ID: 1007133211

View in Genome Browser
Species Human (GRCh38)
Location 6:39496208-39496230
Sequence AGTGAAATCTGAGGGACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007133211_1007133214 12 Left 1007133211 6:39496208-39496230 CCTAAAGTCCCTCAGATTTCACT 0: 1
1: 0
2: 2
3: 16
4: 228
Right 1007133214 6:39496243-39496265 TTCATTTGCCACATGACCACAGG 0: 1
1: 0
2: 2
3: 21
4: 125
1007133211_1007133215 16 Left 1007133211 6:39496208-39496230 CCTAAAGTCCCTCAGATTTCACT 0: 1
1: 0
2: 2
3: 16
4: 228
Right 1007133215 6:39496247-39496269 TTTGCCACATGACCACAGGACGG 0: 1
1: 0
2: 1
3: 29
4: 184
1007133211_1007133217 20 Left 1007133211 6:39496208-39496230 CCTAAAGTCCCTCAGATTTCACT 0: 1
1: 0
2: 2
3: 16
4: 228
Right 1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007133211 Original CRISPR AGTGAAATCTGAGGGACTTT AGG (reversed) Intronic
902961896 1:19969449-19969471 AGTGAAATATAAGTGATTTTTGG + Intergenic
905186848 1:36203265-36203287 ACAGAAAGTTGAGGGACTTTTGG - Intergenic
906338746 1:44959028-44959050 AGTGACATCTGAGAAACTTATGG + Intronic
907215898 1:52863529-52863551 AGTGACATCTGAGGTAGTTATGG - Intronic
908916016 1:69127410-69127432 AGTGAAGTCTGAGGGACAGCTGG - Intergenic
909400240 1:75220102-75220124 AGGAAAATTTGAGGGACTTTAGG - Intronic
909431124 1:75588925-75588947 AGTGAAACCTCAGGGAGTTATGG + Intronic
910498366 1:87859393-87859415 AATGTAAACTAAGGGACTTTGGG + Intergenic
910712488 1:90196213-90196235 AGTGAACAATGAGGGGCTTTAGG - Intergenic
910718973 1:90264405-90264427 AGTGAAAGATGAAAGACTTTAGG + Intergenic
911139155 1:94479635-94479657 GGTGATATCTGAGCTACTTTGGG + Intronic
912901250 1:113651887-113651909 AGTGAAATCTGAGCTACTAAAGG + Intronic
913420119 1:118657479-118657501 AGTGGAATTTAAGGGACTATGGG - Intergenic
913709889 1:121472571-121472593 AGTTAAAACTGGGGGACTGTTGG - Intergenic
915099571 1:153489581-153489603 TGTGAAAGCTGAGGCACTATAGG + Intergenic
916079302 1:161222544-161222566 AGTTTAATCTGAGGGACCCTAGG + Intronic
916473570 1:165147112-165147134 TGTGAATTCTCAGGTACTTTAGG - Intergenic
916654519 1:166862093-166862115 TGTGAAATCAGAGTGACATTTGG + Intronic
917571423 1:176269435-176269457 ATTGAAATCTGAGACACTTCTGG - Intergenic
920161189 1:203998772-203998794 TGTGTAATCTGTGGGACTTGTGG + Intergenic
920689412 1:208134590-208134612 AGTTGAGCCTGAGGGACTTTGGG - Intronic
922860458 1:228811739-228811761 AGTGAAATCTGAAGGTCCTTGGG + Intergenic
923377657 1:233380462-233380484 AGTGACATCTGAGGGACAGAGGG + Intronic
924468314 1:244317400-244317422 CGGCAAATCTGAGGGACTCTGGG - Intergenic
1063066367 10:2613536-2613558 AATGAAGCCTAAGGGACTTTTGG + Intergenic
1066225321 10:33377119-33377141 ACTGACATCTGAGAGCCTTTGGG + Intergenic
1066793300 10:39090242-39090264 GGAGAAATCTGGGGGACATTTGG + Intergenic
1067266641 10:44751437-44751459 AGTGAAGTCTAATGGACTCTGGG + Intergenic
1068580654 10:58735622-58735644 ACTGAAACTTGAGGCACTTTTGG + Intronic
1068823250 10:61402636-61402658 AATGATTTTTGAGGGACTTTAGG + Intergenic
1073115499 10:101089519-101089541 AGTGACATTTGAGGGCCTTGGGG - Exonic
1073671685 10:105597625-105597647 AGAGAAAGCTGAGTGAATTTGGG - Intergenic
1073755776 10:106579141-106579163 AGTTCAGTCTGAGGGACATTGGG + Intronic
1078070415 11:8105239-8105261 AGTGTAATCTGAGGGCCACTTGG - Exonic
1079620500 11:22548660-22548682 AGTGAAACCTGAGAGGTTTTTGG + Intergenic
1082214302 11:49548704-49548726 ATAGAAATTTGTGGGACTTTGGG + Intergenic
1082603392 11:55191149-55191171 AGGGATATTTGAGGGCCTTTTGG - Intergenic
1082913066 11:58398828-58398850 AGTGACATATGTGGGCCTTTAGG + Intergenic
1086195182 11:84129422-84129444 ATTGAAATTTGGGGGACATTTGG - Intronic
1086635299 11:89075804-89075826 ATAGAAATTTGTGGGACTTTGGG - Intergenic
1088395672 11:109365484-109365506 TGTGGAAACTGAGGGCCTTTTGG + Intergenic
1089168887 11:116499014-116499036 AGTGAAATCAGAGAGAATCTGGG - Intergenic
1093894354 12:24561000-24561022 AGGGAAATCTGTGGGATTTGGGG - Intergenic
1095225551 12:39672939-39672961 AGTGCCACCTCAGGGACTTTGGG + Intronic
1096201645 12:49687874-49687896 AGTGAGATGTGGAGGACTTTAGG - Intronic
1096901679 12:54889224-54889246 AATGAAATATGAGGGATTGTAGG + Intergenic
1099886507 12:88537685-88537707 AATGAAATCTGAAACACTTTTGG + Intronic
1099908123 12:88796124-88796146 AGTTAAATTTGAGGCACTTATGG + Intergenic
1100090385 12:90961245-90961267 AGTCATATCTGTGGTACTTTAGG + Intergenic
1100270586 12:93020807-93020829 AGTGAAATGTGAGGGAGTGGGGG - Intergenic
1100984993 12:100195249-100195271 ACTGGAATCTGAGGCACTTAGGG - Intergenic
1101421462 12:104554604-104554626 AGAGAAATCTCAGGGACTGCTGG + Intronic
1102676937 12:114665483-114665505 GGTGAATTCTGACGGCCTTTGGG - Intergenic
1104875367 12:132030023-132030045 ATTGAAATCTGAAGGACGTCGGG + Exonic
1105312111 13:19221264-19221286 AGTGAAATTTCAGGAACTTTGGG - Intergenic
1105363646 13:19744453-19744475 AGTGAAATATCAGGAACTTTGGG - Intronic
1105507405 13:21022432-21022454 AGTGAGATGTCAGGGATTTTAGG - Intronic
1108417996 13:50220453-50220475 AGTGATAACTGAGGAATTTTGGG + Intronic
1109852237 13:68080756-68080778 AGTTCAATTTGAGGAACTTTTGG - Intergenic
1109964988 13:69680410-69680432 AGAGAAAACTGAGGGAGTTCAGG + Intergenic
1110084743 13:71364165-71364187 AGTGAGATCTCTGAGACTTTGGG - Intergenic
1110680213 13:78302117-78302139 AAGCAAATCTGAGGTACTTTAGG + Intergenic
1111290256 13:86157452-86157474 AGTGACATCTGTGGTACTTTGGG - Intergenic
1112568113 13:100568688-100568710 AGTTAAGACTGAGGGACTGTTGG - Intronic
1115343620 14:32318680-32318702 ACTGAATTCTGAGGTAATTTAGG + Intergenic
1117622209 14:57599082-57599104 AGAGAAAGCTGTGGGAATTTAGG - Intronic
1118363151 14:65072544-65072566 AGTCAAACCTGAGTGACTTGAGG + Intronic
1119565621 14:75626732-75626754 AGTGAAACCAGATGGCCTTTGGG + Intronic
1120016019 14:79474536-79474558 AGTTACCTCTGAGGGAATTTAGG + Intronic
1121974533 14:98390665-98390687 ATTGTAATCTGAGGGGCTGTGGG + Intergenic
1125017522 15:34950867-34950889 AGTGACATCTGTGGGACATCTGG - Intronic
1125116504 15:36099667-36099689 AGTGAAATCTATGGCACTTGCGG - Intergenic
1126499152 15:49325316-49325338 AGTGGGATCCGAGGGATTTTAGG + Intronic
1126822922 15:52522547-52522569 AGTGAAGTATGAGGTACTGTTGG - Intronic
1126842206 15:52728154-52728176 AGTGGACTCTGAGGCACTTCAGG - Intergenic
1127814715 15:62597681-62597703 AATGAAATCTGAAGCACTTCTGG - Intronic
1128534315 15:68479222-68479244 GGTGAGATCTGAGGGAGTCTGGG + Intergenic
1129265572 15:74391568-74391590 AGGGAAGCCTGTGGGACTTTGGG - Intergenic
1129555123 15:76500325-76500347 AGTAAACTCTGAGCTACTTTAGG - Intronic
1129752082 15:78072781-78072803 ACTGGAATCTGAGGCACTTAGGG - Intronic
1133857441 16:9562883-9562905 ACTGACATCTGAGCAACTTTGGG - Intergenic
1134375083 16:13664642-13664664 AATGAAAGCTGGGGCACTTTGGG - Intergenic
1134401666 16:13915417-13915439 AGTGGATTCAGAGGGACTTCTGG + Intergenic
1136274842 16:29173348-29173370 AGTGAAATGAGAGGGTGTTTCGG + Intergenic
1140393584 16:74608616-74608638 AGTGACATCTCAAGGACTTCTGG - Intergenic
1140853527 16:78956654-78956676 AGTGAAAACAGAGGTATTTTAGG - Intronic
1142079141 16:88139105-88139127 AGTGAAATGAGAGGGTGTTTCGG + Intergenic
1144796043 17:17891904-17891926 AGTTAATTCTGAGGAACTCTGGG - Intronic
1144858362 17:18283687-18283709 ACTGACATCTGAGGGAATTTGGG - Intronic
1148904216 17:50901287-50901309 AGTCAGATCTGAGAGACCTTGGG - Intergenic
1153098532 18:1437391-1437413 AGGGAAATCTGAGGGTGGTTGGG - Intergenic
1153813012 18:8768456-8768478 AGTCAAATCAGAGGGTCTGTAGG + Intronic
1156436872 18:37140631-37140653 AGTAAAATCTTAGGAACTTAAGG + Intronic
1159517492 18:69476427-69476449 AGAGAAATCAGAGGGATTCTTGG + Intronic
1159960335 18:74550542-74550564 AGTGAAGGCTGGGGGACTATTGG + Intronic
1161453319 19:4358423-4358445 AGAGAAACCCCAGGGACTTTGGG + Intronic
1163231152 19:16003140-16003162 AGTGGAACCTGAGGGGCTATGGG - Intergenic
1163594142 19:18211130-18211152 GGTGAGGTCTGAGGGACTTCGGG + Exonic
1164893809 19:31850780-31850802 AGAAAAATCTAAGTGACTTTGGG + Intergenic
1167857972 19:52257958-52257980 AGTGAACTCTGAGGAACTGAGGG - Intergenic
1167973081 19:53201146-53201168 AGTGAAATGAGAGGGACTGAGGG - Intergenic
926355925 2:12040655-12040677 AGTCACATCTGAGGTACTTGGGG + Intergenic
928433094 2:31236262-31236284 AGTGATTTCTGAAGGAGTTTGGG + Intronic
929078386 2:38097283-38097305 AGTGAAATCTTTGGGATTGTAGG - Intronic
931046808 2:58363041-58363063 AGAGAGATCTGAGAGAGTTTGGG - Intergenic
931235080 2:60406177-60406199 ACTGACATCTGTGGGAGTTTAGG - Intergenic
935290864 2:101610019-101610041 AGTCACATCTGAGGTACTGTGGG - Intergenic
935690122 2:105723461-105723483 ACTGAAATCTGAGGCAATTCTGG - Intergenic
937054720 2:118924506-118924528 TCTGAAATCTGAGACACTTTTGG + Intergenic
937759440 2:125582676-125582698 AGTGATATCCGAGGGAGTCTGGG - Intergenic
938222251 2:129580465-129580487 TGTGAAATTTGGGGGACTTGGGG - Intergenic
940096899 2:149987149-149987171 ACAGAAATCTCAGGGTCTTTAGG + Intergenic
941988784 2:171534483-171534505 ACTGAAATATGGTGGACTTTGGG - Intronic
943405906 2:187484463-187484485 AGATAAAACTGAGTGACTTTAGG + Intronic
943479697 2:188403180-188403202 AATGAAATATGAGAGACTTAGGG - Intronic
945618898 2:212108599-212108621 AGGAAAATCAGAGGGAGTTTTGG + Intronic
947504047 2:230693439-230693461 TGAGAATTCTTAGGGACTTTGGG - Intergenic
1170487009 20:16828680-16828702 AATGGAATCAGATGGACTTTTGG + Intergenic
1172003516 20:31800700-31800722 AGTGAAAGCTGAGGGACTTGAGG + Intronic
1175329576 20:58154104-58154126 AGTGACATATGAGGGATTCTTGG + Intronic
1177684986 21:24424210-24424232 ATTGAAATCATGGGGACTTTGGG + Intergenic
1177688360 21:24469774-24469796 AATGAAAACTGTGGGAATTTTGG + Intergenic
1179400426 21:41077620-41077642 AGTGACATCTGAGGTACTGGAGG + Intergenic
1181236461 22:21450413-21450435 AGTGAATACTGACGGATTTTGGG - Exonic
1181619294 22:24077559-24077581 CGTGAGCTCTGAGGGCCTTTGGG + Intronic
1182626978 22:31654678-31654700 AATGAAATCTGAGGATCATTCGG + Intronic
1184157404 22:42677079-42677101 CCTGAAATCTGAGGAACTTTAGG + Intergenic
949318048 3:2778462-2778484 AGTGAAATTTGAGTGGCTTTGGG - Intronic
950144453 3:10639217-10639239 AGTGAATTCTGCTGGGCTTTTGG - Intronic
951926006 3:27909415-27909437 AGGGAAATCTGAGGGAGATATGG + Intergenic
952291682 3:32022933-32022955 TGTCAAATATGAGGGACTTGAGG - Intronic
952336285 3:32405961-32405983 ACTGACAACTGGGGGACTTTTGG - Intronic
953033258 3:39191438-39191460 AGTGACCTCTGAGGGTCCTTAGG - Intronic
953487730 3:43317966-43317988 AGTGACATCTGATGGACTGAGGG - Intronic
955845640 3:63160265-63160287 TTTGAAATCTGAGAGACTTGGGG - Intergenic
955940655 3:64144274-64144296 TCTGAAAGCTGAGTGACTTTGGG + Intronic
957402729 3:79737169-79737191 AGTGCAATATGAGGCACTTAGGG + Intronic
959745535 3:109772307-109772329 AATGATATGTGACGGACTTTGGG + Intergenic
961140833 3:124554368-124554390 AATGTAATCTGAGGGCCTTTTGG - Intronic
961462217 3:127058246-127058268 AGGGAAATCCGTGGGACTTGTGG + Intergenic
964087036 3:152831303-152831325 AGTCAAATCTGATGGTTTTTTGG + Intergenic
964287861 3:155140017-155140039 AGTGAAATGTAAGAGATTTTTGG - Intronic
964334059 3:155636113-155636135 AGTGAGATGTGAGGGAAGTTGGG - Intronic
965896983 3:173590386-173590408 CGTGAAATAACAGGGACTTTTGG - Intronic
966033775 3:175384310-175384332 AGTGAAATCTAGGAGAGTTTAGG - Intronic
966566241 3:181384547-181384569 AGTAAATTCTGAGGTACTTAAGG - Intergenic
966937176 3:184718422-184718444 AATGAAATCTGAGAGAAGTTAGG + Intergenic
970074125 4:12198107-12198129 TGTGAAATCTTAGGAGCTTTGGG + Intergenic
971254137 4:24998647-24998669 AGTGAATTTTTAGTGACTTTTGG + Intergenic
971486008 4:27160958-27160980 AGTGAAATGTAAGGGAGATTTGG + Intergenic
971665764 4:29482248-29482270 ATTGAAATCTGAAGGACTTTTGG + Intergenic
971816014 4:31490252-31490274 AGTGAAATCTGAATGAATTCTGG + Intergenic
974782991 4:66578180-66578202 TGTCAAGTCTGAGCGACTTTAGG - Intergenic
977712644 4:100145449-100145471 AGTGAATGCTGAGGGCCTATTGG - Intergenic
978114804 4:105006158-105006180 AGTGAAGTCTTAGGGAAATTAGG - Intergenic
978942297 4:114450908-114450930 ACTGGAACCTGAGTGACTTTTGG + Intergenic
979568512 4:122185068-122185090 AGTGAAATCTAAAGTAATTTTGG + Intronic
980077256 4:128306876-128306898 GGAGAAATCTGATGGACTCTTGG + Intergenic
980205280 4:129711322-129711344 AGGGAAATGAGAGAGACTTTGGG + Intergenic
981208724 4:142075314-142075336 AGTGAAAGCTGTGGGAATTCAGG + Intronic
983491545 4:168396190-168396212 AGGGAAATCTGTGGGGCCTTAGG - Intronic
986395041 5:7321103-7321125 AGTGAATTCCGAGTCACTTTGGG - Intergenic
988444381 5:31269047-31269069 TGTGAAATCTGAAGAACTCTAGG + Intronic
988620584 5:32819193-32819215 AGGGAATTTTGAGGGACTGTTGG - Intergenic
992192068 5:74302886-74302908 AGTGGAAGCTGAAGTACTTTTGG - Intergenic
996013870 5:118509564-118509586 AGTGCAATCTGAGGTCCCTTGGG + Intergenic
996022062 5:118602258-118602280 AGTGAAATATGAGGAAGTGTGGG + Intergenic
997851314 5:137335065-137335087 AGTGAGATCTCAGGAAATTTGGG + Intronic
1000925952 5:167194338-167194360 AGAGGAAACTGAGAGACTTTGGG - Intergenic
1001068557 5:168561824-168561846 AGTTAAAGCTGAGATACTTTTGG - Intronic
1001517328 5:172365082-172365104 AGGGAAATGGGAGGGCCTTTGGG + Intronic
1002832954 6:840589-840611 AGTGACATCTAATGTACTTTGGG + Intergenic
1003129569 6:3383971-3383993 GCAGAAACCTGAGGGACTTTAGG - Intronic
1005831361 6:29673447-29673469 TGTGATAGCTGAGGGACTTGGGG + Exonic
1007133211 6:39496208-39496230 AGTGAAATCTGAGGGACTTTAGG - Intronic
1007754137 6:44087921-44087943 TGTGCAAGCTGAGTGACTTTGGG - Intergenic
1008318083 6:50071769-50071791 ATTGAAATCTCAGTGACGTTAGG - Intergenic
1008615900 6:53225200-53225222 AGAGGATTCTGAGGGTCTTTAGG + Intergenic
1008804036 6:55405925-55405947 AGTCAAATCTGAGTGACTAATGG + Intergenic
1009609627 6:65923912-65923934 AGTGAAATATAAGGGAGTTTGGG - Intergenic
1010712343 6:79189926-79189948 AGTGAAATATGAGCTACTTAAGG + Intergenic
1011504542 6:88027736-88027758 AGTTACATCTGGGGGACTATTGG - Intergenic
1011516078 6:88155257-88155279 ATTCAAATCTGAGAGAATTTGGG + Intronic
1013319425 6:108972338-108972360 ACTGAAAACTGAGAGACCTTGGG - Intronic
1013432399 6:110066630-110066652 AGTGGAATCTCAGGGTCTTCAGG + Intergenic
1013753358 6:113432978-113433000 AGTGAAATCTAATGGGCTTAGGG + Intergenic
1014060649 6:117067721-117067743 ACTGAAAGCACAGGGACTTTAGG + Intergenic
1014916908 6:127161712-127161734 AGTGAAATCTCAGAGAATATAGG - Intronic
1016707270 6:147124062-147124084 CATAAAATCTGAGGGACTTACGG + Intergenic
1016873394 6:148840581-148840603 AGTGGACTCTGAGGGACCTGTGG + Intronic
1016920599 6:149289427-149289449 AGTGATCTATGAGGGACTTTAGG - Intronic
1021096154 7:16538466-16538488 ACTTAAAACTGAGGGTCTTTTGG + Intronic
1021990643 7:26138185-26138207 AGTAAAAACTGGGGGACTCTGGG - Intergenic
1026251864 7:68678310-68678332 AGAGACATCTGAGGGAGGTTAGG - Intergenic
1026586762 7:71661783-71661805 AGGGAGAGCTGAGGGACTTTGGG + Intronic
1027541828 7:79476707-79476729 GGTGAAATCTGAAGAACTTCCGG + Intergenic
1029945116 7:104524764-104524786 GAGGAAATCTGAGGGACTGTGGG - Intronic
1032805394 7:135349164-135349186 AGTGAATTTGGAAGGACTTTTGG + Intergenic
1032914287 7:136470575-136470597 AGTGAAATCTGCTGGGATTTTGG + Intergenic
1033475969 7:141692925-141692947 AGAAAAATCTGGGTGACTTTGGG + Intronic
1033991856 7:147297769-147297791 AGTGAAATCAGAGGAACAATTGG + Intronic
1036261065 8:7240631-7240653 AGTGAGTGCTGAGGGACGTTCGG - Intergenic
1036313102 8:7699175-7699197 AGTGAGTGCTGAGGGACGTTCGG - Intergenic
1036566484 8:9942843-9942865 AGTGCAATCTGAGGGCTTTGGGG - Intergenic
1036746749 8:11415315-11415337 GGTGAAATCCGGGCGACTTTGGG + Intronic
1036775215 8:11607129-11607151 AGTGAAATATTTGGGACCTTGGG + Intergenic
1036926438 8:12910638-12910660 CGTGAAATTTGATGGATTTTAGG + Intergenic
1040643757 8:49372747-49372769 AGAGAAAGCAGAGGGACATTGGG + Intergenic
1041797347 8:61759601-61759623 AGTGATAGCTGAGCGACTTTGGG - Intergenic
1042291485 8:67173245-67173267 AGTGAAATCTAGGGGATTTGAGG + Intronic
1043097154 8:75989586-75989608 AGTTAAATCTGAGATTCTTTAGG - Intergenic
1044699843 8:94956068-94956090 AGTGCAAGCTGAATGACTTTAGG + Intronic
1045208847 8:100073565-100073587 AGTGAGATCTGAAGGACATTTGG + Intronic
1046609234 8:116405626-116405648 AGAGAAATTTGAGCAACTTTAGG + Intergenic
1046678683 8:117142233-117142255 AGTCATATTTGAGGGACTTTTGG - Intronic
1047167207 8:122452422-122452444 AGTGAAAACTGAGTCACTTATGG + Intergenic
1048176450 8:132156863-132156885 AGAGAAATGAGAGGGAGTTTGGG + Intronic
1048375123 8:133816566-133816588 AGTGGAACCAGAGGGAATTTGGG + Intergenic
1052071599 9:24088726-24088748 AGTGAACTGTGGGGGACGTTGGG + Intergenic
1053377218 9:37617837-37617859 AGTGAACTCAGAGTCACTTTAGG - Intronic
1056718048 9:89049378-89049400 AGTGAAGTTTGAAGGACTTTTGG - Intronic
1058391968 9:104505778-104505800 AATGAAATATGAGTGATTTTGGG + Intergenic
1058848021 9:108981387-108981409 AGTGAAAGGTCATGGACTTTGGG + Intronic
1060046865 9:120348459-120348481 ACTGAAATCAGAGAGACATTGGG + Intergenic
1062179110 9:135181173-135181195 AGTGACAGATGAGGGACTTGGGG + Intergenic
1186295001 X:8139594-8139616 ACTGAAATCCAATGGACTTTAGG - Intergenic
1186896496 X:14009273-14009295 AGGGAAAGATGAGGGACCTTAGG - Intronic
1187746365 X:22413687-22413709 AGTGACTTCAGAGGCACTTTTGG - Intergenic
1188801007 X:34529510-34529532 AGTGAAATTGGAGGGAGTTGGGG + Intergenic
1188930767 X:36108389-36108411 AGTGAAATTTGAGGTGCTTATGG - Intronic
1190279146 X:48918201-48918223 TGTGAGATTTGTGGGACTTTTGG - Intronic
1191083956 X:56545036-56545058 AGTTAAGACTGAGGGACTGTTGG - Intergenic
1191242440 X:58200080-58200102 AGTGACATCTGGGCGACATTAGG + Intergenic
1191752913 X:64563205-64563227 ACTGGAATGTGAGGGCCTTTTGG - Intergenic
1191923130 X:66278718-66278740 AGTTAAGACTGAGGGACTGTTGG - Intergenic
1193451441 X:81674743-81674765 TGTGAAATCTGTAGGATTTTCGG + Intergenic
1194129562 X:90064478-90064500 AGTGAATTCTTAGGCATTTTTGG - Intergenic
1194430070 X:93792144-93792166 AAGGAAATCTAAGTGACTTTAGG + Intergenic
1195338013 X:103876417-103876439 AGAAAAATCAGAGGGATTTTTGG + Intergenic
1197195788 X:123699625-123699647 AGGTAGATCTTAGGGACTTTAGG - Intronic
1197698675 X:129579012-129579034 ATTGAAATCTGAAACACTTTTGG - Intronic
1200827618 Y:7660233-7660255 AATGGAATCTGTGGGGCTTTGGG + Intergenic
1200986365 Y:9306242-9306264 AGTGAAACCTGCAGGGCTTTGGG + Intergenic
1201947293 Y:19525624-19525646 ACTGAAATCTGAAACACTTTTGG + Intergenic
1202107379 Y:21385247-21385269 AATGGAAACTGAGGGGCTTTGGG + Intronic
1202124213 Y:21554660-21554682 AGTGAAACCTGCAGGGCTTTGGG - Intergenic
1202154795 Y:21874720-21874742 AGTGAAACCTGCAGGGCTTTGGG + Intergenic