ID: 1007133217

View in Genome Browser
Species Human (GRCh38)
Location 6:39496251-39496273
Sequence CCACATGACCACAGGACGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007133213_1007133217 11 Left 1007133213 6:39496217-39496239 CCTCAGATTTCACTGTCACATCA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG No data
1007133211_1007133217 20 Left 1007133211 6:39496208-39496230 CCTAAAGTCCCTCAGATTTCACT 0: 1
1: 0
2: 2
3: 16
4: 228
Right 1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG No data
1007133212_1007133217 12 Left 1007133212 6:39496216-39496238 CCCTCAGATTTCACTGTCACATC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007133217 Original CRISPR CCACATGACCACAGGACGGA TGG Intronic
No off target data available for this crispr