ID: 1007133212

View in Genome Browser
Species Human (GRCh38)
Location 6:39496216-39496238
Sequence GATGTGACAGTGAAATCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 270}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007133212_1007133222 28 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133222 6:39496267-39496289 CGGATGGATGTCAACAGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 78
1007133212_1007133214 4 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133214 6:39496243-39496265 TTCATTTGCCACATGACCACAGG 0: 1
1: 0
2: 2
3: 21
4: 125
1007133212_1007133217 12 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG No data
1007133212_1007133219 23 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133219 6:39496262-39496284 CAGGACGGATGGATGTCAACAGG No data
1007133212_1007133215 8 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133215 6:39496247-39496269 TTTGCCACATGACCACAGGACGG 0: 1
1: 0
2: 1
3: 29
4: 184
1007133212_1007133221 25 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133221 6:39496264-39496286 GGACGGATGGATGTCAACAGGGG 0: 1
1: 0
2: 1
3: 24
4: 170
1007133212_1007133220 24 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133220 6:39496263-39496285 AGGACGGATGGATGTCAACAGGG 0: 1
1: 0
2: 1
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007133212 Original CRISPR GATGTGACAGTGAAATCTGA GGG (reversed) Intronic
901558327 1:10049364-10049386 GATGGGGCAGTTAATTCTGATGG + Intronic
902432885 1:16377189-16377211 GGTGTTAAAGTGAAATCTGGTGG + Intronic
903533996 1:24054482-24054504 GATGTGACAGTGAGGTGTGAGGG - Intergenic
903994135 1:27294744-27294766 GATGTTACATTGAAATGTGGGGG + Intronic
904328494 1:29743073-29743095 AATGGGGCAGTGAAGTCTGAAGG - Intergenic
904441723 1:30536070-30536092 GGGGGGACAGTGAAGTCTGAAGG + Intergenic
904860540 1:33534292-33534314 GTTGTGACACTCAAATGTGATGG + Intronic
905414988 1:37797739-37797761 GAGGTTACAGTGAACTATGATGG + Intronic
905701236 1:40016793-40016815 GATATGACAGTGATATTTGTTGG - Intergenic
905751080 1:40464539-40464561 TATGTGCCAGTGAAATTTCATGG + Intergenic
908916017 1:69127418-69127440 GCAGAGACAGTGAAGTCTGAGGG - Intergenic
909094859 1:71274138-71274160 ACTGTGACAGTGACATCAGAAGG + Intergenic
909096813 1:71297560-71297582 AATGTGACAATGAAAACTAAAGG + Intergenic
911658065 1:100467011-100467033 TCTGTGACAGTGAAATTTCATGG + Intronic
911993910 1:104737820-104737842 GAAGTGACAGTGAATTCATATGG + Intergenic
912490393 1:110059614-110059636 CATGTGGCAGGGAAAACTGAGGG - Intronic
913441603 1:118904257-118904279 GATGTGATAATTATATCTGAAGG - Intronic
914420777 1:147526749-147526771 GAAGAGACTGGGAAATCTGATGG + Intergenic
922324094 1:224512413-224512435 GAGGTTACAGTGAACTATGATGG + Intronic
923540307 1:234884095-234884117 GATGTGACAGTGGCAGGTGAAGG + Intergenic
923689323 1:236177203-236177225 TATGTCACACTGGAATCTGAGGG + Intronic
1063021262 10:2130598-2130620 GATGTGAATGTGATATGTGAGGG - Intergenic
1063447836 10:6130910-6130932 GATTTGACAGTCAAATGGGAAGG - Intergenic
1063981646 10:11457432-11457454 GCTGTGGAAGTGAAATGTGAGGG - Intronic
1065363694 10:24914083-24914105 GATTTGACTGTGAAACTTGATGG - Intronic
1066185811 10:33009552-33009574 AAAGTAACAGTGAAATCAGATGG - Intergenic
1067055700 10:43048622-43048644 GAGGTCACAGTGAAATCAGTGGG - Intergenic
1067205659 10:44209926-44209948 GATTTGTAAGTGAAGTCTGATGG + Intergenic
1067801962 10:49365475-49365497 GATGTGCCAGTGAGATCTCCTGG + Exonic
1068028740 10:51681539-51681561 GATATAAGAGAGAAATCTGAGGG - Intronic
1068193003 10:53678065-53678087 TATGTGATAATGAAACCTGAAGG - Intergenic
1068465927 10:57391425-57391447 TGTTTGTCAGTGAAATCTGAAGG + Intergenic
1069627049 10:69874797-69874819 GATGCAACAGTGAAGTCTAAGGG + Intronic
1072565691 10:96615053-96615075 GATGCTACACTGAACTCTGAAGG + Intronic
1073115502 10:101089527-101089549 GAGGGGACAGTGACATTTGAGGG - Exonic
1073421647 10:103428664-103428686 GATGAGTCAGTGAACTCTGTGGG + Intronic
1074394888 10:113089451-113089473 GTGCTGACAGTGAAGTCTGAGGG - Intronic
1074488104 10:113909358-113909380 ATTGTGACAGCTAAATCTGATGG + Exonic
1076014062 10:127013702-127013724 CAAGTCACAGTGAAAACTGAGGG + Intronic
1076233312 10:128840072-128840094 CATCTGACAGTGAAGTTTGATGG - Intergenic
1077441993 11:2573225-2573247 GATTTGAGAGGGAAATCGGAGGG + Intronic
1077809855 11:5626065-5626087 GCAGTTACAGTGAACTCTGAAGG - Intronic
1078621247 11:12910514-12910536 AATATGAAAGTGAAATCTTACGG + Intronic
1079431159 11:20389183-20389205 TATGTGACATGCAAATCTGAAGG - Intronic
1080892577 11:36422264-36422286 CATCTGACAGTCAAATGTGAAGG - Intronic
1080996608 11:37609800-37609822 AATGTGACAGTGAAAACTCTGGG + Intergenic
1084584743 11:70051394-70051416 TATGTAACAGTGAAATTTCAGGG + Intergenic
1084914915 11:72421449-72421471 GATGTGACAGTGATGACCGAAGG + Intronic
1088028598 11:105218364-105218386 GTTTTGTAAGTGAAATCTGATGG + Intergenic
1088081166 11:105916282-105916304 GATGGGACAGTGAAGACTCAGGG - Intronic
1088357422 11:108958587-108958609 GAAGTGACAGTTATATCTGCTGG + Intergenic
1088858623 11:113779575-113779597 GATGTGGGTGTGAAATCTGGGGG - Intergenic
1089157460 11:116413485-116413507 GATGTGACAGTGATGAATGAAGG - Intergenic
1092291959 12:7165124-7165146 GATGAGACAGTAAAATGTGGAGG + Intergenic
1092815433 12:12308626-12308648 GTTTTGTCAGTGAAATTTGAAGG - Intergenic
1093072794 12:14724196-14724218 GATCTCACAGTGAATTCTGAGGG - Intergenic
1093969071 12:25357899-25357921 GGTGAGACAGGGAAAACTGATGG - Intergenic
1094299957 12:28952265-28952287 GAGGTGACAATGAAGTGTGATGG - Intergenic
1096088975 12:48885650-48885672 GATGGCACAGTGAAAGCTGAGGG + Intergenic
1096383019 12:51174829-51174851 GATGTCACATGGAGATCTGAGGG + Intergenic
1097315839 12:58170769-58170791 CTTGTGATAGTGAGATCTGATGG + Intergenic
1097406270 12:59194475-59194497 CTTGTGATAGTGAGATCTGATGG - Intergenic
1099431049 12:82586448-82586470 GATGTGACAATAAAATGTTAGGG - Intergenic
1100800467 12:98225306-98225328 CAGGTAACAGTTAAATCTGATGG - Intergenic
1101134686 12:101730281-101730303 GATGTGACAGAGAAAGGAGATGG + Intronic
1101490154 12:105202541-105202563 GAAGAGACAGTGAAAGATGAGGG + Intronic
1101930492 12:109009802-109009824 GGAGTGACAGTGACATCTGGTGG + Intronic
1102891837 12:116565415-116565437 GATGTGTGAATGAGATCTGATGG - Intergenic
1107001700 13:35553761-35553783 GATATCACAGTGAATTCTCAGGG + Intronic
1107161641 13:37236880-37236902 GTTTTGACAGTTCAATCTGAAGG + Intergenic
1108613593 13:52108272-52108294 AAAGTGTCAGTAAAATCTGATGG - Intronic
1109911631 13:68919679-68919701 CTAGTGACAGTGAAACCTGAAGG + Intergenic
1112135192 13:96570427-96570449 AATGCGACATTGAAATCTCAGGG + Intronic
1114286550 14:21249728-21249750 GATGGCACAATGAAATGTGAAGG - Intronic
1115025989 14:28746859-28746881 GAGGTAAAAGTAAAATCTGATGG - Intergenic
1117294789 14:54369430-54369452 GAAGTGACAGTGAGCTATGATGG - Intergenic
1120681450 14:87485523-87485545 AATCTGACACTGAAAGCTGACGG - Intergenic
1120722030 14:87900085-87900107 GATGTGACGGGGAGAACTGAGGG - Intronic
1120814858 14:88845434-88845456 GATGTGACATTGAAATGTAGGGG + Intronic
1122083267 14:99281869-99281891 TATGTACCAGTGAAATCTGGGGG - Intergenic
1123738983 15:23216638-23216660 GAGGACACAGTGAAATCTTAGGG + Intergenic
1123838960 15:24226488-24226510 GATGTGACTGTAAACTCTGAAGG + Intergenic
1124117921 15:26865116-26865138 GAGGGGACAGTGAAATCGTAAGG - Intronic
1124290203 15:28445608-28445630 GAGGACACAGTGAAATCTTAGGG + Intergenic
1124293035 15:28471960-28471982 GAGGACACAGTGAAATCTTAGGG - Intergenic
1124485224 15:30108490-30108512 GAGGTTACAGTGAACTATGATGG - Intergenic
1124518354 15:30388782-30388804 GAGGTTACAGTGAACTATGATGG + Intronic
1124540299 15:30577467-30577489 GAGGTTACAGTGAACTATGATGG - Intergenic
1124696424 15:31868152-31868174 GATGTGACAGTGATCTCTTTTGG + Intronic
1124758354 15:32430113-32430135 GAGGTTACAGTGAACTATGATGG + Intergenic
1125439013 15:39681089-39681111 GATATGCCAGTTAAATCTGGGGG - Intronic
1125495721 15:40191507-40191529 GATATGACAGTGAAAGCTCAGGG - Intronic
1125612562 15:40981729-40981751 GTTGTGACCGTGATATGTGAAGG - Intronic
1126157635 15:45580305-45580327 GATGTGACAATGAAAGCAGGGGG + Intergenic
1126256333 15:46630102-46630124 TATGTCACAGTGAAAACTGCTGG + Intergenic
1127178450 15:56387205-56387227 AATATCACTGTGAAATCTGATGG + Intronic
1127465394 15:59239382-59239404 AATGTGACAGTGTAAACTTAAGG - Intronic
1130405624 15:83598319-83598341 GCTGTGACAGTGAAGTCTAAGGG - Intronic
1130663789 15:85852486-85852508 GATCTGACAGTGAGAGCTGGTGG - Intergenic
1130925165 15:88380059-88380081 GATATGGCAATGAAATCTGTGGG - Intergenic
1131099132 15:89674319-89674341 GAGGTTACAGTGAACTATGATGG - Intronic
1131345062 15:91638830-91638852 GATGTGAGAATTAAATATGATGG + Intergenic
1134303728 16:13013633-13013655 GATGTGACAGTGATGCCTCATGG - Intronic
1135295523 16:21276490-21276512 GGTGTGACAGTTAACTCTTAAGG - Intronic
1136944984 16:34638744-34638766 GATGAGGCAGTGACATCTTATGG + Intergenic
1137689388 16:50410957-50410979 GAAGTGACAGTAAAATCAGGAGG - Intergenic
1137690295 16:50421901-50421923 GATGAGAAAATGAAAACTGAGGG + Intergenic
1139598320 16:67970625-67970647 CATGTGTCTGAGAAATCTGAGGG - Intergenic
1139854172 16:69967650-69967672 GATCTGAGAATGAATTCTGAGGG - Intergenic
1139883153 16:70190564-70190586 GATCTGAGAATGAATTCTGAGGG - Intergenic
1140369355 16:74404956-74404978 GATCTGAGAATGAATTCTGAGGG + Intergenic
1141974927 16:87509412-87509434 GATGTGACTGTGGAAGCAGAGGG - Intergenic
1144604998 17:16657250-16657272 AATGTGAAAATGAAATGTGATGG - Intergenic
1148142805 17:45340294-45340316 GATGTAACAGTGCCAACTGAGGG - Intergenic
1148999701 17:51744543-51744565 GAGGTTACAGTGAACTGTGATGG + Intronic
1149371187 17:55994719-55994741 GAGGTGACAGTGAGCTATGATGG - Intergenic
1149718030 17:58813039-58813061 GATGTGGCAGTGAGAGATGAGGG + Intronic
1151011901 17:70509023-70509045 GATGGGAGACTGAAATCTAATGG - Intergenic
1151140678 17:71989302-71989324 CAAGTGACAGTTAAAGCTGAGGG - Intergenic
1151353094 17:73543068-73543090 GATGGGAGAGGGGAATCTGAAGG + Intronic
1155041731 18:22070517-22070539 TACGTAACAGTGAAATCTGTGGG + Intergenic
1156342297 18:36220615-36220637 GATCTGACAGTTCAATCAGACGG + Intronic
1157460425 18:47887424-47887446 GATGTGACAGTAATGTGTGATGG + Intronic
1157567707 18:48690905-48690927 GAGGTGCCAGTCAAATCTAAGGG + Intronic
1158964624 18:62611830-62611852 GCTGTGACAGGGGAATCTGTGGG + Intergenic
1159224121 18:65509701-65509723 AATGTGAAAGTGGAGTCTGATGG - Intergenic
1159462654 18:68740533-68740555 GATGTGAGATTGACATATGATGG + Intronic
1162225235 19:9215589-9215611 GATGTGACAGTTAACTCTCAGGG + Intergenic
1163376492 19:16935990-16936012 GAGGTGGCAGTGAACTGTGATGG - Intronic
1164206581 19:23064075-23064097 AATGTCACAGTTAAATCTGCAGG + Intergenic
1164242261 19:23399848-23399870 TATGTGACAGTGCCTTCTGAGGG + Intergenic
1164283170 19:23787151-23787173 GATGTCACAATGTCATCTGAAGG - Intronic
1165787527 19:38470854-38470876 GAGGTGACAGTGGAGTCAGAAGG + Intronic
1166637311 19:44461708-44461730 GATGGCACATTGAAATTTGAGGG - Intergenic
1168255563 19:55162867-55162889 GAGGTAACAGTGAACTATGATGG - Intronic
926381182 2:12291522-12291544 GATATGACTGTGAAATCTGCAGG + Intergenic
929793772 2:45042582-45042604 CATGGGACAGTGAATTCTGGGGG - Intergenic
934164251 2:89280042-89280064 GATGTGTATGTGAAATCTGGAGG + Intergenic
934181856 2:89630735-89630757 GATATAACAGTGATGTCTGAAGG + Intergenic
934203023 2:89902482-89902504 GATGTGTATGTGAAATCTGGAGG - Intergenic
936350985 2:111712445-111712467 TATGTGATGGTGAAATCTGTTGG + Intergenic
937556628 2:123165958-123165980 GATGTGACAGTCACAACTGCTGG + Intergenic
940250758 2:151673678-151673700 CATGTAACAGTGAACTCTGCAGG + Intronic
940750802 2:157625515-157625537 GAAGTGAAAGTGAAAGCTCAGGG - Intronic
942705642 2:178768849-178768871 GAGGTGACAGTGAACTATGAAGG - Exonic
943360537 2:186913723-186913745 GATGTGAGAATGAAAACTGAAGG - Intergenic
943730964 2:191303294-191303316 GATGTGAAAGTGCTTTCTGAAGG + Intronic
944490528 2:200253918-200253940 TATGTGCAAGTGAAATATGAAGG - Intergenic
944978558 2:205087944-205087966 AATGTGACAGTGTAATCATAAGG + Intronic
945741195 2:213664138-213664160 TATGTGACAGTGGAAACAGAGGG - Intronic
947436213 2:230074616-230074638 GAGGTTACAGTGAACTATGATGG + Intergenic
1169724532 20:8714630-8714652 AATGTGGCAGTGTATTCTGATGG + Intronic
1170706767 20:18750594-18750616 AATGTGACAGAGAAATGTCAAGG - Intronic
1174345328 20:49924870-49924892 GAGGTTACAGTGAACTGTGATGG + Intergenic
1174688610 20:52480032-52480054 TGTGGGACAGTGAAATATGAGGG + Intergenic
1175670218 20:60896089-60896111 GTGGTGATAGTGAAATATGATGG + Intergenic
1180380034 22:12132518-12132540 GAAGTGACAGTGAGATGTGAAGG + Intergenic
1182134645 22:27890136-27890158 GAGGTGACTGTGAAATCTAGTGG - Intronic
1182158938 22:28102463-28102485 TTTGTGAGAGTCAAATCTGAAGG + Intronic
1182266498 22:29119977-29119999 GATGTGACAATGGAAACAGAGGG + Intronic
1182653239 22:31869171-31869193 GAGGTTACAGTGAGATGTGATGG + Intronic
1183130453 22:35829785-35829807 AAGGTGACAATGAAATCTTAGGG - Intronic
1183309597 22:37102244-37102266 GATGGGACAGAGGAAGCTGAGGG - Intronic
950693141 3:14676796-14676818 AATGTGACACTGGAATCTCATGG - Intronic
950786682 3:15442772-15442794 GGTGTGACATTCAAAACTGAAGG + Intronic
951706760 3:25551577-25551599 GAGGTGCCAGTGATATCTAATGG + Intronic
952392370 3:32891317-32891339 GATGTGGCGGTGAATTCTGAGGG + Exonic
953487732 3:43317974-43317996 ACTGAGACAGTGACATCTGATGG - Intronic
953527445 3:43704527-43704549 GATGTGACATGGAACTCTGCAGG + Intronic
955604982 3:60691861-60691883 GATATGTCACAGAAATCTGAAGG - Intronic
956542726 3:70360591-70360613 GATTTGAAAGGAAAATCTGAAGG + Intergenic
956667170 3:71653002-71653024 TATGTTACAGTGCCATCTGATGG + Intergenic
957015617 3:75061136-75061158 GATGTGAGATAAAAATCTGAAGG + Intergenic
957877951 3:86173837-86173859 TATCTTGCAGTGAAATCTGAAGG + Intergenic
960128500 3:114027088-114027110 GATCTTACAGTGAAATCTCTTGG - Intronic
960455436 3:117865505-117865527 AATGTGACAATAAAATGTGATGG - Intergenic
962599531 3:136980774-136980796 GATTTGACAGTGAACTCTCTGGG + Intronic
963418846 3:145033370-145033392 GACGTGATATTGTAATCTGAAGG - Intergenic
963670127 3:148241197-148241219 TGTGTCACAGTGGAATCTGAGGG + Intergenic
963920820 3:150902991-150903013 AATTTGACAGTGAAATTTGAGGG - Intronic
965843098 3:172930213-172930235 GATGTGACAGTGAAAAAGGCAGG - Intronic
966626499 3:182022335-182022357 CCTGAGAGAGTGAAATCTGAGGG - Intergenic
968006569 3:195247237-195247259 GATTTCACTGTGAAATCTGAGGG + Intronic
970003637 4:11389302-11389324 GATGGTACAATGATATCTGAAGG + Intergenic
971763417 4:30799049-30799071 TCTGTGACAGTGAAATTTTAAGG + Intronic
972674335 4:41244811-41244833 GAGGTCACAGTGAACTGTGATGG - Intergenic
975796900 4:78015681-78015703 AATGTGACAGTGACATCCCAAGG - Intergenic
976162523 4:82218739-82218761 GATGTGACATGGAAATCTTTGGG - Intergenic
976385728 4:84455719-84455741 GATGTGACATTTAAAACTGATGG + Intergenic
976892118 4:90062437-90062459 GATATGCAAGTCAAATCTGAAGG + Intergenic
977125284 4:93157897-93157919 GTTTTGTAAGTGAAATCTGATGG - Intronic
977382222 4:96290190-96290212 GATGTTACACTGAAAGATGAGGG + Intergenic
977604913 4:98974503-98974525 GATGCTACAGTGAACTATGATGG - Intergenic
978301652 4:107275603-107275625 GTTGTGAGAGTGAAAAATGATGG - Intronic
978768034 4:112424831-112424853 GATGTGACAGAGAATGGTGAGGG + Intronic
980348412 4:131655186-131655208 GATGTAACACTGAAATGTTAGGG + Intergenic
982465143 4:155721197-155721219 GAGGTTACAGTGAACTATGATGG + Intronic
982969410 4:161964119-161964141 GATGTGATCCTGAAATATGACGG + Intronic
983197838 4:164826990-164827012 GAGGTGACAGTGAGCTATGATGG + Intergenic
983204118 4:164894949-164894971 GAAGTGAAAGTGAAATGTGAAGG + Intronic
984948814 4:184990673-184990695 GATTTGACAGTGAAGTGTTAGGG + Intergenic
985196620 4:187437172-187437194 GATGTGGCAGTGAGAGCCGAAGG + Intergenic
985361670 4:189182270-189182292 GATGTGACAGTGAAATCCTGAGG - Intergenic
985402943 4:189610222-189610244 GATGTGACACTGAAGTCAGCAGG - Intergenic
986162082 5:5239345-5239367 GAGGTGACAGTGAAAACAGCAGG + Intronic
986649894 5:9952979-9953001 GATGTGCCAGTGGAAGCAGAGGG - Intergenic
988939008 5:36122075-36122097 GAAGTAACAGTGGAAACTGATGG + Intronic
989367075 5:40668744-40668766 ACTGTGACATTGAAGTCTGAAGG - Intergenic
990898388 5:60724381-60724403 GAAGTGACAGTGACATTTCACGG - Intergenic
992071347 5:73152170-73152192 CATGTGAGAGTGAAGGCTGATGG - Intergenic
992925372 5:81579399-81579421 GATGAGAAAGTGAATTATGAGGG + Intronic
994139522 5:96326257-96326279 GATATGCCATTGAAATCAGAAGG - Intergenic
994322796 5:98412508-98412530 GATGAGATAGAGAAATCAGATGG - Intergenic
994616442 5:102110135-102110157 GATGTGATAGTCAAATATAAAGG + Intergenic
995342536 5:111075350-111075372 GATGTGTCACAGACATCTGAGGG - Intronic
995784205 5:115811254-115811276 GATGCTACAGGGAAATCTAAAGG - Exonic
999722711 5:154410846-154410868 GTTTTGTAAGTGAAATCTGATGG - Intronic
1000325201 5:160166808-160166830 GATTTGCCAATGAAATCTCAAGG + Intergenic
1000820394 5:165975408-165975430 AATGTGACAGTGACAACTAAGGG + Intergenic
1003571234 6:7257955-7257977 GATTCGTCAGTGAACTCTGATGG - Intergenic
1004247654 6:13995646-13995668 GATGTTACAGTGAACTGAGATGG + Intergenic
1006251479 6:32790760-32790782 AATGTGACAGTGAAGTGTTAGGG - Intergenic
1006608866 6:35280294-35280316 GAGGTTACAGTGAACTGTGATGG + Intronic
1007120896 6:39380302-39380324 GATGTGACAGTCAGAGCTGGGGG - Intronic
1007133212 6:39496216-39496238 GATGTGACAGTGAAATCTGAGGG - Intronic
1008025365 6:46629883-46629905 GACGTGACAGACAAATCTCATGG + Intronic
1009661989 6:66625464-66625486 GATATGACAGGGAATTCTGAAGG - Intergenic
1010129941 6:72479747-72479769 GAGGTTACAGTGAACTGTGATGG + Intergenic
1010137940 6:72577137-72577159 GAGGTGACACTCAAATCTGGAGG + Intergenic
1010237328 6:73586119-73586141 GATGTAACATTTAAATGTGAAGG - Intergenic
1011221047 6:85054889-85054911 CTTGTGATAGTGAAATCTCAAGG - Intergenic
1013782473 6:113744101-113744123 GAGGTGACAGTGATCTATGATGG + Intergenic
1014593054 6:123295898-123295920 GAGGTTACAGTGAAATGAGATGG + Intronic
1018509688 6:164511846-164511868 GCTGTGAAACTGGAATCTGAGGG + Intergenic
1020678657 7:11209185-11209207 GATGAGACAGTGATGTCTGGAGG + Intergenic
1024657766 7:51466502-51466524 GATGTGAAACTGGAATCTGAAGG - Intergenic
1025605948 7:63039939-63039961 GCTGTGAGAGTGAATTCTCAGGG + Intergenic
1026760994 7:73125500-73125522 AAAGTGACATTGAGATCTGAAGG - Intergenic
1027037335 7:74934296-74934318 AAAGTGACATTGAGATCTGAAGG - Intergenic
1027086227 7:75267159-75267181 AAAGTGACATTGAGATCTGAAGG + Intergenic
1029392530 7:100285183-100285205 AAAGTGACACTGAGATCTGAAGG + Intergenic
1030141254 7:106306206-106306228 CATGTGAGAGAGAAAGCTGAAGG - Intergenic
1030779948 7:113587924-113587946 GATGTGTCAGTGAAAGTTCATGG - Intergenic
1030885606 7:114932822-114932844 GATATGAAATTGAAATCAGAAGG - Intronic
1031625002 7:123982396-123982418 GAAGTCACAGTGAGATCTGATGG - Intergenic
1031969333 7:128052788-128052810 GAAGTAACACTGAAATCCGAGGG - Intronic
1032159480 7:129499892-129499914 GTTTTGTCAATGAAATCTGACGG + Intergenic
1032408056 7:131672013-131672035 GATGTTACAGTCATCTCTGATGG + Intergenic
1034608804 7:152345375-152345397 AAGGTTACAGTGAAATATGATGG + Intronic
1034870302 7:154677673-154677695 CCTGTCACACTGAAATCTGATGG - Intronic
1034876567 7:154729824-154729846 CATGTGACAATAAAATCTCAGGG - Intronic
1036779004 8:11633032-11633054 GCTGTGAGAGTGAATTCTCAGGG - Intergenic
1036846255 8:12172849-12172871 CATGTGTCAGAGAAGTCTGAGGG - Intergenic
1037029792 8:14090973-14090995 GATGTGACGGGGAAATCTATGGG - Intronic
1040375261 8:46818788-46818810 TATGTCACAGTGATATCTGTGGG - Intergenic
1041151342 8:54938143-54938165 AATGTGACACTGAATACTGAAGG + Intergenic
1041212824 8:55569760-55569782 AATGTGTAAGTGAAGTCTGATGG - Intergenic
1042057650 8:64783042-64783064 GAAGTGACAGGGAGATCTGCAGG - Intronic
1043937957 8:86164797-86164819 GTGGTGACATTGAAACCTGAAGG - Intergenic
1045203540 8:100012515-100012537 GAGATTACAGTGAAATATGATGG + Intronic
1046484535 8:114869393-114869415 GTGGTGACAGTGAAATGTTAAGG - Intergenic
1047927958 8:129699607-129699629 GATGTGACAGTGGAAGCAGAGGG + Intergenic
1048425811 8:134322444-134322466 GAGGTTACAGTGAGCTCTGATGG - Intergenic
1048742399 8:137575881-137575903 GATGTGACAGTGAGACTGGAGGG - Intergenic
1050883153 9:10729403-10729425 CATTTGCCAGTGAAACCTGAAGG - Intergenic
1051262505 9:15277985-15278007 TTTGTGACAGTGACATCTGGTGG - Intronic
1052179957 9:25513634-25513656 GAAGTGAAAGTGAAAACTGAAGG - Intergenic
1053585668 9:39455993-39456015 GATGGGACAGTGATAACTAAAGG + Intergenic
1053623503 9:39844547-39844569 GTTGTTACAGTTAAAGCTGAGGG - Intergenic
1053881366 9:42598681-42598703 GTTGTTACAGTTAAAGCTGAGGG + Intergenic
1054220397 9:62406152-62406174 GTTGTTACAGTTAAAGCTGAGGG + Intergenic
1054230318 9:62503020-62503042 GTTGTTACAGTTAAAGCTGAGGG - Intergenic
1054580643 9:66909232-66909254 GATGGGACAGTGATAACTAAAGG - Intronic
1054948006 9:70817336-70817358 GATGTGACAGTGGGCTCTCATGG + Intronic
1055242852 9:74205203-74205225 CATCTGACAGTGAAATGGGATGG - Intergenic
1055417893 9:76104013-76104035 GATCTGACAGTGTAATTTAAAGG - Intronic
1056285544 9:85083927-85083949 GGAGTGTCACTGAAATCTGATGG - Intergenic
1057029350 9:91762145-91762167 GATGTGACAATGGAAGCAGAGGG - Intronic
1058248407 9:102660078-102660100 GATTTAATAGTGAAATCTGGAGG - Intergenic
1058407539 9:104693289-104693311 GATGTGATGGAGAACTCTGAAGG - Intergenic
1058779895 9:108322764-108322786 GAAGTGACAGGGAAATTGGATGG - Intergenic
1186390217 X:9151234-9151256 TATGTGACAGGGGAATGTGATGG - Intronic
1190058758 X:47197598-47197620 GCTGTGGAAGTGAAATCTGGTGG - Intronic
1190141132 X:47846138-47846160 GATCTCACAGTGAAAGCTGCAGG + Exonic
1192840502 X:74850107-74850129 GATGAGACAGTGAAATCCCCAGG - Intronic
1195114844 X:101686979-101687001 GTTTTGGCAGTGAACTCTGAGGG + Intergenic
1196192271 X:112807304-112807326 GATGTGATAGTAAAATCTGGGGG - Intronic
1196583259 X:117399814-117399836 GATGTGAAAGTGAAAGCTTGTGG + Intergenic
1196630840 X:117937876-117937898 GATATGAGAGTGAAAGCTAAAGG - Intronic
1196855563 X:119980112-119980134 GATGTTACAGTGAATCATGATGG - Intergenic
1197633918 X:128892733-128892755 GAGGTGACAGTGAAGGCAGAAGG - Intergenic
1197997748 X:132397761-132397783 TGTGTGAAAGTGAAGTCTGATGG - Intronic
1199711735 X:150474332-150474354 GAGGTGACAGTGGAAACAGAAGG - Intronic
1200849949 Y:7872869-7872891 TATGTCACAGTGTAATATGAGGG + Intergenic