148 18:51398051-51398073 CTTAACAAGCAGAAAAGTGAAGG - Intergenic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160099587 18:75907630-75907652 CTGAACAACCACAAGGGGTAAGG + Intergenic
1161015611 19:1981401-1981423 CCGGACAGGCAGGATGGGGATGG - Intergenic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1164398202 19:27884558-27884580 CTGAAAGGGCAGACTGGGGAAGG + Intergenic
1164423291 19:28116802-28116824 CTGAACAAGTGGAAGGGGCAGGG - Intergenic
1165397465 19:35573467-35573489 CTGAACATCCAGAATGGTGGAGG - Intergenic
1165873808 19:38991634-38991656 CCAACCAAGCAGAATGGGGTGGG - Intronic
1166068122 19:40371990-40372012 CTGACCAAGCAGAATGAGCTGGG - Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166901534 19:46067672-46067694 ATGAACAAGCAGAATGGAGGAGG + Intronic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
927676532 2:25110422-25110444 CTGAAGAAGCTGATTTGGGAGGG - Intronic
927840630 2:26440705-26440727 AGGAACAAGATGAATGGGGACGG - Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928626327 2:33143161-33143183 TTGCCCAAGCAGAATGGGTAGGG - Intronic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
930244785 2:48972357-48972379 CTGAAGAATCATAATAGGGAGGG - Intronic
930541103 2:52707826-52707848 GTGAACCGCCAGAATGGGGAAGG - Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
932591372 2:73070134-73070156 AAGAACGAGCAGAATGGGGGTGG + Intronic
932649209 2:73537397-73537419 CTGTACAAGAAGAAAAGGGAAGG + Intronic
932722173 2:74146389-74146411 CTGAAAAGGCAGACTGGGAATGG + Intronic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
935116819 2:100143978-100144000 CTGAAGAGGTAGAATGGGCAGGG - Intergenic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
937250876 2:120522914-120522936 AAGAACAAGCAGCATGGGGCTGG + Intergenic
937446257 2:121961064-121961086 ATGAACAAGCAGCGTGGCGAAGG - Intergenic
938222210 2:129580151-129580173 CTGTACAAGAAGCATGGGGCTGG + Intergenic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
946748885 2:222872757-222872779 CTGATCTAGGAGAAGGGGGATGG + Intronic
947127399 2:226884191-226884213 CTGCACAAGCAGAAGAGGAAAGG - Intronic
947267686 2:228301159-228301181 CTGAAAGGGCAGACTGGGGAGGG - Intergenic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1170225603 20:13988619-13988641 CTGAAAAAGAAGAATGGAGTTGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1172034226 20:32000370-32000392 CTGAACATCCAGACTGGGGTGGG - Exonic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172704045 20:36870070-36870092 CTGGTCAAGAAGAATGGAGAAGG + Intergenic
1172965780 20:38833774-38833796 GTAAGCAGGCAGAATGGGGAAGG - Intronic
1173189531 20:40865415-40865437 TAGAACAGGCAGGATGGGGATGG - Intergenic
1173460954 20:43243108-43243130 CTGAGCTAGCACAGTGGGGAGGG + Intergenic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1177397666 21:20558327-20558349 CTGCATAACCAGAATGGAGATGG - Intergenic
1182021646 22:27086650-27086672 CTGCACAAGGAGATCGGGGACGG + Intergenic
1182663030 22:31938444-31938466 CTGAACAAGCTGGAGGGGGGCGG + Intronic
1183608843 22:38883892-38883914 CAGAACTGGCAGAATGGGGCTGG - Intergenic
1184432956 22:44452285-44452307 CTGTACAAGCAGCATGGAGCCGG - Intergenic
949820020 3:8106101-8106123 CTGAACTATCTAAATGGGGAGGG - Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
952232700 3:31448206-31448228 CTGAACAGCCAGGATGGGGGAGG + Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
955353056 3:58208203-58208225 CTGAACAGGTAACATGGGGAAGG - Exonic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
958547483 3:95572893-95572915 CTGAACAACAAGAATGGGTTTGG + Intergenic
959670045 3:108966712-108966734 TTGACCAAGCTCAATGGGGAAGG + Intronic
960722439 3:120638159-120638181 CTGTACAAGCAGCATGGTGCTGG - Intronic
961645340 3:128389797-128389819 CTGCTCCAGCAGAATGGGCAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
966522473 3:180888676-180888698 CTGAAAAATCACAATGGAGAAGG + Intronic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969469622 4:7379962-7379984 CGGAACCGGCAGACTGGGGATGG - Intronic
969542464 4:7801781-7801803 CTGAAAAATCAGAATTGGAAAGG - Intronic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
971464057 4:26935609-26935631 CTGAATCAGCAGCTTGGGGATGG + Intronic
971862149 4:32121760-32121782 GGAAACATGCAGAATGGGGAAGG - Intergenic
973940391 4:55903413-55903435 TTGAACAGGCAAAGTGGGGATGG + Intronic
973945155 4:55948204-55948226 CTGAGGCAGCAGAATAGGGAAGG - Intergenic
974669789 4:65014682-65014704 CTGAACAACTAGAATGGGCCAGG + Intergenic
975909234 4:79248294-79248316 CTGACAAAGCAGTATGGGGGAGG - Intronic
978144401 4:105354876-105354898 GTGTACAAGCTGATTGGGGAGGG - Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
980711936 4:136580369-136580391 CTGAAAAAGATGCATGGGGAAGG - Intergenic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
984547809 4:181128344-181128366 TTGAAGATGCAGGATGGGGAAGG + Intergenic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
986464432 5:8007705-8007727 CTGGACAAGCTGACTGGTGAAGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988778234 5:34496359-34496381 CTGAAGAAGCTGCATAGGGAGGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989792557 5:45423271-45423293 CTCAAGAAGCAGAATAGAGATGG + Intronic
991293868 5:65060805-65060827 CTAAATAAGCAGAATGGTAAGGG + Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992106638 5:73453465-73453487 CTGAAGAAGCAGGGTGGGGGAGG - Intergenic
992966836 5:82011358-82011380 CTGAACAAAAAGAATGGTGATGG - Intronic
993551375 5:89277945-89277967 CTGAACAGTCAGAATGGGCATGG + Intergenic
993905427 5:93618364-93618386 TAGAACAAGTAGAATGGGAAAGG - Exonic
995316660 5:110782353-110782375 CTGTACAAGAAGCATGGTGAGGG + Intergenic
995738356 5:115327896-115327918 CTGAAAGCGCAGACTGGGGAGGG + Intergenic
998407086 5:141880061-141880083 CCCAGCAAGCAGACTGGGGAGGG - Intergenic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
999169546 5:149581649-149581671 CTGGTCAAGCAGGATGGGGCTGG + Intronic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1001033502 5:168280042-168280064 CTGTACAAGCAGCATGGTGCTGG + Intergenic
1001719751 5:173847316-173847338 CTGAACAAGCAGCATGGTGCTGG + Intergenic
1002032735 5:176442483-176442505 CTGAGCTGGCAGAATGGGAAAGG - Intergenic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1003694080 6:8384971-8384993 TTGAAAAAGCAGAAAAGGGAAGG + Intergenic
1006723984 6:36182516-36182538 CTGGACAAGCTGACTGGTGAAGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018882049 6:167893778-167893800 CAGAACACGCGGAATAGGGAAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1021550580 7:21867252-21867274 CTGAAGAAACACAATAGGGAAGG - Intronic
1026389714 7:69888237-69888259 CTGTACAAGAAGAATGGTGCTGG + Intronic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1029366948 7:100122712-100122734 CTGAAATGGCAGAAAGGGGAAGG + Intronic
1029420616 7:100469942-100469964 CTGAGCGAGCAGGATGGGGTGGG + Intronic
1031239277 7:119217664-119217686 CTGAACAATCAGAAGTGGGAAGG - Intergenic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1037218633 8:16488731-16488753 CTGATAGAGCTGAATGGGGATGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038677910 8:29640211-29640233 CTGAAGAAGGAGGATAGGGAAGG + Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039721976 8:40174133-40174155 CTCAACAAGCATTAAGGGGATGG + Intergenic
1039757530 8:40539372-40539394 CTGAAAATGCAGGATGGGAATGG - Intronic
1040528230 8:48243144-48243166 CTGAAAGAGAAGATTGGGGAGGG + Intergenic
1043157826 8:76807408-76807430 CTGAACAAGCAGAATTAGATTGG + Intronic
1043488622 8:80724726-80724748 GTGAAAAATCAGAATGGAGAAGG - Intronic
1043820050 8:84852134-84852156 GTGAATATGCACAATGGGGAGGG + Intronic
1044708964 8:95036947-95036969 ATGCTCCAGCAGAATGGGGAAGG - Intronic
1049192114 8:141294307-141294329 ATGAACAAGCCGCATCGGGAGGG + Intronic
1049748537 8:144273062-144273084 CTCCACAAGCAGCGTGGGGAGGG + Intronic
1050436681 9:5618393-5618415 CTAACCAAGCAAAATGGGAAGGG - Intergenic
1050541560 9:6674807-6674829 CTGAAAATGGAGAATGGGCATGG - Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1054904427 9:70402148-70402170 CTGAACAAGCATTTTGGGGCTGG + Intronic
1055222875 9:73959194-73959216 CTGAGGAAGCAGCCTGGGGATGG + Intergenic
1055312564 9:74998200-74998222 ATGAACAAGGTGATTGGGGATGG - Intronic
1055692548 9:78848125-78848147 TTGAAAAGGCACAATGGGGATGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1057056371 9:91964465-91964487 CAGAAAAAGCAGAATGGAGGTGG - Intergenic
1058813550 9:108663837-108663859 CTTAACAAGCTGAATGCTGAAGG + Intergenic
1059442780 9:114319159-114319181 CTGAATGGGAAGAATGGGGAGGG - Intergenic
1060346722 9:122823219-122823241 GTGACCAAGGAGAATGGGCAGGG + Intronic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1061281828 9:129602016-129602038 CTGCCCAAGAAGGATGGGGAGGG - Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193352939 X:80483075-80483097 CTGAAAGGGCAGACTGGGGAGGG + Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195758196 X:108220058-108220080 CTGTAGAAGCATAATGGAGAGGG - Intronic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199056410 X:143300778-143300800 GTGAGCAAGCACAATGGAGAAGG + Intergenic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200314586 X:155118584-155118606 CTGAACAAGAAGCATGGTGCTGG + Intronic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic