ID: 1007133213

View in Genome Browser
Species Human (GRCh38)
Location 6:39496217-39496239
Sequence TGATGTGACAGTGAAATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007133213_1007133214 3 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133214 6:39496243-39496265 TTCATTTGCCACATGACCACAGG 0: 1
1: 0
2: 2
3: 21
4: 125
1007133213_1007133222 27 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133222 6:39496267-39496289 CGGATGGATGTCAACAGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 78
1007133213_1007133217 11 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG No data
1007133213_1007133219 22 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133219 6:39496262-39496284 CAGGACGGATGGATGTCAACAGG No data
1007133213_1007133215 7 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133215 6:39496247-39496269 TTTGCCACATGACCACAGGACGG 0: 1
1: 0
2: 1
3: 29
4: 184
1007133213_1007133220 23 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133220 6:39496263-39496285 AGGACGGATGGATGTCAACAGGG 0: 1
1: 0
2: 1
3: 11
4: 135
1007133213_1007133221 24 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133221 6:39496264-39496286 GGACGGATGGATGTCAACAGGGG 0: 1
1: 0
2: 1
3: 24
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007133213 Original CRISPR TGATGTGACAGTGAAATCTG AGG (reversed) Intronic
903533997 1:24054483-24054505 TGATGTGACAGTGAGGTGTGAGG - Intergenic
903994134 1:27294743-27294765 TGATGTTACATTGAAATGTGGGG + Intronic
909367587 1:74845765-74845787 TGATGTGAGAGAGAATTCAGTGG - Intergenic
910271034 1:85394525-85394547 TCATGTGACAGGTAAATCTTTGG + Intronic
910524588 1:88163646-88163668 TGGTAAGCCAGTGAAATCTGTGG - Intergenic
912029940 1:105228020-105228042 TAATGTGAAAGGGAAATGTGAGG + Intergenic
912490394 1:110059615-110059637 TCATGTGGCAGGGAAAACTGAGG - Intronic
913271540 1:117098641-117098663 TCATGTGACAGAGAACTATGTGG - Intronic
913391922 1:118323388-118323410 TGATGCAACAGGGAAATTTGGGG + Intergenic
916252721 1:162754469-162754491 TGTGGTGGCAGTGAAAACTGTGG + Intronic
918188399 1:182148191-182148213 GGGAGTGACAGTGTAATCTGAGG + Intergenic
920699727 1:208208794-208208816 TGATGTGACAGGGAGAGCTCAGG + Intronic
923464835 1:234239162-234239184 AGATGTGACAGTGAAATCAAAGG + Intronic
923689322 1:236177202-236177224 TTATGTCACACTGGAATCTGAGG + Intronic
923778819 1:237003601-237003623 AGATGAGAAAGTGCAATCTGTGG - Intergenic
1063223259 10:3990956-3990978 TGATGTGTTGGTGAAAACTGGGG - Intergenic
1063494587 10:6495168-6495190 AGATGTGAAAGTGAAACCAGAGG - Intronic
1063651536 10:7942689-7942711 TGTGGTGACAGTGAAATCCAGGG + Intronic
1063981647 10:11457433-11457455 TGCTGTGGAAGTGAAATGTGAGG - Intronic
1064937225 10:20691623-20691645 TGATGTGACAGTCAAAGTTCTGG - Intergenic
1065620493 10:27576162-27576184 TGAGGTGACACTGAGATCAGAGG - Intergenic
1066265216 10:33770250-33770272 TAATATGACTGTGAAGTCTGTGG + Intergenic
1066336661 10:34484976-34484998 GGATATGACAGTGAAAGGTGAGG - Intronic
1067055701 10:43048623-43048645 TGAGGTCACAGTGAAATCAGTGG - Intergenic
1069335638 10:67346831-67346853 TGATGTGGCATTGATATCAGTGG - Intronic
1069627048 10:69874796-69874818 TGATGCAACAGTGAAGTCTAAGG + Intronic
1069800303 10:71077818-71077840 AGATGTGGCAATGAACTCTGAGG - Intergenic
1072194699 10:93107174-93107196 TGATGTGCAACTGAAACCTGTGG + Intergenic
1073135678 10:101218880-101218902 TCAAGTGACAGTGACATCTCTGG + Intergenic
1073421646 10:103428663-103428685 GGATGAGTCAGTGAACTCTGTGG + Intronic
1073611704 10:104950357-104950379 TGATGTGACCGTATAATCTAGGG + Intronic
1074500145 10:114016451-114016473 TTCAGTGACAGTGAGATCTGCGG - Intergenic
1075865913 10:125719313-125719335 AGATGTGACACTGAAGCCTGGGG + Intergenic
1076014061 10:127013701-127013723 TCAAGTCACAGTGAAAACTGAGG + Intronic
1080463580 11:32476508-32476530 TGATATGACTGTGAATTCTTGGG - Intergenic
1080996607 11:37609799-37609821 GAATGTGACAGTGAAAACTCTGG + Intergenic
1085941811 11:81214002-81214024 TGATGCGAAAGGGAAATGTGGGG - Intergenic
1086640364 11:89147255-89147277 TGATGTGAGTGTGAAAACTTGGG + Intergenic
1087157786 11:94921808-94921830 TGATGTGTCAATGGAAGCTGAGG - Intergenic
1088052363 11:105533105-105533127 AGAGGTGACTTTGAAATCTGCGG + Intergenic
1088858624 11:113779576-113779598 GGATGTGGGTGTGAAATCTGGGG - Intergenic
1089067700 11:115674437-115674459 CGATGTGTCAGGCAAATCTGGGG + Intergenic
1089114173 11:116080809-116080831 TGATGTGACATTCAGGTCTGAGG + Intergenic
1091070076 11:132554654-132554676 CAATGTGACAGTGAAAGCTCTGG - Intronic
1093072795 12:14724197-14724219 TGATCTCACAGTGAATTCTGAGG - Intergenic
1093791934 12:23261913-23261935 TTATGGAACAGTGAAATGTGCGG - Intergenic
1095596359 12:43963091-43963113 TGACGCAACATTGAAATCTGAGG - Intronic
1096088974 12:48885649-48885671 AGATGGCACAGTGAAAGCTGAGG + Intergenic
1099257494 12:80331893-80331915 TGATGTGACAATAGAATCAGAGG + Intronic
1099431050 12:82586449-82586471 TGATGTGACAATAAAATGTTAGG - Intergenic
1099931465 12:89080333-89080355 TGATGTGACTGTGACATATTTGG - Intergenic
1101384490 12:104244770-104244792 TGATGTTACAATGAAATCATTGG + Intronic
1101713533 12:107290364-107290386 TGAGGTTACAGTGAAATGAGTGG - Intergenic
1104646435 12:130501060-130501082 TGCTGTGACAGGGAAGCCTGGGG - Intronic
1104945151 12:132412355-132412377 TGAGGTGTCAGTGGGATCTGGGG + Intergenic
1104945160 12:132412391-132412413 TGAGGTGTCAGTGGGATCTGGGG + Intergenic
1104945242 12:132412644-132412666 TGAGGTGTCAGTGGGATCTGGGG + Intergenic
1108882511 13:55137803-55137825 TCATGTGATAATGAAATCTTTGG - Intergenic
1108997050 13:56747520-56747542 TGAAGTACCAGTGAAATCTCAGG + Intergenic
1109185518 13:59263228-59263250 TGAACTGACAATGTAATCTGAGG - Intergenic
1109843781 13:67956763-67956785 AGATGTGGCATTGAAATCAGAGG - Intergenic
1110534767 13:76638537-76638559 AGATGTAACAGTGCAGTCTGGGG - Intergenic
1112135191 13:96570426-96570448 TAATGCGACATTGAAATCTCAGG + Intronic
1114724123 14:24916398-24916420 TGATGTCACAGTGATGTCTCTGG - Intronic
1116936952 14:50750351-50750373 TGATGTTACATTGAGATCTGCGG - Intronic
1117616187 14:57536075-57536097 GGAAGTGACAGTGCAATCTAAGG - Intergenic
1117925817 14:60778173-60778195 TGAAATGACATTGAAATCTGGGG + Intronic
1118427441 14:65681998-65682020 AGATGTGACAGAGACATATGTGG + Intronic
1119626126 14:76177617-76177639 TGGTGTCACAGTGTAATCTTGGG + Intronic
1120814857 14:88845433-88845455 AGATGTGACATTGAAATGTAGGG + Intronic
1121337688 14:93087247-93087269 AGATGTGACAGTGGAAGCAGAGG - Intronic
1122083268 14:99281870-99281892 TTATGTACCAGTGAAATCTGGGG - Intergenic
1122318319 14:100838602-100838624 TGATGTGACAGGGTCCTCTGTGG - Intergenic
1123738982 15:23216637-23216659 TGAGGACACAGTGAAATCTTAGG + Intergenic
1124290202 15:28445607-28445629 TGAGGACACAGTGAAATCTTAGG + Intergenic
1124293036 15:28471961-28471983 TGAGGACACAGTGAAATCTTAGG - Intergenic
1125022483 15:34999017-34999039 TGATGTGACAGAGAATATTGAGG + Intergenic
1125439014 15:39681090-39681112 AGATATGCCAGTTAAATCTGGGG - Intronic
1125495722 15:40191508-40191530 AGATATGACAGTGAAAGCTCAGG - Intronic
1126157634 15:45580304-45580326 TGATGTGACAATGAAAGCAGGGG + Intergenic
1130191313 15:81738688-81738710 TCATGTGTCAGTGTTATCTGGGG + Intergenic
1130405625 15:83598320-83598342 TGCTGTGACAGTGAAGTCTAAGG - Intronic
1130925166 15:88380060-88380082 AGATATGGCAATGAAATCTGTGG - Intergenic
1135198402 16:20414370-20414392 AGATGTGACAATGAAAACAGAGG + Intronic
1139854173 16:69967651-69967673 TGATCTGAGAATGAATTCTGAGG - Intergenic
1139883154 16:70190565-70190587 TGATCTGAGAATGAATTCTGAGG - Intergenic
1140369354 16:74404955-74404977 TGATCTGAGAATGAATTCTGAGG + Intergenic
1141227172 16:82129011-82129033 TGATGAGGCAGAGAAAGCTGGGG + Intergenic
1141239610 16:82253377-82253399 CGTTCTGACAGTGAAATCTCAGG - Intergenic
1141726033 16:85789115-85789137 GCATGTGGCAGTGAGATCTGTGG - Intronic
1144236859 17:13270120-13270142 CGAAGTTACAGTGAAATCTTGGG + Intergenic
1144480031 17:15621559-15621581 TGATGTTACAGTTAAAAATGTGG + Intronic
1144918273 17:18742187-18742209 TGATGTTACAGTTAAAAATGTGG - Intergenic
1146662526 17:34674206-34674228 TGTTGTGCCAGTGCAAACTGGGG - Intergenic
1147922392 17:43925953-43925975 CAATGTCACAGTCAAATCTGTGG - Intergenic
1148584115 17:48765042-48765064 TGCTGTGACAATTAAAACTGGGG + Intronic
1149718029 17:58813038-58813060 TGATGTGGCAGTGAGAGATGAGG + Intronic
1150982413 17:70157299-70157321 TGCTGTGTCAGTGGCATCTGTGG + Intergenic
1155041730 18:22070516-22070538 ATACGTAACAGTGAAATCTGTGG + Intergenic
1155594481 18:27469249-27469271 TGCTGTGACTTTGAATTCTGTGG + Intergenic
1156785821 18:40913862-40913884 TGATGTGATAGTTAAATGGGTGG - Intergenic
1156791698 18:40983791-40983813 TGATGTGAAAATAAAATCTCAGG - Intergenic
1157567706 18:48690904-48690926 TGAGGTGCCAGTCAAATCTAAGG + Intronic
1158555994 18:58475192-58475214 GGATGTGGCAGTGAAAGATGAGG + Intergenic
1158964623 18:62611829-62611851 GGCTGTGACAGGGGAATCTGTGG + Intergenic
1160021499 18:75185233-75185255 TGATTTCACAGTGAAGTCAGTGG + Intergenic
1161912433 19:7204583-7204605 TGATTAGCCAGTGAAGTCTGAGG - Intronic
1162225234 19:9215588-9215610 TGATGTGACAGTTAACTCTCAGG + Intergenic
1162371840 19:10284455-10284477 CGAGGTGACAGTGAAGTGTGAGG + Exonic
1162543682 19:11314886-11314908 TTATGTGGCAGTGGAGTCTGGGG + Intronic
1165794068 19:38508551-38508573 TGATGAGAATGTGATATCTGAGG + Intronic
1168081379 19:54012691-54012713 TGATGTGATCGTGCATTCTGGGG + Intergenic
925302756 2:2828695-2828717 GGAGGTGGCATTGAAATCTGGGG - Intergenic
925880231 2:8346043-8346065 TGCTGTCAAAGTGGAATCTGGGG - Intergenic
925959472 2:9002643-9002665 TGTTGTGACAGTGAGATTTAGGG - Intronic
929793773 2:45042583-45042605 TCATGGGACAGTGAATTCTGGGG - Intergenic
934745984 2:96760320-96760342 TGATGTGGAAGGCAAATCTGGGG - Intergenic
935174906 2:100641218-100641240 CGATGTGTGAGTGAAGTCTGTGG - Intergenic
935528287 2:104199981-104200003 TGTTGTGACTGTGAAATGTGTGG - Intergenic
937966002 2:127511197-127511219 TAATGTGACAGTTAAGGCTGTGG + Intronic
938290395 2:130146049-130146071 TGATGTGGCAGTAAGATGTGGGG - Intergenic
938316834 2:130335503-130335525 TGATGTGGCAGTAAGATGTGGGG + Intergenic
938466143 2:131526918-131526940 TGATGTGGCAGTAAGATGTGGGG + Intergenic
942527211 2:176867144-176867166 TTATCTGACAAAGAAATCTGGGG + Intergenic
945501370 2:210579676-210579698 TGTAGTGACAGTGAAATTGGAGG - Intronic
946614162 2:221491601-221491623 TGAGGTGAAATTGAACTCTGGGG - Intronic
946879791 2:224165051-224165073 ATATGGGAGAGTGAAATCTGTGG - Intergenic
948647100 2:239412175-239412197 TGAGCTGACACTGAAATCAGAGG + Intergenic
1169662530 20:7996515-7996537 TGATTTCACAGTGACATATGAGG - Intronic
1170439455 20:16363821-16363843 TAATGTGCCACTGAAATTTGGGG + Intronic
1171231580 20:23491278-23491300 TGATGTGATCATGAAAACTGTGG - Exonic
1171453446 20:25252492-25252514 TGATGTGCAACTGACATCTGGGG - Intronic
1173835060 20:46119399-46119421 TCAGGTGAAAGTGAAAGCTGTGG - Intronic
1174545879 20:51324792-51324814 TGCTCTGAAAGGGAAATCTGGGG - Intergenic
1174661092 20:52213873-52213895 TGATGTGACAATGGAAACAGTGG - Intergenic
1175087879 20:56476213-56476235 TGAATAGACAGTAAAATCTGAGG - Intronic
1176452014 21:6871609-6871631 TTGTGTGGTAGTGAAATCTGGGG + Intergenic
1176830186 21:13736658-13736680 TTGTGTGGTAGTGAAATCTGGGG + Intergenic
1178206986 21:30479611-30479633 TTATGAGGCAGTGAGATCTGTGG - Intergenic
1178401827 21:32293134-32293156 TGATGTGATAATGAAAGCAGGGG + Intronic
1181868532 22:25879063-25879085 TGAAGAGACAGGGAAAACTGTGG + Intronic
1183309598 22:37102245-37102267 TGATGGGACAGAGGAAGCTGAGG - Intronic
1183709616 22:39495194-39495216 TGAGGTGACATTGACACCTGGGG - Intergenic
1184797212 22:46739182-46739204 GGATGTGACACTGAGGTCTGAGG + Intergenic
950493039 3:13317765-13317787 TGATGAGGCAGCGAAATCTAGGG + Exonic
950880375 3:16318058-16318080 TGGTGTGACAGGGAAGTCAGGGG + Intronic
950898089 3:16471944-16471966 TTATGTGTGAGTGAATTCTGAGG - Intronic
952392369 3:32891316-32891338 GGATGTGGCGGTGAATTCTGAGG + Exonic
953210530 3:40871150-40871172 TGATGTTCCAGTGAAATATGTGG + Intergenic
955519006 3:59756277-59756299 TAATGAGACACTCAAATCTGGGG + Intronic
956282360 3:67571027-67571049 TGCTGAGATAGTGACATCTGAGG - Intronic
957215692 3:77317500-77317522 TGATTTGAAAACGAAATCTGAGG - Intronic
959560607 3:107776030-107776052 TGATTTGACACTGAAATACGAGG - Intronic
960274428 3:115711737-115711759 TGAGCTGGCAGTGGAATCTGTGG - Intronic
961577147 3:127846834-127846856 TTATGTAACAGTGATATCAGGGG - Intergenic
962458023 3:135583116-135583138 TGATGTGACAGTGACAGCAGAGG - Intergenic
962599530 3:136980773-136980795 GGATTTGACAGTGAACTCTCTGG + Intronic
963438120 3:145298290-145298312 TGATGGAACAGTGAACTCTGAGG + Intergenic
963670126 3:148241196-148241218 TTGTGTCACAGTGGAATCTGAGG + Intergenic
963671632 3:148258620-148258642 TCATGTGGAAGAGAAATCTGGGG + Intergenic
963889820 3:150621417-150621439 TTAAGTTACAGTAAAATCTGAGG - Intronic
963920821 3:150902992-150903014 CAATTTGACAGTGAAATTTGAGG - Intronic
964068937 3:152608687-152608709 TCATGTGAAAGGGACATCTGTGG + Intergenic
966447804 3:180023154-180023176 TGATTTGACAAGGAAGTCTGGGG + Intronic
967108331 3:186271530-186271552 TGATGTGGGAGAGAAATCAGGGG - Intronic
967309925 3:188096175-188096197 TGTTGTGAAAGTGACTTCTGGGG + Intergenic
967672904 3:192260478-192260500 TGATTCTACAGTGAAATCTGAGG - Intronic
968006568 3:195247236-195247258 GGATTTCACTGTGAAATCTGAGG + Intronic
968252911 3:197238143-197238165 TGCTCTGACAGTGAAAGGTGGGG - Intronic
969099318 4:4756999-4757021 GGATGCTAGAGTGAAATCTGGGG - Intergenic
969424715 4:7117456-7117478 TGATGTAGAACTGAAATCTGGGG - Intergenic
970242008 4:14019348-14019370 TTATCTGAAAGTGAAGTCTGGGG - Intergenic
973589931 4:52430817-52430839 TGATGTTACACTGAAAACTTTGG + Intergenic
975903526 4:79181764-79181786 TGATTTTACATTAAAATCTGGGG + Intergenic
976162524 4:82218740-82218762 TGATGTGACATGGAAATCTTTGG - Intergenic
977142325 4:93388961-93388983 TGAAGTGATAGTGAAATATAAGG + Intronic
977382221 4:96290189-96290211 TGATGTTACACTGAAAGATGAGG + Intergenic
977433026 4:96956607-96956629 CAATCTGACAGTGAAAGCTGAGG - Intergenic
978506727 4:109465700-109465722 AGATGTGTCAGGGAAATATGGGG + Intronic
978768033 4:112424830-112424852 TGATGTGACAGAGAATGGTGAGG + Intronic
979881918 4:125970714-125970736 CAATGTGGCAGGGAAATCTGGGG - Intergenic
984352004 4:178607015-178607037 TCATATCACAGTTAAATCTGAGG + Intergenic
987060637 5:14240011-14240033 TGAAGAGACAGGGAAACCTGGGG - Intronic
988154571 5:27433657-27433679 TGATGTCACATTGAAAGATGGGG - Intergenic
989233949 5:39122347-39122369 TGATGAAACAGGGAAATCAGAGG + Exonic
992872476 5:81021007-81021029 TGCTGTGACAGCGTAATCTGTGG - Intronic
993597922 5:89882560-89882582 TGATGTTGCTGTGAAATGTGAGG - Intergenic
993956971 5:94246141-94246163 TGATGAGACAATAAAATATGAGG + Intronic
998893045 5:146767267-146767289 TGATGTGTCTGTGAATTCTTTGG - Intronic
1003393395 6:5732481-5732503 TGGTCTGACATTGAAAGCTGGGG - Intronic
1005471546 6:26166323-26166345 TGCTATGACAGTGGAATCTGAGG + Intronic
1007120897 6:39380303-39380325 AGATGTGACAGTCAGAGCTGGGG - Intronic
1007133213 6:39496217-39496239 TGATGTGACAGTGAAATCTGAGG - Intronic
1007949840 6:45861440-45861462 TGTTGTGAGGGTGAAATGTGAGG - Intergenic
1008333714 6:50274525-50274547 TGATGTCACAGTTAAAAGTGGGG + Intergenic
1008577343 6:52873873-52873895 TGTTATGTCAGTGAAATGTGTGG - Intronic
1010966139 6:82211538-82211560 TGACGTGACCATGAAATCAGTGG - Exonic
1012412149 6:98970743-98970765 TAATGTCAGTGTGAAATCTGTGG + Intergenic
1014255060 6:119152900-119152922 TGTTGTCACAGTGATGTCTGTGG + Intergenic
1014893561 6:126872016-126872038 TGATGTGCCAGTGGGTTCTGTGG - Intergenic
1018084963 6:160293427-160293449 TGATGTGACAAAAAAATGTGTGG - Intergenic
1018509687 6:164511845-164511867 TGCTGTGAAACTGGAATCTGAGG + Intergenic
1019094398 6:169567137-169567159 GGCTGTGACAGTGACACCTGGGG + Intronic
1019925577 7:4190168-4190190 TGATGAGACAGTGCAGCCTGTGG - Intronic
1020607758 7:10359944-10359966 GGCAGTGACAGTGGAATCTGGGG + Intergenic
1020713443 7:11637742-11637764 TGATGTGATACTTAAATCAGTGG + Intronic
1025605947 7:63039938-63039960 TGCTGTGAGAGTGAATTCTCAGG + Intergenic
1027768381 7:82375362-82375384 TGATGTGGCTGGGAAATCTATGG - Intronic
1031325154 7:120386708-120386730 TCATATAACAGTGAAATTTGTGG - Intronic
1034261821 7:149761613-149761635 TGAGGGGACAGAGAAAGCTGTGG - Intergenic
1034876568 7:154729825-154729847 TCATGTGACAATAAAATCTCAGG - Intronic
1035195445 7:157216182-157216204 AGATGTGACAGTGATATCTGGGG + Intronic
1036187713 8:6638739-6638761 TGAAGTGACATTGGAATTTGGGG + Intronic
1036263882 8:7259803-7259825 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036265178 8:7267425-7267447 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036266479 8:7275047-7275069 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036267785 8:7282669-7282691 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036269088 8:7290291-7290313 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036270382 8:7297913-7297935 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036297503 8:7549142-7549164 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036298807 8:7556789-7556811 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036300112 8:7564439-7564461 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036301416 8:7572084-7572106 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036302713 8:7579733-7579755 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036315922 8:7718342-7718364 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036317229 8:7725990-7726012 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036318537 8:7733638-7733660 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036319846 8:7741285-7741307 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036321153 8:7748933-7748955 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036322462 8:7756581-7756603 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036323770 8:7764229-7764251 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036325072 8:7771877-7771899 TCATGTGTCAGAGAAGTCTGAGG + Intergenic
1036350972 8:8012431-8012453 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036352270 8:8020077-8020099 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036353569 8:8027725-8027747 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036779005 8:11633033-11633055 TGCTGTGAGAGTGAATTCTCAGG - Intergenic
1036846256 8:12172850-12172872 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1036867621 8:12415169-12415191 TCATGTGTCAGAGAAGTCTGAGG - Intergenic
1037029793 8:14090974-14090996 GGATGTGACGGGGAAATCTATGG - Intronic
1038129574 8:24714972-24714994 TCATCTGACAGTAAAATCAGGGG - Intergenic
1038837779 8:31147558-31147580 AGATGTGACAGTGGAAGCTATGG - Intronic
1039187590 8:34934476-34934498 TGAGGTCACAATGAAATCTGGGG - Intergenic
1039759334 8:40557950-40557972 TGATGTGACAGAGAACACTGAGG + Intronic
1040375262 8:46818789-46818811 ATATGTCACAGTGATATCTGTGG - Intergenic
1040705442 8:50121000-50121022 TGATATGATAATGAAATATGGGG - Intronic
1041388736 8:57330469-57330491 TGATGTGACAATGAACACTCTGG + Intergenic
1041563391 8:59247091-59247113 TGATTTTAAAGAGAAATCTGAGG - Intergenic
1041962101 8:63629934-63629956 TCATGTGATATTGATATCTGTGG - Intergenic
1042583443 8:70308056-70308078 TGATTTGTCAGTGAAATTTTTGG - Intronic
1042972938 8:74430894-74430916 TTGTGTGGTAGTGAAATCTGGGG + Intronic
1043326330 8:79056343-79056365 TGATGGGGCAGTGCAATCTTGGG - Intergenic
1043584629 8:81754004-81754026 GGATGTGATAGTGGAACCTGGGG + Intronic
1043873584 8:85462329-85462351 TGATGTCACAGGGAATTCTTAGG - Intergenic
1044749040 8:95398828-95398850 TGATATGACTGAGAAATGTGGGG + Intergenic
1047927957 8:129699606-129699628 GGATGTGACAGTGGAAGCAGAGG + Intergenic
1048121703 8:131588686-131588708 TGCTGTGCCACTGACATCTGGGG + Intergenic
1055737620 9:79348798-79348820 TGGTGTGACAGAGAAAACTTAGG + Intergenic
1056927386 9:90846481-90846503 AGGTATGACAGTGAAGTCTGAGG - Intronic
1061410518 9:130418800-130418822 GGACATGACAGTGAGATCTGGGG + Exonic
1203517167 Un_GL000213v1:12906-12928 TTGTGTGGTAGTGAAATCTGGGG - Intergenic
1186414093 X:9368560-9368582 TAATATGAGAGTGAACTCTGTGG - Intergenic
1188292681 X:28408515-28408537 TGATGTGACATTAATATCTTAGG - Intergenic
1189246702 X:39568842-39568864 TGATGTGACAATGAAAGCAGAGG - Intergenic
1190022746 X:46894156-46894178 TGTAGTGACAGTTGAATCTGTGG - Intronic
1190647856 X:52539451-52539473 TCTAGTGACAGTGACATCTGTGG - Intergenic
1190678849 X:52806807-52806829 TCCAGTGACAGTGACATCTGTGG - Intergenic
1196192272 X:112807305-112807327 GGATGTGATAGTAAAATCTGGGG - Intronic
1196237944 X:113304761-113304783 TCCTGTGACAGTGATATGTGTGG + Intergenic
1197024343 X:121729396-121729418 TGATGGGATAGTGACAGCTGAGG + Intergenic
1201720538 Y:17091347-17091369 AGATGTTACATTGAATTCTGAGG + Intergenic