ID: 1007132483

View in Genome Browser
Species Human (GRCh38)
Location 6:39488743-39488765
Sequence TCTAATGTTTAGTTGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007132483_1007132487 -7 Left 1007132483 6:39488743-39488765 CCATTCACCAACTAAACATTAGA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1007132487 6:39488759-39488781 CATTAGAATTTGGGCTTGTTTGG 0: 1
1: 0
2: 2
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007132483 Original CRISPR TCTAATGTTTAGTTGGTGAA TGG (reversed) Intronic
907851325 1:58257950-58257972 TGTGATGTTTAGTTGGTGCCAGG + Intronic
908484854 1:64581027-64581049 TATAATGTTTAATTGGATAATGG - Intronic
908938005 1:69398948-69398970 TCTAAAGTTTAGAGGATGAAGGG + Intergenic
911704132 1:100991305-100991327 TGTATTGTTTAGTTGGGAAAGGG + Intronic
912024306 1:105147890-105147912 TCTAATGTTTAATGGGCGTAAGG + Intergenic
921090909 1:211841552-211841574 TGTAATTTTTTGCTGGTGAAGGG + Intergenic
921305376 1:213791380-213791402 ACTAATGTTTTGTTGGTGTCTGG - Intergenic
922428963 1:225527978-225528000 ACTGATGTTTAGCTGGTAAATGG - Intronic
1064145802 10:12825369-12825391 TAAAATATTTAGTTGGGGAAAGG + Intronic
1064418590 10:15170814-15170836 TCTAAAGTTTATTTGGTGGATGG + Intergenic
1064580196 10:16786041-16786063 TCTAAAATTTCGTTGGTGACTGG + Intronic
1065416887 10:25498007-25498029 TAAAATGTTAATTTGGTGAAAGG + Intronic
1065477100 10:26151490-26151512 TCTTATGATTAGTGAGTGAATGG + Intronic
1066229344 10:33417034-33417056 TCTAATATCTATTGGGTGAACGG + Intergenic
1068210994 10:53920262-53920284 TCTAATGTTTTATAGGTGTATGG - Intronic
1068324818 10:55471053-55471075 TATATCGTTTAGTAGGTGAATGG - Intronic
1074905122 10:117855062-117855084 TGTAATCTTTTGCTGGTGAAGGG + Intergenic
1075231656 10:120685100-120685122 TCTTATCTTTAGTTGGAGAGAGG - Intergenic
1081286831 11:41280808-41280830 TCTAATGAATAATTGTTGAAAGG + Intronic
1085065397 11:73490735-73490757 TATAATGTTGAGTTTGTTAAAGG - Intronic
1085359508 11:75873811-75873833 TGTAAGGTAGAGTTGGTGAAGGG + Intronic
1086843267 11:91716156-91716178 GCTTATGTCTAGTTGGGGAAGGG - Intergenic
1088167844 11:106959305-106959327 TTCATTGTTTATTTGGTGAAAGG + Intronic
1090369936 11:126242963-126242985 TCAAATGTCTAGTTCATGAATGG + Intronic
1092520195 12:9263815-9263837 TCTACAGTTTTGTTGGTGATTGG + Intergenic
1092623450 12:10299608-10299630 CCTAATTTTTTGTTGGTGGAGGG + Intergenic
1093768184 12:22989011-22989033 TCTTTTGTGTAGTTGATGAATGG + Intergenic
1095549666 12:43419102-43419124 TATAATTTTTATTTTGTGAATGG - Intronic
1095978489 12:47956266-47956288 TCTCATGTTGAATTGGTGGAGGG + Intergenic
1099612761 12:84895669-84895691 TCTTATGTTCAGTGGGTGCATGG - Intronic
1102424832 12:112835054-112835076 TCTAATTTTATATTGGTGAAGGG + Intronic
1102863211 12:116354225-116354247 TCTAATGTTTAGATGTCGATGGG + Intergenic
1106652770 13:31709547-31709569 TCTGTTATTTAGTTGGTGATGGG + Intergenic
1106746321 13:32711943-32711965 TCTAATGTTCAAGTGGTAAATGG + Intronic
1107107752 13:36664989-36665011 TCTCATGTAGAGTAGGTGAAGGG + Intergenic
1110305127 13:73977620-73977642 TCTAATGTTTATGTGGAGAGAGG + Intronic
1110328314 13:74242691-74242713 TCAATTGTTTAGTAGGTGTAGGG + Intergenic
1111497041 13:89064404-89064426 TCTAATGATTAGTTATTAAAAGG - Intergenic
1111889051 13:94059013-94059035 TCTAGTGTTTACTTGATTAAAGG + Intronic
1112735945 13:102418045-102418067 TCTAATGTTCACTTGTTAAATGG - Intergenic
1114419580 14:22570158-22570180 TTTAATTTTTTGTTGGTGGAGGG - Intronic
1117173457 14:53124274-53124296 TCAAATATTTAATTGGTAAATGG + Intronic
1118459737 14:65977046-65977068 TCTAAGGCTTAGCTGGTGAAAGG - Intronic
1119790112 14:77342358-77342380 TCTATCATTTAGTAGGTGAAAGG + Intronic
1120063421 14:80011846-80011868 ACTAAGGTTTTTTTGGTGAAAGG - Intergenic
1120674110 14:87400055-87400077 TCTAATCCTTATTTTGTGAATGG + Intergenic
1126167801 15:45668352-45668374 TGTAATGTTTGGTGGGTGAATGG - Intronic
1126469746 15:48996076-48996098 CCTAATGTTTAGTTAGTGATAGG + Intronic
1126837498 15:52681605-52681627 TCTAGTTCCTAGTTGGTGAAGGG + Intronic
1126921933 15:53536349-53536371 TCTAAGGTTAAGTTGTTGAATGG + Intronic
1128429053 15:67573521-67573543 TCTCATGTTTAATTGGAGGAGGG - Intronic
1128614546 15:69099026-69099048 TCTGCTGTTTAATTGGAGAAGGG - Intergenic
1131911213 15:97205117-97205139 TCTAATGTTTTTCTGGGGAAGGG - Intergenic
1136604186 16:31321537-31321559 TGTAATGATCAGGTGGTGAAAGG + Exonic
1141227644 16:82133961-82133983 TCTTAAGTTTCCTTGGTGAAAGG - Intergenic
1143339976 17:6203241-6203263 TGTAATGTTTAGGTGGTCATAGG + Intergenic
1145285304 17:21501342-21501364 TCTAATTTGCAGTTGGTTAAAGG - Intergenic
1146989993 17:37261128-37261150 TTTAAGGTTTAGTTGGTGTGTGG - Intronic
1149522228 17:57326125-57326147 TCTAATGCTTCGTTGCTGTATGG + Intronic
1149616176 17:58001823-58001845 TCTAATGTTTACTTAGGTAAAGG - Intronic
1151103115 17:71578474-71578496 TCTACTGATTAGTTGGAGTAGGG - Intergenic
1155718835 18:28984724-28984746 TCTATTGCTTAGTTGTAGAAGGG + Intergenic
1156039524 18:32804751-32804773 TCTAATCTCTTGTTGTTGAAGGG - Intergenic
1156594818 18:38536336-38536358 TCTCATGTTTGGTCGGTGGAAGG - Intergenic
1158169995 18:54586714-54586736 TCTAATCTTGAGTTTGTAAAAGG + Intergenic
1158591187 18:58780337-58780359 TCTCATGTTGAGTTGGAGGAGGG - Intergenic
1163516372 19:17766438-17766460 TCTAATGTTGATTTGTTGAGGGG + Intronic
926881286 2:17547049-17547071 CCTCATTTTTAGTTTGTGAATGG + Intronic
928371567 2:30743673-30743695 TGTAATGTTATCTTGGTGAATGG - Intronic
929260051 2:39856329-39856351 AATAATGTTTAGATGGTTAAAGG + Intergenic
931749567 2:65318522-65318544 TCATCTGTTTAGTTGGGGAATGG - Intronic
932163399 2:69483467-69483489 CCAAATGTTCAGTTGGTGAATGG - Intronic
935429706 2:102962071-102962093 TCTAAGGTACACTTGGTGAACGG + Intergenic
936652790 2:114448838-114448860 TTTAATGTCTACTGGGTGAAAGG - Intronic
937174160 2:119910172-119910194 TGTAATCTTTTGTTGGTGGAGGG - Intronic
937658695 2:124406276-124406298 TATAATCTGTAGTTGTTGAATGG + Intronic
941533546 2:166696470-166696492 TCTAATATTTAGGTGGGGAGAGG + Intergenic
943418896 2:187641861-187641883 TATAATGTTTTCTTGGTGCAAGG - Intergenic
944121130 2:196242038-196242060 CATAATGTATAGATGGTGAAAGG - Intronic
944355101 2:198778269-198778291 TCTAATGTTTAGCTGGGGTCAGG + Intergenic
947091270 2:226513648-226513670 TCTAGTTTTTAGATTGTGAAAGG - Intergenic
947216737 2:227756826-227756848 TCAAATGTATCGTTGGAGAAAGG - Intergenic
949011611 2:241682748-241682770 TCTATTTTTTAGTTAGTGATGGG - Intronic
1169218551 20:3807331-3807353 GCAAATGTTTATTTGGTGAGAGG + Intergenic
1169513010 20:6285299-6285321 TAAAATGTTTAATTGGTCAAAGG + Intergenic
1172416798 20:34775780-34775802 ACTAAAGTTTATTTGGTGGAAGG + Intronic
1172496889 20:35393673-35393695 TATAATGATTAGGTGGTCAATGG + Intronic
1175587326 20:60152131-60152153 TCTAATCTCTAGATGCTGAATGG - Intergenic
1177229705 21:18303957-18303979 TCAAATGCTTAGTAGGAGAAAGG + Intronic
1180915722 22:19485082-19485104 TCTAATCTTTGGTTTGTGAGGGG + Intronic
1181838523 22:25631961-25631983 CCAAATGTTCAGTTGGTGGATGG - Intronic
1184124695 22:42478941-42478963 GCTAATGTTTGGCTGGTGACTGG + Intergenic
949235121 3:1799467-1799489 TCTAATGTTTAGTTCTTGAGTGG - Intergenic
953664023 3:44912946-44912968 TCTAATGTTTTGTTTCTGAGAGG + Intronic
955013188 3:55040083-55040105 TCTCTTCTTTAGTTAGTGAATGG + Intronic
955025106 3:55160094-55160116 ACTCAAGTTTAGTTGGTGATGGG - Intergenic
957579472 3:82052235-82052257 TGAAATGTTTAATTGGTGAAAGG + Intergenic
960460560 3:117929554-117929576 TCTAATTTTCAGTCAGTGAAGGG - Intergenic
960891656 3:122454640-122454662 TCAAATGATAAGTAGGTGAAAGG + Intronic
962365705 3:134778476-134778498 ACTAAAGTTTAGTTAGTCAATGG + Intronic
963549211 3:146699505-146699527 TCTCAAGTTTAATTGGAGAATGG - Intergenic
964889001 3:161516161-161516183 TCTAATATTTAGTGAGGGAATGG - Intergenic
966006186 3:175015219-175015241 TCTACTGTTTACTATGTGAAAGG + Intronic
966012904 3:175103342-175103364 TATACTATTTAGTTGCTGAAAGG - Intronic
966109929 3:176388088-176388110 TCAAATGCTTAGTTGGTTGATGG - Intergenic
966515053 3:180810277-180810299 TCTAAATTTTAGCTGGTAAATGG - Intronic
970227889 4:13878820-13878842 TCTAATGGCTAGTTGGGTAATGG - Intergenic
970234291 4:13943306-13943328 TTTTATGTGTAGTTGGGGAAAGG + Intergenic
971858493 4:32074015-32074037 GTAAATGTTTAGCTGGTGAAAGG + Intergenic
972098952 4:35387678-35387700 GCTAATGCTTAGTTGTTAAATGG - Intergenic
972998563 4:44915458-44915480 TCTAGTTTTTAATTGATGAATGG + Intergenic
973540030 4:51926455-51926477 TGTATTGTTTATTAGGTGAAAGG + Intergenic
976081046 4:81355358-81355380 GGTAATGCTTGGTTGGTGAATGG + Intergenic
977275859 4:94976695-94976717 TTGAATGTTTAGTGTGTGAAAGG - Intronic
979896169 4:126160646-126160668 TATAATTTTAAGTAGGTGAAAGG + Intergenic
980641992 4:135592975-135592997 TCTACTGTTTGGTTGGCTAATGG + Intergenic
981392092 4:144202997-144203019 TCTCATGTTGAATTGGAGAAGGG + Intergenic
981450750 4:144895019-144895041 TCCCATCTTTAGTTGGGGAAAGG - Intergenic
981479451 4:145222913-145222935 TCTAATGTAAAGTAGGTGACAGG - Intergenic
983132731 4:164042549-164042571 TCTCATGTTGAATTGGAGAAGGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984472877 4:180199365-180199387 TCTAAAAGTTAGTCGGTGAAAGG - Intergenic
984497262 4:180514580-180514602 CATGATGTTTGGTTGGTGAAGGG - Intergenic
985103898 4:186483539-186483561 TTTAATGTGTAGTTGGTGAAAGG - Intronic
985617652 5:933611-933633 TCTCATGTTGAATTGGTGAGAGG - Intergenic
985850213 5:2383131-2383153 TCTAATGCATAGTTGGTGCTTGG + Intergenic
987513475 5:18874103-18874125 GCTAATTTCTAGTTGGTAAATGG - Intergenic
991336047 5:65548373-65548395 TGTAATGTTTTGCTGGTGGAAGG + Intronic
991650151 5:68844444-68844466 TCGTGTTTTTAGTTGGTGAAAGG + Intergenic
993044436 5:82851566-82851588 TCTAATTTCTAATTGGTGACTGG + Intergenic
994674920 5:102808734-102808756 ACAAAGATTTAGTTGGTGAAGGG + Intronic
995079671 5:108034988-108035010 TGTAATGTTTATTGGGGGAAGGG - Intronic
998816841 5:146023079-146023101 TTTAATGTATAGATGGTTAAGGG - Intronic
1002057411 5:176606434-176606456 TCTAATGTTTAGAAGTTGATCGG - Intronic
1005166587 6:22929019-22929041 CCTTCTGTTTAGTTGGTCAATGG - Intergenic
1006176969 6:32128258-32128280 TCAACTGATTAGTTGGTGATGGG - Intergenic
1007132483 6:39488743-39488765 TCTAATGTTTAGTTGGTGAATGG - Intronic
1007376952 6:41463453-41463475 GCTAATGTTTACTTGCTGAATGG - Intergenic
1008571241 6:52819093-52819115 TCCAATCTTTAGTTGGTTAATGG - Intergenic
1012613882 6:101251529-101251551 TTTAAAGTTTAGTTGGATAATGG - Intergenic
1015505732 6:133985511-133985533 TTTAATCTTTATTTGGAGAAAGG + Intronic
1016388063 6:143548330-143548352 TCTAATGTTTGGATTTTGAAGGG + Intronic
1017675442 6:156808786-156808808 TCTTATTTTTACTTGATGAAAGG + Intronic
1020335969 7:7062642-7062664 TCTAATATTTACGTGGGGAAAGG + Intergenic
1021916044 7:25433306-25433328 CCAAATGTTTATTTGGTAAATGG + Intergenic
1023637471 7:42227212-42227234 TGTAATGTTTCAGTGGTGAAAGG - Intronic
1024386586 7:48758854-48758876 TATAATGTTTAATTTGTTAAAGG - Intergenic
1025524841 7:61792351-61792373 TCAAATGTTTATTTGCAGAATGG + Intergenic
1028174450 7:87637403-87637425 TCTAAAATTTAGTTTGTAAAAGG - Intronic
1028927739 7:96377917-96377939 TCTCTTGTTTTGTTGGGGAAGGG - Intergenic
1029301112 7:99582985-99583007 TCTAATATTTAGGTGGGGAGAGG - Intronic
1029609109 7:101617187-101617209 TCAAATGTGTCATTGGTGAAAGG + Intronic
1029917784 7:104230284-104230306 TTTAAGGTTTAGTTGGTGGTTGG - Intergenic
1030649741 7:112104379-112104401 TCTAATGATTAGTTTGCTAATGG - Intronic
1033013489 7:137647325-137647347 TCTAATGTTGAGGTGATGCAAGG - Intronic
1033886602 7:145956296-145956318 TCTATTGTTTAGTTTGTGTTTGG + Intergenic
1035576025 8:705918-705940 TTTAATGTTTGGATGCTGAAAGG + Intronic
1037039398 8:14211786-14211808 TCTCATGTTGAATTGGAGAAGGG - Intronic
1037424648 8:18742617-18742639 TTTAATCTTTAGGTGGTGATGGG - Intronic
1038530856 8:28317151-28317173 TCTGCTGTTTGGTTGCTGAAGGG + Exonic
1043221154 8:77666293-77666315 ATTCATGTTTAGTTAGTGAAGGG + Intergenic
1044052091 8:87517589-87517611 TCTAAGGTGTAGTTAGTGCAAGG - Intronic
1047341126 8:123981401-123981423 TCTACTGTTTAGTTTATCAATGG + Intronic
1047491138 8:125375652-125375674 ACAAATATTCAGTTGGTGAATGG + Intergenic
1047638640 8:126794689-126794711 TCTCCTGGTTAATTGGTGAATGG - Intergenic
1047948598 8:129908059-129908081 TGTAATGTATAGTTTGAGAAGGG - Intronic
1048605817 8:135967748-135967770 TCTAATGTTTAATAGATCAATGG - Intergenic
1050911016 9:11070660-11070682 TCTAAAGGTTAGTTCATGAATGG - Intergenic
1054353881 9:64043584-64043606 TCTAATATTAAGTTGGGGAGAGG - Intergenic
1054753139 9:68929250-68929272 TGTAATTTTTATTTGTTGAATGG + Intronic
1055437541 9:76307608-76307630 TCCAATGTTTCCTTGGTTAATGG + Intronic
1057986796 9:99725160-99725182 TCAAATGTTTAGTAAGTGCAAGG - Intergenic
1058622288 9:106896258-106896280 TCAAATGTTTAGTTAGTGGATGG + Intronic
1061420251 9:130469737-130469759 TTTAATGTTAAGGTGGTGATGGG + Intronic
1186536471 X:10355332-10355354 TATAATGAATAGTTGTTGAATGG - Intergenic
1186621155 X:11241332-11241354 TAGAATGCTTAGTTGGTAAAGGG - Intronic
1186887041 X:13924256-13924278 TCTAATAAGTATTTGGTGAATGG + Intronic
1187447522 X:19372481-19372503 TCTTTTGTTTTGTTGGGGAAGGG + Intronic
1192676785 X:73204803-73204825 TATAATCTTTTGGTGGTGAAAGG - Intergenic
1194352578 X:92839399-92839421 TCTCATGTTCAATTGGAGAAGGG - Intergenic
1194501580 X:94688261-94688283 CCCAATGTTTAGTTGGTATAAGG + Intergenic
1194645477 X:96453834-96453856 ACTAATGTTTTCTGGGTGAATGG - Intergenic
1195255209 X:103083103-103083125 TCTGAAGTTGAGGTGGTGAAGGG + Intronic
1197435800 X:126426362-126426384 TCTAATGTTAAAATGGTGAAAGG - Intergenic
1200163919 X:154023229-154023251 TGTAATTTTTGGTGGGTGAAAGG - Intronic
1200660888 Y:5956143-5956165 TCTCATGTTCAATTGGAGAAGGG - Intergenic
1201393355 Y:13522382-13522404 TCAAATGCTTAGGTGGTGGAGGG - Intergenic
1201850758 Y:18477225-18477247 TCTAACATTTTGTGGGTGAAGGG + Intergenic
1201882560 Y:18843152-18843174 TCTAACATTTTGTGGGTGAAGGG - Intergenic