ID: 1007142401

View in Genome Browser
Species Human (GRCh38)
Location 6:39588996-39589018
Sequence ATATTATGCTAAGTGTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 8, 3: 101, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007142401_1007142403 -7 Left 1007142401 6:39588996-39589018 CCCTAATACACTTAGCATAATAT 0: 1
1: 0
2: 8
3: 101
4: 463
Right 1007142403 6:39589012-39589034 ATAATATCCCAGCTCCTGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007142401 Original CRISPR ATATTATGCTAAGTGTATTA GGG (reversed) Intronic
900906662 1:5564257-5564279 AAATCATGATAAGGGTATTATGG - Intergenic
901288680 1:8104493-8104515 ACATTATGCTAAGTGAGATAAGG - Intergenic
902172350 1:14622349-14622371 ATATTATGTTTAGTGAAATAAGG + Intronic
905220461 1:36442833-36442855 ATATTATCCTCATTCTATTAAGG + Intronic
905639906 1:39581950-39581972 ATAAAATCCTAAGTGTTTTAAGG - Intergenic
906008724 1:42502810-42502832 ACATTATGCTAAGTGAAAGAAGG - Intronic
906780710 1:48570609-48570631 ATACTGTGCTAAGTGCTTTATGG - Intronic
907030319 1:51164582-51164604 ACATTATGCCAAGTGAAATAAGG + Intergenic
907502489 1:54891819-54891841 GTACTATGATAAGGGTATTATGG + Intergenic
907843427 1:58179125-58179147 ATATTATGTTAAATGATTTATGG + Intronic
908217484 1:61968997-61969019 AAATTATGCTATGTGAAATAAGG - Intronic
908586777 1:65578377-65578399 TAGTTATGCTAAGTCTATTATGG - Intronic
909162184 1:72166632-72166654 ACATTATGTTAAGTGAATTAAGG + Intronic
909287777 1:73842528-73842550 ACATTATGCTAAGTGAGATAAGG + Intergenic
910264628 1:85325436-85325458 CTTTTATGCTCATTGTATTAAGG - Intronic
910462500 1:87463521-87463543 ACACTATGCTAAGTGAAATAAGG + Intergenic
910747256 1:90587659-90587681 ACATTATGCTGAGTGAAATAAGG + Intergenic
910848819 1:91631035-91631057 ACATTATGCTAAGTGAAAGAAGG + Intergenic
910980288 1:92953613-92953635 ACATTATGTTAAGTGAAATAAGG + Intronic
911360935 1:96875026-96875048 ATATTATGCTGAGTGGAATAAGG + Intergenic
911388313 1:97205643-97205665 ATATTATGGAAATTGTACTATGG - Intronic
911879178 1:103212266-103212288 ATATTAAGCTAAGTGAAATAAGG + Intergenic
912662627 1:111546540-111546562 ACATTATGCTAAGTGAAATAAGG - Intronic
913562293 1:120033528-120033550 ACATTATGCTAAGTGAAATAAGG + Intronic
913562719 1:120038903-120038925 ATCTTAAGCCATGTGTATTATGG + Intronic
913635402 1:120754702-120754724 ATCTTAAGCCATGTGTATTATGG - Intergenic
913635831 1:120760073-120760095 ACATTATGCTAAGTGAAATAAGG - Intergenic
913707744 1:121444170-121444192 ATTTTCTGGTAAGTGTTTTATGG - Intergenic
914282879 1:146192919-146192941 ACATTATGCTAAGTGAAATAAGG + Intronic
914283317 1:146198283-146198305 ATCTTAAGCCATGTGTATTATGG + Intronic
914383094 1:147138202-147138224 TTATTATGCTGAGAGTTTTAAGG + Intergenic
914439609 1:147692772-147692794 ATATAATGCTATGTGAATAAAGG + Intergenic
914543909 1:148643637-148643659 ACATTATGCTAAGTGAAATAAGG + Intronic
914544347 1:148649003-148649025 ATCTTAAGCCATGTGTATTATGG + Intronic
914622285 1:149422007-149422029 ATCTTAAGCCATGTGTATTATGG - Intergenic
914622713 1:149427385-149427407 ACATTATGCTAAGTGAAATAAGG - Intergenic
915374753 1:155383675-155383697 ACATTATGCTAAGTGAATTAAGG + Intronic
915388002 1:155514015-155514037 ACATTATGCTAAGGGAAATAAGG + Intronic
915612631 1:157006799-157006821 ACATTACACTTAGTGTATTATGG - Intronic
916139549 1:161682592-161682614 TGATTAAGCTAAGTGAATTATGG - Intergenic
916146610 1:161745752-161745774 ACATTATGCTAAGTAAAATAAGG - Intergenic
916374368 1:164136135-164136157 ACATTATGCTAAGTGGAATAAGG + Intergenic
916397541 1:164407891-164407913 ACATTATGCTAAATGAAATAAGG - Intergenic
917393625 1:174567291-174567313 ACATTATGCTTAGTGAAATAAGG - Intronic
917823554 1:178792272-178792294 ATATTTTGTTAAGTTTTTTAAGG + Intronic
918552016 1:185754138-185754160 ACATTATGCTAAGTGAAATAAGG + Intronic
918613457 1:186517667-186517689 ATATAATGGGAAGTTTATTAAGG + Intergenic
918862329 1:189846638-189846660 ACTTTATGCTAACTGTATAAAGG + Intergenic
918967234 1:191367127-191367149 ACATTATGCTAAGTGAAGTAAGG + Intergenic
919119611 1:193322567-193322589 ATATTATGCTAAGTAAAATAAGG - Intergenic
919522309 1:198603207-198603229 ATATTATGCAAAGTTTTTAAAGG + Intergenic
919541682 1:198854371-198854393 ACATTATGCTAACTGAAATAAGG + Intergenic
919548662 1:198956700-198956722 ACATTATGCTAAGTAAAATAAGG + Intergenic
919649992 1:200138522-200138544 ATTTTTTTCCAAGTGTATTAAGG + Intronic
919652990 1:200168600-200168622 ATATTATTCTAAGGGACTTATGG + Intronic
920595657 1:207267229-207267251 ACATTATGCTAACTGAAATAAGG + Intergenic
922608950 1:226910108-226910130 GCATTATGCTAAGTGAAATAGGG - Intronic
923701332 1:236302948-236302970 ACATTATGCTAAGTTAAATAAGG + Intergenic
924394252 1:243601777-243601799 GTATTATGCTAAGTGAAAAATGG + Intronic
1064461858 10:15542602-15542624 ATATTTTGATCACTGTATTACGG - Intronic
1064889379 10:20152523-20152545 ATATTATTCTTATTGTATTTTGG - Intronic
1065273169 10:24057543-24057565 ACATTATGCTAAGTGAAATAAGG - Intronic
1065387208 10:25145583-25145605 ACATTATGTTAAGTGAAATAAGG - Intergenic
1066045375 10:31589925-31589947 ATGTTGTGCTAAGTGACTTAAGG - Intergenic
1066088566 10:31995403-31995425 ACACTATGCTAAGTGAAATAAGG + Intergenic
1066165448 10:32783863-32783885 ATATTATGGTAAGTGAAATAAGG + Intronic
1068102806 10:52577452-52577474 ATATTTGCCTAAGTGTATCAGGG + Intergenic
1068199260 10:53761779-53761801 ATATTTTCTTAAGGGTATTAGGG - Intergenic
1071207062 10:83293629-83293651 ATAATATGCTAAGTGAAAGAAGG + Intergenic
1072167270 10:92826178-92826200 ACATTATGCTAAGTGAAATAAGG - Intergenic
1072346666 10:94514537-94514559 ACATTATGCTAAGTGAAATAAGG - Intronic
1072401080 10:95101057-95101079 ACATTATGTTAAGTGAAATAAGG + Intergenic
1072870287 10:99112181-99112203 ATATTATTGTTACTGTATTAGGG - Intronic
1072976094 10:100059960-100059982 ACATTATGGTAAGTGAAATAAGG + Intronic
1073618908 10:105026699-105026721 CCATTATACTAAGTGAATTAAGG + Intronic
1073869465 10:107846489-107846511 ATATTTGGCTAAATGTATCAGGG + Intergenic
1074624660 10:115168102-115168124 AAATTATGCTAAGTGAAATATGG - Intronic
1076990356 11:270388-270410 ATTTTTTCCTAAGTGTTTTATGG + Intergenic
1077993946 11:7436991-7437013 ATATTATGCTAGGTGCTTTCAGG - Intronic
1078114065 11:8427268-8427290 GTAATATGTTAACTGTATTAAGG - Intronic
1078814781 11:14809447-14809469 ACATTATGCTAAGTTAAATAAGG + Intronic
1079220202 11:18553965-18553987 ATTTTATGTTATGTGTATTTGGG + Intronic
1079277051 11:19050506-19050528 ATATTATCCTAAGTGAAATAAGG + Intergenic
1079663803 11:23077370-23077392 ATATTCTGCTAAGTATGTGAAGG + Intergenic
1079668689 11:23138641-23138663 ATGTTATGCTGGTTGTATTATGG + Intergenic
1080051859 11:27866108-27866130 ATATAATGCTTACTGTGTTATGG + Intergenic
1080444548 11:32325965-32325987 ACAATATGCTAAGTGAAATAAGG + Intergenic
1080699209 11:34630254-34630276 ATATTATAATAAGTGTACTTGGG - Intronic
1081383620 11:42445527-42445549 ATAATGTGCTAAGAGTATTTAGG + Intergenic
1082298975 11:50481785-50481807 ATATTCTGCAAAGGGTATTTGGG - Intergenic
1085094655 11:73750281-73750303 ACGTTATGCTAAGTGAAATAAGG - Intronic
1085883376 11:80495062-80495084 ATCATATGCTGAGGGTATTAAGG - Intergenic
1086374754 11:86188813-86188835 ACATTATGCTAAGTGAAAGAAGG - Intergenic
1086822954 11:91458104-91458126 ATGTTAAGGTGAGTGTATTAAGG + Intergenic
1087051898 11:93894580-93894602 ACATTATGCTAAGTGAACTAAGG + Intergenic
1087503329 11:98988121-98988143 TTATTATGTTAAGTGAAATAAGG - Intergenic
1087813412 11:102632780-102632802 ACATTATGCTAAGTGAAATAAGG + Intergenic
1087871494 11:103299068-103299090 ATATTATACTATGTGTATTGAGG + Intronic
1088006082 11:104942236-104942258 ACATTATGCTATGTGAAATAAGG - Intergenic
1088210172 11:107445731-107445753 ATATTACTCTAAATGTATTTGGG - Intronic
1088565673 11:111170219-111170241 TTATTATGAGAAGTCTATTAAGG + Intergenic
1089340408 11:117753580-117753602 ATGTTATGCTCAGTGTTTGAAGG - Intronic
1090112294 11:123926547-123926569 TCATTATGCTATATGTATTATGG + Intergenic
1090218797 11:124996821-124996843 GCATTATGCTAAGTGAAATAAGG - Intronic
1091093477 11:132794219-132794241 GAAATATGCTCAGTGTATTATGG - Intronic
1092167433 12:6351266-6351288 ATATTATGCTAAGTGAAATAAGG + Intronic
1093291941 12:17336878-17336900 ATATTATGCTTAGTGAAAGAAGG - Intergenic
1093560776 12:20536657-20536679 ACATTATGCTAAGTGAAAGATGG - Intronic
1093755137 12:22843763-22843785 ACATTATGCTAAGTGAAATAAGG + Intergenic
1094552622 12:31467125-31467147 ATATTATCCTCAGAGTACTAAGG + Intronic
1094650819 12:32374290-32374312 ATATTATGCAATGTGATTTATGG - Intronic
1095671367 12:44864172-44864194 GTATTATGTTAATTGTTTTATGG - Intronic
1095724006 12:45432505-45432527 AAATTATATTCAGTGTATTAAGG + Intronic
1095927177 12:47590509-47590531 ACATTATGCTAAGCCTACTATGG - Intergenic
1096303308 12:50451334-50451356 ACATTATGCTAAGTGAAATAGGG - Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1096547629 12:52351640-52351662 ATATTGTGCTATGTGTACTGTGG + Intergenic
1097453193 12:59761978-59762000 TCATTATGCCAACTGTATTAAGG + Intronic
1097667608 12:62498201-62498223 ATATTATTCTAAGTGGAAGAAGG + Intronic
1097854195 12:64444524-64444546 ACATTATGCTAAATGAAATAAGG + Intronic
1098130009 12:67340557-67340579 ACATTATTCTAAGTGAAATAAGG - Intergenic
1098143110 12:67470799-67470821 GCACTATGCTAAGTGTAATATGG + Intergenic
1098475935 12:70902987-70903009 ACATTATGCTGAGTGAAATAAGG + Intronic
1098512353 12:71331688-71331710 ACATTATGTTAAGTGAAATAAGG + Intronic
1098557160 12:71832378-71832400 ATTTTTGGCTATGTGTATTAGGG + Intergenic
1099298053 12:80855580-80855602 ATATTATGATAAATACATTATGG - Intronic
1099427366 12:82539949-82539971 ACATTATGTTAAGTGAAATAAGG - Intergenic
1099601344 12:84742170-84742192 ATATTCTGTTAAGTATATTATGG - Intergenic
1100662309 12:96713404-96713426 ACATTATGTTAAGTGAAATAGGG + Intronic
1100857377 12:98769547-98769569 ATGTTTTTCTAAGTGTATCAGGG + Intronic
1101686667 12:107030725-107030747 TTATTATGAAAAGTGTATTATGG + Intronic
1101928785 12:108995367-108995389 ATATTATGCGGAGTGAAGTAAGG + Intronic
1102032487 12:109750204-109750226 ATACTATTCTAAGAGAATTAAGG - Intronic
1102242216 12:111331645-111331667 GTATAATGCTACGTGTCTTATGG + Intronic
1102334197 12:112063645-112063667 GTTTTATCCTAAGTGTATTGGGG + Intronic
1102598326 12:114010148-114010170 ATATTATGTCAATTGTATTAGGG - Intergenic
1103015502 12:117491502-117491524 ACATTATGCTAAGTGAAAAAAGG - Intronic
1107338114 13:39377395-39377417 ATACAATGATAAGTGTTTTATGG + Intronic
1108109810 13:47056905-47056927 ATATATTACTAAGTGTTTTAAGG + Intergenic
1108203579 13:48065614-48065636 ACATGATGCTAAGTGAAATAAGG - Intronic
1108509113 13:51138947-51138969 ACATTATGCTAAGAGAAATAAGG + Intergenic
1109191471 13:59328938-59328960 ATATTATGCTAAGTGAAAAAGGG + Intergenic
1109323659 13:60840234-60840256 ACATTATGCTAAATGAAATAAGG - Intergenic
1109632371 13:65066961-65066983 ATATTATGCTCACTATATTTTGG + Intergenic
1109745068 13:66613915-66613937 AAGTTTTGCTAAGTGTTTTAAGG + Intronic
1110003363 13:70233911-70233933 ACATTATGTTAAGTGAAATAAGG + Intergenic
1110767470 13:79297372-79297394 ATATTATGCTACTTGTTTTTAGG + Intergenic
1111499394 13:89095767-89095789 ACATTATGCTGAGTGAAATAAGG + Intergenic
1111676679 13:91397269-91397291 ATAATATTCTAAGTATTTTATGG - Intergenic
1112741111 13:102473498-102473520 AAATTATCCTAAGTGAAATAAGG + Intergenic
1113416641 13:110133423-110133445 ACATTATGTTAAGGATATTATGG + Intergenic
1114165464 14:20213719-20213741 ACATTATGCTAAGTGAAACAGGG - Intergenic
1114357692 14:21930551-21930573 ACATTACGCTAAGTGAAATAAGG - Intergenic
1115475017 14:33805228-33805250 AGACTATGCTGAGTGGATTATGG + Intergenic
1116785085 14:49279275-49279297 TCATTATGCTAAGTGAAATAAGG - Intergenic
1117329754 14:54700835-54700857 ACATTATGCTCAGTGAAGTAAGG + Intronic
1118676175 14:68187076-68187098 CCATTATCCTAAGTGAATTAAGG + Intronic
1119152951 14:72381050-72381072 ATATTATGCTAAGTGAAATAAGG + Intronic
1120135619 14:80865196-80865218 ACATTATGCTAAATGAAGTAAGG - Intronic
1120433712 14:84452803-84452825 ATATTATGCTAAATGTCCTCAGG + Intergenic
1120461769 14:84806067-84806089 ATATTATCCTATGTGTTTTAAGG + Intergenic
1120531380 14:85636212-85636234 ATATTATGCTACCTCTATAAAGG + Exonic
1120729140 14:87982204-87982226 ATATAATGCCAATTATATTAAGG - Exonic
1121821345 14:96969967-96969989 GGATTATGCTAAGTGAAATAAGG + Intergenic
1122456853 14:101860319-101860341 ACATTATGCTAAGTGAAGGAAGG - Intronic
1122892215 14:104737797-104737819 ACATTATGCTGAGTGAAATAAGG - Intronic
1123456825 15:20433787-20433809 ACATTATGCTAAGTCTTTTGCGG - Intergenic
1123661237 15:22566569-22566591 ACATTATGCTAAGTCTTTTGCGG + Intergenic
1124059930 15:26281881-26281903 ACATTATGCTAAGTAAAATAAGG - Intergenic
1124262974 15:28208940-28208962 ACATTATGCTAAGTCTTTTCGGG - Intronic
1124315037 15:28660805-28660827 ACATTATGCTAAGTCTTTTGCGG + Intergenic
1124427866 15:29577801-29577823 ACATTAGGCTAAGTGAAATAAGG + Intergenic
1124969472 15:34471923-34471945 ATATTATGCTAGGTGAAATAAGG - Intergenic
1125238629 15:37547631-37547653 CCATCATGCTAAGTGAATTAAGG + Intergenic
1126078557 15:44936672-44936694 ACATTATGCTAAGTGGAATAAGG - Intergenic
1126079291 15:44943653-44943675 ACATTATGCTAAGTGGAATAAGG + Intergenic
1126674191 15:51145205-51145227 TTATTATGATGTGTGTATTATGG + Intergenic
1126892359 15:53220066-53220088 ACATTATGCTAAGTGAAATGAGG - Intergenic
1127862772 15:63008216-63008238 GTATTATACTAAGTATATAAGGG - Intergenic
1128006526 15:64247282-64247304 ATGTTATGTTAATTGTATTATGG - Intronic
1128395363 15:67219534-67219556 CCATTATCCTAAGTGAATTAAGG + Intronic
1129915167 15:79263553-79263575 ATATTATGCTAAAAATTTTATGG + Intergenic
1131753941 15:95540149-95540171 ATATTAGGGAAAGTTTATTAAGG + Intergenic
1132061839 15:98698563-98698585 ACATTATGCTAAGTGAAATAAGG - Intronic
1132189817 15:99843514-99843536 ATATTATGCTAGGTGAAATAAGG + Intergenic
1133462055 16:5995503-5995525 TTATTATGCCAAGTGGAATAAGG + Intergenic
1133793040 16:9024195-9024217 ACTATATGCTAAGTGTATTAAGG + Intergenic
1134340314 16:13338850-13338872 ATATTTTCCTAAGTGTATTTGGG + Intergenic
1136385065 16:29919370-29919392 TTATTATGGTAACTGTATTAAGG + Intronic
1136649600 16:31657081-31657103 ACATTATGCTAAGTGAAATAAGG - Intergenic
1138613085 16:58142946-58142968 ACATTATGCTAAGTGAAAGAAGG - Intergenic
1138754212 16:59463327-59463349 TTATAATAGTAAGTGTATTATGG - Intergenic
1138891297 16:61147193-61147215 CAATTATCCTAAGTGAATTAAGG - Intergenic
1138954338 16:61952700-61952722 AAATTATGCAATGTTTATTAGGG + Intronic
1140036609 16:71376124-71376146 AGATTAAGGTAAGTGTGTTAGGG + Intronic
1140089627 16:71827040-71827062 CTATTATTCTAAGTGAAATATGG + Intergenic
1140278918 16:73536107-73536129 ATATTATGCTTAGTTGATTGGGG + Intergenic
1140836079 16:78795184-78795206 ATATTGTGCTAAGTGCTTTGCGG + Intronic
1141379187 16:83560393-83560415 ATGTTATGCTAAGTGAAATAAGG + Intronic
1143541122 17:7569873-7569895 GTCTTGTTCTAAGTGTATTATGG + Intronic
1143824889 17:9597179-9597201 ACATTATGTTAAGTGAAATAAGG - Intronic
1144183481 17:12774228-12774250 CCATTATCCTAAGTGAATTAAGG + Intergenic
1145983617 17:29029417-29029439 ATATTATGTTAAGTGAAACAGGG - Intronic
1146045931 17:29506331-29506353 GGATTATGCTAAGTGAAATAAGG + Intronic
1146106688 17:30045018-30045040 ATACTATGCTAAGTGAAAGAAGG + Intronic
1146302748 17:31703031-31703053 ACCTTATGCTAAGTGAAATAAGG - Intergenic
1147517655 17:41136631-41136653 ATACTATGTTAAGTGAAATAAGG - Intergenic
1148427293 17:47610317-47610339 ATACTATGCTAAGTGAAAGAAGG - Intronic
1148949533 17:51298435-51298457 ATATTATGATAAGAGAACTATGG - Intergenic
1149536104 17:57434676-57434698 ACATTATCCTAAGTGAAATAAGG - Intronic
1150359858 17:64522252-64522274 ATGTTATGTTATGTGAATTATGG - Intronic
1152979349 18:260836-260858 ATATAATGCTAAGTGAAAAAAGG + Intronic
1153047240 18:867703-867725 CTATTATGCTAAGTGAAATAAGG - Intergenic
1154408603 18:14121053-14121075 ACATTATGCTAAATGAAATAAGG + Intronic
1155572337 18:27209695-27209717 ATACTATGAGAAGTGTACTAAGG - Intergenic
1156299398 18:35822690-35822712 ATATTAAGCTCCCTGTATTAAGG + Intergenic
1157903811 18:51547480-51547502 ACATTAGGTTAAGTGAATTAAGG - Intergenic
1157956737 18:52106956-52106978 ATTTATTGCAAAGTGTATTAGGG + Intergenic
1158041500 18:53100267-53100289 ATTTCATGCTAAGGGTATAAGGG - Intronic
1159217294 18:65410080-65410102 ATATTGTTCTCAGTGTATCAGGG + Intergenic
1162162533 19:8729354-8729376 CCATTATCCTAAGTGAATTAAGG - Intergenic
1164125913 19:22317273-22317295 AAATTATCCTATGTGTATTAAGG - Intergenic
1164174328 19:22756141-22756163 AAATTATCTTATGTGTATTAAGG + Intergenic
1165661323 19:37582949-37582971 ATTTTATTCTAAGTGTGATAGGG - Intronic
1166272374 19:41722610-41722632 ACATTATGCTAAGTGAAATAGGG - Intronic
1166534920 19:43567043-43567065 ACATTATGCAAAGTGTAACAAGG + Intronic
1167812841 19:51849931-51849953 TTATTATGCTAAGTGTAAAAAGG + Intergenic
1168499675 19:56883020-56883042 ACATTATGCTAAGTGAAATAAGG - Intergenic
927412898 2:22846790-22846812 ATATGAAGCCAAGTGTATTTGGG - Intergenic
927581964 2:24259092-24259114 AGTTTAAGCTATGTGTATTAGGG - Intronic
927613403 2:24565328-24565350 AAAGTATGCTAAGTATTTTAGGG + Intronic
927801893 2:26108110-26108132 GTAATATGGTAAGTGTATAACGG - Intronic
928548022 2:32346178-32346200 ATATTAGGCTAAATGAAGTAAGG - Intergenic
928972761 2:37048770-37048792 ATACTATCCTTAGTGCATTAGGG + Intronic
929404700 2:41628390-41628412 AAATTATTCTATATGTATTAAGG - Intergenic
930314677 2:49783358-49783380 ACATTAAAATAAGTGTATTAAGG + Intergenic
930781408 2:55227777-55227799 ATTTTATCCTAAGGGTAATACGG - Intronic
931134782 2:59385853-59385875 ATAGTCTGCTAGGTATATTAAGG - Intergenic
931513670 2:63027682-63027704 ACATTATGTTAAGTGAAATAGGG + Intronic
935369710 2:102332524-102332546 AGATTATGCTAAGTGAAATAAGG + Intronic
936684619 2:114813084-114813106 TTATTATGATAAATGTAGTAGGG - Intronic
937440442 2:121910815-121910837 ATGTTATGCTAAGTGTTGGATGG - Intergenic
938214202 2:129494839-129494861 ATATTATGCTAAGTAAAATAAGG - Intergenic
939463734 2:142531039-142531061 ACATAATGTTAAGTGTATAATGG - Intergenic
939485255 2:142803295-142803317 GCATTATGCTAAGTGTAAAAGGG - Intergenic
939895542 2:147786705-147786727 ATTTTATTCTAAGTCTATTGGGG - Intergenic
941534863 2:166709453-166709475 ACATTTTGCTAAGTGAAATAAGG - Intergenic
941699456 2:168588529-168588551 ACATTATGCTAAGTGAAATAAGG - Intronic
942020133 2:171859558-171859580 ACATTATGCTAAATGAAATAAGG + Intronic
942320821 2:174734178-174734200 ATATTATCCTAAGTGAAAAAAGG - Intergenic
942500699 2:176587650-176587672 ATGCTGTGCTAAGTGTTTTAAGG - Intergenic
942532854 2:176931332-176931354 ATATTATGCTAAGTGAAAAAAGG + Intergenic
942756999 2:179352948-179352970 ATCATATGCTAAGTGAAATAAGG - Intergenic
943256312 2:185597958-185597980 ACCTTATGCTAAGTGAAATAAGG + Intergenic
943924432 2:193754175-193754197 ACATTATGTTAAGTGAAATAAGG - Intergenic
944787808 2:203091254-203091276 ACACTATGCTAAGTGAAATAAGG - Intronic
944792769 2:203149842-203149864 ACATTATGCTAAGTGAAAGATGG - Intronic
945737633 2:213620032-213620054 ACATTATGCTAAGTAAAGTAAGG + Intronic
945824116 2:214699312-214699334 ATATGATGCCAGGTGTATTTTGG + Intergenic
946442946 2:219712318-219712340 ATATTGTACTATGTGTACTATGG + Intergenic
947454662 2:230242995-230243017 ATTTAATCCTTAGTGTATTAAGG - Intronic
947559705 2:231137808-231137830 CCATTATCCTAAGTGAATTAAGG - Intronic
1168950249 20:1793716-1793738 TTATTATGTTAAGTGAAATAAGG + Intergenic
1168986928 20:2057107-2057129 ATATTAAGTTAACTGTAGTAAGG - Intergenic
1169396359 20:5233888-5233910 ACATTATGCTAAGTGAAAGAAGG + Intergenic
1169535607 20:6536148-6536170 TTTTTTTGCTAAGTGTTTTATGG + Intergenic
1170063262 20:12282840-12282862 ACATTATGTTAAGTGAAGTAAGG + Intergenic
1170410662 20:16087543-16087565 ATATTATGTTAAGTGAAATAAGG + Intergenic
1170650224 20:18232745-18232767 ACATTATGCTAACTGAAATAAGG - Intergenic
1170805901 20:19631374-19631396 ATATTTTGCGAAGTGTTGTAAGG + Intronic
1171154965 20:22863513-22863535 ATCTTATGCTATCTGAATTAGGG + Intergenic
1171350465 20:24498620-24498642 ACATTATGCTAAGTGGAACACGG - Intronic
1172831097 20:37835369-37835391 ATCTTTTCCTATGTGTATTAGGG - Intronic
1172878748 20:38183341-38183363 ACATTATGCTAAGTGAAAGAAGG - Intergenic
1172989189 20:39020006-39020028 ACATTATGCCAAGTGAAATAAGG - Intronic
1173639847 20:44593477-44593499 ACATTGTGCTAAGTGAAATAGGG + Intronic
1174525425 20:51166708-51166730 ACATTATGCTAAGTAAAATAAGG - Intergenic
1176961552 21:15164543-15164565 ACATTATGCTAAGTGAAATAAGG - Intergenic
1177531866 21:22371070-22371092 CCATTATGCTAAGTGAAATAAGG - Intergenic
1177865906 21:26513206-26513228 AGAATATGGTAAGTGTGTTAGGG - Intronic
1178674279 21:34617484-34617506 ACATTATGCTAAGTGGAAGAAGG + Intergenic
1179184852 21:39077495-39077517 ATATTATGCTAAGTCGAAGAAGG - Intergenic
1179477335 21:41655838-41655860 ACATTATGCTATGTGAAATAAGG - Intergenic
1181963502 22:26640165-26640187 ACATTATGCTAAGTGAAATAAGG - Intergenic
1185011745 22:48318467-48318489 ACATTGTGCTAAGTGGAATAAGG - Intergenic
949263101 3:2125234-2125256 ACAGTATGCTAAGTGAAATAAGG - Intronic
949489531 3:4575205-4575227 AGATTAAGCAAAGCGTATTATGG + Intronic
949535269 3:4990619-4990641 ACATTATGCTAAGTGAAAGAAGG + Intergenic
949801416 3:7908304-7908326 ACACTATGCTAAGTGATTTAGGG + Intergenic
950890114 3:16397219-16397241 ACATTATGCTAAGTGAAATAAGG + Intronic
951148733 3:19261708-19261730 ATTTTCTGCTAAGTGTTTTATGG + Intronic
951210214 3:19966306-19966328 ACATTATGCTAAATGAAATAAGG - Intronic
951357967 3:21691999-21692021 ACATTATGCTAAGTGGAGTAAGG - Intronic
951800754 3:26593339-26593361 ACATTATGCTAAGTGAAATAAGG - Intergenic
952558687 3:34563519-34563541 CCATTATCCTAAGTGAATTAAGG + Intergenic
954078207 3:48196520-48196542 ATATTAAGCAAAGTGCAGTATGG + Intergenic
954778242 3:53039332-53039354 ACATTATGTTAAGTGAATTAAGG + Intronic
955691009 3:61590767-61590789 AGACTATGCTAAATGTATTAGGG - Intronic
955909339 3:63844070-63844092 ACATTATGCTAGGTGAAATAAGG + Intronic
956586854 3:70874526-70874548 ATTTTATGCTAAGTATCTCAAGG + Intergenic
957035852 3:75292213-75292235 ATTTTATGTTATGTGTATTTTGG + Intergenic
957264584 3:77946221-77946243 ATATTATGCATTTTGTATTAAGG - Intergenic
957703752 3:83753128-83753150 ACATTCTGCTAAGTGAAGTATGG - Intergenic
958676203 3:97272202-97272224 ACATTATGCTAAATGAAGTAAGG - Intronic
959047821 3:101494058-101494080 ATAATTTGCTAACTGTTTTAAGG + Intronic
959155385 3:102660549-102660571 ATATTATGCTTACTGTCTTGGGG + Intergenic
959629079 3:108488239-108488261 ACATTATGCTAAATGAAATAAGG - Intronic
960319659 3:116219222-116219244 ATATTATGCTAAGTGAAATAAGG - Intronic
961232743 3:125333450-125333472 AGATGATGCTAAATGAATTAGGG - Intronic
962161585 3:133006191-133006213 ATATTATGTTAAGTGAAATAAGG - Intergenic
962194545 3:133350144-133350166 ACATTATGTTAAGTGAAATAAGG + Intronic
963828030 3:149976369-149976391 ACATTTTGCTAGTTGTATTATGG + Intronic
963859397 3:150292707-150292729 ATATTATGCAACAGGTATTATGG + Intergenic
964366349 3:155954536-155954558 CCATTATCCTAAGTGAATTAAGG - Intergenic
964512989 3:157474087-157474109 ATTTTATGCTAAGTCCATAAAGG + Intronic
964707163 3:159631543-159631565 ATATTATGCTAAGTGAAATAAGG + Intronic
964967628 3:162516692-162516714 ATTTTATGCTAGTTGTATTCAGG - Intergenic
965083172 3:164062407-164062429 ACCTTATGCTAAGTGAAATAAGG + Intergenic
966176303 3:177141917-177141939 ACGTTATGCTAAGTATATTAAGG + Intronic
966846137 3:184131429-184131451 ACATTATGCTAAGTGAAATAAGG + Intergenic
966972614 3:185059397-185059419 ACATTATGTTAAGTGAAATAAGG + Intergenic
967032197 3:185618349-185618371 AGCTTTTGCTAAATGTATTAAGG - Intronic
967254839 3:187579787-187579809 ATATTATGTTAACTTTTTTATGG + Intergenic
967461341 3:189750190-189750212 TCATTATGCTAAGTGAAATAAGG + Intronic
967548509 3:190761538-190761560 ACATTATGCTAAGTGAAATAAGG - Intergenic
967613231 3:191533223-191533245 AAATTATGCAATCTGTATTAGGG - Intergenic
968677905 4:1895054-1895076 AAACTATGCTAAGTGAAATAAGG - Intronic
970016029 4:11513642-11513664 ATATTATCCTAAGTCAATGATGG - Intergenic
970540758 4:17076701-17076723 ATATTATGCTAAGTTCAAAAAGG + Intergenic
971124830 4:23742082-23742104 ATATTATTCTAAGTTTATTGAGG + Intergenic
971975970 4:33687501-33687523 ATATAATCCTTAGTGTATAAGGG + Intergenic
972751476 4:41993808-41993830 ATATTATGATACCTTTATTATGG + Intronic
974080520 4:57207685-57207707 ATATTATGGTGTGTGTATAAGGG + Intergenic
974261268 4:59527632-59527654 ATATTATGCTTATTTAATTATGG - Intergenic
974744144 4:66048072-66048094 ATATTATGGTAAGTGAAATGAGG + Intergenic
974784115 4:66595544-66595566 ATATTTTGCAATGAGTATTAAGG - Intergenic
975681304 4:76879191-76879213 GTAATATACTGAGTGTATTAGGG - Intergenic
976132321 4:81897678-81897700 CGATTATCCTAAGTGAATTAAGG - Intronic
976459718 4:85295757-85295779 ATGTTATGCTAAGTGAAATAAGG + Intergenic
976726419 4:88220097-88220119 ACATTATGCTAAGAGAAATAAGG - Intronic
977363755 4:96040104-96040126 ATCTGATGCTAATTATATTATGG + Intergenic
977943597 4:102884277-102884299 AGGTTATGCTAAGAGTATAAGGG - Intronic
978177660 4:105753637-105753659 ATATTATGCCATTTGTATCAGGG + Intronic
978364407 4:107965955-107965977 ATATTATGCTAAATGAAATAAGG + Intergenic
978462407 4:108970821-108970843 ACATTATGTTAAGTGAAATAAGG - Intronic
978651719 4:111013725-111013747 ATATTATGCTAAGTGAAAAGAGG + Intergenic
978935870 4:114374764-114374786 ACATTATGTTAAGTGAAATAAGG - Intergenic
979069527 4:116184626-116184648 ATATTATGGAAAGGATATTAGGG + Intergenic
979915323 4:126425077-126425099 ACATTATGCTAAGTGAAATAAGG + Intergenic
979916136 4:126436548-126436570 ATACTATGCTAAGTGAAATAAGG - Intergenic
980297483 4:130941193-130941215 ACATTATGCTAAGTGAAATAAGG + Intergenic
980707243 4:136515114-136515136 CTATTATTTTAAATGTATTATGG + Intergenic
981202680 4:141999629-141999651 TTATTCTGATAAGTGTATAATGG + Intergenic
981289499 4:143057546-143057568 ATTCTATCCTAAGTGTATTATGG - Intergenic
981636127 4:146881855-146881877 ATTTTCTTCTCAGTGTATTAGGG - Intronic
981959878 4:150523691-150523713 AGAGTATGCGAAGTGAATTATGG - Intronic
982154263 4:152500255-152500277 ATATTATGCTATGAGTTTTTAGG + Intronic
982282213 4:153694944-153694966 ATATTATGTTAAGTGAAATAAGG - Intergenic
982985809 4:162203925-162203947 ATATTAGGCTAAGTGAGATAAGG - Intergenic
983932853 4:173472355-173472377 TTCTTTTGCCAAGTGTATTAGGG + Intergenic
984125854 4:175809319-175809341 AGATGATGCTAGGTTTATTATGG + Intronic
984604018 4:181763369-181763391 AAATTATGTTAATTGTTTTAGGG - Intergenic
984970084 4:185180527-185180549 ACATTATGCTAAGTGAAATAAGG - Intronic
985391252 4:189492644-189492666 ACATTAGGCTAAGTGAAGTAAGG - Intergenic
985999230 5:3617132-3617154 ATATGATGCCAAGTGGCTTAAGG + Intergenic
986158479 5:5200509-5200531 ATATTTTGGTAAGTGTCTTATGG - Intronic
986223497 5:5791708-5791730 ATATTATGCTAAGTGAACTAAGG + Intergenic
986382929 5:7204890-7204912 ATATTAAGGGAAGTTTATTAAGG + Intergenic
986408394 5:7449908-7449930 ATATTATTTTAAGTGTTTTGGGG + Intronic
987900709 5:24007740-24007762 CCATTATCCTAAGTGAATTAAGG - Intronic
988099828 5:26661602-26661624 ATATTATGGAAAGTGTATTATGG - Intergenic
989417153 5:41192740-41192762 ACATTATGCTAAGTGCAAAAAGG + Intronic
990024574 5:51169717-51169739 ATATTATGCCCAGTATATTCTGG - Intergenic
990236218 5:53771289-53771311 ACATTATGCTACCTGGATTAGGG - Intergenic
991219205 5:64193006-64193028 ACATTATGCTAAGTGAAATAAGG + Intronic
991219954 5:64202019-64202041 TTTTTATGCTAAGAGTATTTTGG + Intronic
991537677 5:67690704-67690726 ACATTATGCTAAGTGAAAAAAGG + Intergenic
991946705 5:71904895-71904917 ATCCTCTGCTAACTGTATTATGG - Intergenic
992948126 5:81829607-81829629 ACACTATGCTAAGTGAAATAAGG + Intergenic
993159206 5:84266917-84266939 AAATTATACTAAGTGTTTTATGG + Intronic
993347557 5:86803691-86803713 ATATTATGCCAAGTCCCTTATGG + Intergenic
993856293 5:93080019-93080041 ACATTATGCTAAGTGAAATAAGG - Intergenic
993977456 5:94499626-94499648 ATATTATGCTAAGATTAATGGGG - Intronic
994013997 5:94943694-94943716 AAATTCTGATAAGTGTTTTAAGG + Intronic
994920927 5:106042124-106042146 ACATTATGCTAAGTGAAAGAAGG + Intergenic
995544738 5:113218481-113218503 ATAATCAGTTAAGTGTATTAGGG + Intronic
995595899 5:113747274-113747296 ATATTATGTGAAGAGCATTATGG + Intergenic
996243314 5:121228723-121228745 CCATTATCCTAAGTGAATTAAGG + Intergenic
996248847 5:121301665-121301687 ATTTTATGATATGTCTATTAAGG - Intergenic
996264189 5:121515162-121515184 ACGTTATGCTAAGTGAAATAAGG - Intergenic
996610969 5:125380085-125380107 ATATTATACTAAGTGAAAGAAGG + Intergenic
996713079 5:126562859-126562881 ACATTATGTTAAGTGAAATAAGG + Intronic
997010703 5:129874111-129874133 ATATTTTGATAAGCTTATTAAGG + Intergenic
997169833 5:131705966-131705988 ACATTATGCTAAATGAAATAAGG + Intronic
998764510 5:145470664-145470686 ATATCATGCTAAGTGATTTAGGG - Intergenic
998793347 5:145790365-145790387 ACATTATGTTAAGTGAAATAAGG + Intronic
998913222 5:146984356-146984378 ACATTATGCTAAGTCAAATAAGG - Intronic
999852491 5:155557768-155557790 ACATTATGCCAAGTGAAATAAGG - Intergenic
1000259163 5:159569362-159569384 ATTTTATTCTAAGTGTAATGAGG + Intergenic
1000448320 5:161352426-161352448 ACATTATGTTAAGTGAAATAAGG + Intronic
1001551738 5:172607725-172607747 ATGTTATGATAAGTCTATAAAGG + Intergenic
1001618116 5:173058204-173058226 ATTTTAATCTAATTGTATTATGG + Intronic
1001841364 5:174879534-174879556 ATTTTATGCTTATAGTATTATGG + Intergenic
1001974152 5:175983089-175983111 ACATTATGTTAAGTGAAATAAGG + Intronic
1002243282 5:177860690-177860712 ACATTATGTTAAGTGAAATAAGG - Intergenic
1002864989 6:1113883-1113905 ACATTATGCTAAGTGAAATAGGG + Intergenic
1003066157 6:2904698-2904720 ACATTATGCTAAGTGAAAGAAGG - Intergenic
1003924835 6:10867972-10867994 ATATTAGCCTAAGTGTATAGTGG + Intronic
1003998950 6:11575235-11575257 ATAAGTGGCTAAGTGTATTATGG + Intronic
1004928746 6:20441276-20441298 ACATTGTGCTAAGTGAAATAAGG - Intronic
1005830244 6:29664949-29664971 ATATTTTGATAACTGTATTTTGG - Intronic
1007142401 6:39588996-39589018 ATATTATGCTAAGTGTATTAGGG - Intronic
1007466379 6:42054579-42054601 ACATTATGCTAAGTGAAATAAGG - Intronic
1007806582 6:44454595-44454617 ACATTATGCTAAGTGAAATAAGG + Intergenic
1008387892 6:50915397-50915419 ACATTGTGCTAAGTGAAATAAGG - Intergenic
1009052852 6:58298940-58298962 ATAAAATGTTAAGTGTATAATGG - Intergenic
1009238259 6:61151646-61151668 ATAAAATGTTAAGTGTATAATGG + Intergenic
1009288804 6:61857933-61857955 ATATTATAATACGTCTATTATGG + Intronic
1009321034 6:62288216-62288238 ATTTTATTCTAAGTGTAATAGGG + Intergenic
1009381598 6:63037461-63037483 TCATTATGCTAAGTGAAATAAGG + Intergenic
1009662310 6:66630749-66630771 GTCTTAAGCTAAGTATATTAAGG - Intergenic
1010008139 6:71018383-71018405 ATATCATGCTATCTGGATTATGG + Intergenic
1010699184 6:79021597-79021619 TTATTATGCTAAGTGAAATAAGG + Intronic
1011125729 6:84005573-84005595 ACATTATGTTAAGTGAAATAAGG - Intergenic
1011278711 6:85655320-85655342 AAATTATTCTAAGTATATTTTGG + Intergenic
1011873241 6:91923725-91923747 ATATTATGTTAAGTGACATAGGG + Intergenic
1012128696 6:95463445-95463467 ACATTGTGCTAAGTGAAATAAGG - Intergenic
1012308038 6:97683915-97683937 ATATCATGGTAAGTGAACTAAGG - Intergenic
1012657658 6:101845432-101845454 ATATTATGCTAAGTGAAAGCAGG - Intronic
1012696684 6:102392500-102392522 ATATGATTCTTGGTGTATTAAGG - Intergenic
1012750174 6:103151760-103151782 ACATTATGTTAAGTGAAATAAGG + Intergenic
1013151371 6:107449590-107449612 ACATTATGCTGAGTGAAATATGG - Intronic
1013644994 6:112128306-112128328 ACATTATGTTAAGTGAAATAAGG + Intronic
1013900527 6:115150803-115150825 CTATTATTCTAAGTGAAGTAAGG - Intergenic
1014792225 6:125686157-125686179 ATATTATGCTAAAAATTTTATGG - Intergenic
1015005405 6:128274392-128274414 GTGTTTTGCTAAGTCTATTATGG + Intronic
1015581966 6:134735054-134735076 ATATGATGCTAAGCATATTCTGG + Intergenic
1016414397 6:143817723-143817745 ATATTATGTTATGTGAAATAAGG + Intronic
1017186232 6:151603556-151603578 ATATCATGCTAGGTGCTTTATGG + Intronic
1018241885 6:161784978-161785000 ACACTATGCTAAGTGAAATAAGG + Intronic
1019889610 7:3936107-3936129 ATGTTATGGTAAGTGAATTAAGG + Intronic
1020577224 7:9948379-9948401 ACATTATGTTAAGTGAAATAAGG + Intergenic
1021156980 7:17222077-17222099 ATATTACGCTAAGTGAAAGAAGG + Intergenic
1021279134 7:18695254-18695276 ATATTATGTTATGTCTATTCAGG + Intronic
1021292546 7:18864249-18864271 ACATTATGCTGAGTGAAATAAGG + Intronic
1021398909 7:20186461-20186483 ATATTATGCTACATTTTTTATGG - Intronic
1021529346 7:21626232-21626254 ACATTATGTTAAGTGAAATAAGG - Intronic
1022606190 7:31816473-31816495 GTATTATGCTGAGTGTTTTTTGG + Intronic
1023409493 7:39875278-39875300 ACATTATGTTAAGTGAAATAAGG - Intergenic
1023449534 7:40268370-40268392 ATATTATGCTAAGTGAGAGAAGG - Intronic
1023712832 7:43013134-43013156 ATATTATGGCAAATGGATTAAGG - Intergenic
1024316621 7:48025276-48025298 ACATTATGCTAAGTGAAAGAAGG + Intronic
1025043438 7:55668743-55668765 ACATTATGTTAAGTGAAATAAGG + Intergenic
1025136358 7:56417257-56417279 ACATTATGTTAAGTGAAATAAGG + Intergenic
1025717275 7:63972013-63972035 ACATTATGCTAAATTTAATAAGG + Intergenic
1025887253 7:65608325-65608347 AAATTATGCTAAGGATATTTAGG + Intergenic
1026395191 7:69945376-69945398 ACATTATGCTAAGTGAATGAAGG - Intronic
1026514297 7:71054585-71054607 ACATTATGTTAAGTGAAATAAGG + Intergenic
1027848582 7:83419167-83419189 TCATTATCCTAAGTGAATTAAGG - Intronic
1028021760 7:85785404-85785426 ACATTTTGATAAGTGTGTTAAGG - Intergenic
1028105649 7:86875116-86875138 ACATTATGTTAAGTGAAATAAGG + Intergenic
1028795518 7:94897399-94897421 ACATTATGCTAAGTGAAATAAGG - Intergenic
1028956153 7:96694062-96694084 ACATTATGCTAAGTGAAAAAAGG + Intronic
1029380105 7:100208321-100208343 ATACTATGTTCAGTGTTTTAGGG + Intronic
1030184602 7:106749246-106749268 ACATTATGCTAAATGAAATAAGG + Intergenic
1031438358 7:121761215-121761237 ATTTTCTTCTAAGTATATTATGG - Intergenic
1031819148 7:126477111-126477133 ACATTACGCTAAGTGAAGTAAGG + Intronic
1034595199 7:152183187-152183209 AGATTATGTTAAATGTTTTAAGG + Intronic
1037100312 8:15035457-15035479 ATATTTTGTTAATTGTATTCTGG - Intronic
1037207467 8:16340323-16340345 ATATTATTCAAAGTGCATAATGG - Intronic
1037704136 8:21303068-21303090 ACATTATGCTAAATGAAATAAGG + Intergenic
1038232013 8:25709758-25709780 ATAATATGCTAAATGTAATTTGG + Intergenic
1038707729 8:29910438-29910460 GTATTGTGCTAAGTGTGTTTAGG - Intergenic
1040633303 8:49240816-49240838 ATATTATGCTAAGTGGTGTAAGG - Intergenic
1040696745 8:50008465-50008487 TTATTATGTAAAGTTTATTACGG + Intronic
1040721118 8:50324390-50324412 ATATTATGGAAAGAGTATTGAGG - Intronic
1041789878 8:61683055-61683077 ACATTATGCTAAGTGCAAAAAGG + Intronic
1041868929 8:62610962-62610984 CTATTATGCCAAGAGTTTTATGG - Intronic
1042257474 8:66820324-66820346 ATATTATGCTAAATGAACAAAGG - Intronic
1042361606 8:67890087-67890109 ATATTATGCAAAGTGAAATAAGG + Intergenic
1042721241 8:71828855-71828877 ATATTATGCTAAGTGAAAGCAGG - Intronic
1043088452 8:75867374-75867396 ACATTAGGCTAAGTGAAATAAGG - Intergenic
1043214835 8:77572975-77572997 ACATTATGCTAACTGAAATAAGG + Intergenic
1043614057 8:82103665-82103687 ATATGAAGCAGAGTGTATTAGGG - Intergenic
1043672529 8:82905186-82905208 ATATTATGATCATTATATTATGG + Intergenic
1043705812 8:83348898-83348920 TTACTGTGCAAAGTGTATTAAGG - Intergenic
1044078683 8:87857045-87857067 CTATTGTGCTAAGTGTGGTAAGG - Intergenic
1046257067 8:111714446-111714468 ACATTATGCCAAGTGAAATAAGG + Intergenic
1046666123 8:117005343-117005365 ATCTTATGCTAAGTGAAAGAAGG - Intronic
1046714397 8:117551597-117551619 ACATTATGCTAAGTGAAATAAGG + Intergenic
1046782315 8:118229009-118229031 CTATTATTCTAAGTGAAGTATGG + Intronic
1047314602 8:123721138-123721160 ACATTATGCTAAGTGAAATAAGG - Intronic
1047372045 8:124264249-124264271 ACATTATGCTACGTGAAATAAGG - Intergenic
1048627768 8:136204829-136204851 ACATTGTGCTAAATGTTTTAAGG - Intergenic
1048772584 8:137911352-137911374 ACATTATGCTAAGTGAAAGAAGG + Intergenic
1048945633 8:139444517-139444539 ACATTATGCTAAGTGAAATAAGG - Intergenic
1050996338 9:12222929-12222951 ATATTATTCTAAGTGGTTTATGG + Intergenic
1052053386 9:23875365-23875387 ACATTATGCTAAGTTAAATAAGG - Intergenic
1052254788 9:26443289-26443311 ATATTCTGCTAATTTTACTATGG - Intergenic
1052412536 9:28140908-28140930 AGATTATATTAAGTATATTACGG - Intronic
1053525238 9:38823271-38823293 ATATTATGCTTTGTTTAATAAGG - Intergenic
1053579120 9:39385174-39385196 ATATTAAGGCAAGAGTATTAAGG - Intergenic
1053588249 9:39483095-39483117 ACATTACGCTAAGTGAAATAAGG + Intergenic
1054100703 9:60943979-60944001 ATATTAAGGCAAGAGTATTAAGG - Intergenic
1054122078 9:61219353-61219375 ATATTAAGGCAAGAGTATTAAGG - Intergenic
1054197468 9:62047719-62047741 ATATTATGCTTTGTTTAATAAGG - Intergenic
1054578055 9:66882199-66882221 ACATTACGCTAAGTGAAATAAGG - Intronic
1054585644 9:66962906-66962928 ATATTAAGGCAAGAGTATTAAGG + Intergenic
1054640942 9:67540983-67541005 ATATTATGCTTTGTTTAATAAGG + Intergenic
1054887407 9:70213430-70213452 TTTTTAAGCTAAATGTATTAGGG + Intronic
1055987835 9:82070226-82070248 ACATTAAGCTAAGTGAAATAAGG - Intergenic
1056159889 9:83878622-83878644 ATATTATGCTAAATGAAATAAGG + Intronic
1056311975 9:85349891-85349913 ACATTGTGCTAAGTGAAATAAGG + Intergenic
1056360337 9:85851195-85851217 ATATTATGCTAAATGAAATAAGG - Intergenic
1056495873 9:87154758-87154780 GTATTATGATAAGTGCACTAAGG + Intronic
1057310860 9:93942238-93942260 ACATTATGCTAAGTGAAATAAGG - Intergenic
1057341298 9:94204196-94204218 ACATTATGCTAAATGAAATAAGG + Intergenic
1057963798 9:99483016-99483038 ACATTATGCTAAGTGAAATTAGG - Intergenic
1058197072 9:101990746-101990768 ATATTATGCTAAGTGAAATCTGG + Intergenic
1059205528 9:112460880-112460902 ATATTATGCTCATCTTATTATGG + Intronic
1059217313 9:112576623-112576645 ACATAATGCTAAGTGTAAGAGGG - Intronic
1059462902 9:114446213-114446235 ATATTATGCTAAGTAAAAGAAGG + Intronic
1060930104 9:127484196-127484218 ACATTATGCTAAGTGAAATATGG - Intronic
1186673368 X:11790124-11790146 ACATTATGCTAAGTGAAATAAGG - Intergenic
1186942189 X:14521777-14521799 AAGTTATGTTTAGTGTATTAAGG + Intergenic
1187111235 X:16302802-16302824 ATATTATGTTAATGGAATTAAGG + Intergenic
1187645806 X:21345750-21345772 ACATTATGTTAAGTGAAATAAGG + Intergenic
1188303552 X:28534533-28534555 AAATTAAGCTAAGTCTTTTACGG - Intergenic
1188598266 X:31928130-31928152 ATATTATGCTGAGGGAAGTAAGG + Intronic
1188633845 X:32403165-32403187 ATGTTATGCTAAGTGTTATCTGG + Intronic
1189019366 X:37318440-37318462 ATTTTATGCTAAGTCTAATGAGG - Intergenic
1189535500 X:41930857-41930879 TTACTATGCTAAGTGCACTATGG + Intergenic
1189782027 X:44524337-44524359 ACATTATGCAAAGTGAAATAAGG + Intronic
1189796887 X:44653893-44653915 ATATTATGCTAAGTGAAATAAGG - Intergenic
1189936243 X:46071709-46071731 AGAATATGCTAAGTCTATTTCGG + Intergenic
1190492468 X:50996186-50996208 ATATTATACAAAGTGTTCTAAGG + Intergenic
1190741902 X:53294366-53294388 ATAATATGCTAAATGCATAAAGG - Intronic
1190896413 X:54622822-54622844 ATATTTTCCTAAGGGTTTTATGG + Intergenic
1192092257 X:68172323-68172345 AAATTATGCTAAGTGAAAGAAGG + Intronic
1192127894 X:68519097-68519119 TTATTAAACTAAGTGAATTAAGG + Intronic
1192291723 X:69803928-69803950 ACATTATGTTAAGTGAAATAAGG - Intronic
1192375706 X:70559282-70559304 AAAATATGCTAAGTGAAATAAGG + Intronic
1193546448 X:82836298-82836320 ATATTATGTTAAGTGAAACAAGG + Intergenic
1193674105 X:84426519-84426541 ACATTATGCTAAGTAAAATAAGG + Intronic
1193730906 X:85101891-85101913 ACATTATGCTAAGTGAAATAAGG + Intronic
1193947640 X:87757802-87757824 CCATTATCCTAAGTGAATTAAGG - Intergenic
1193989885 X:88293607-88293629 AAATAATGCTAAGTGAAGTAAGG + Intergenic
1194336753 X:92657474-92657496 ATATTATGCTTTATGCATTATGG - Intergenic
1194636967 X:96357719-96357741 GTATTATGCCATGTGTATGATGG + Intergenic
1195263332 X:103155551-103155573 ACATTATGCTAAGTGAAAAAAGG - Intergenic
1195462938 X:105147603-105147625 ATATTATGCTAAGTGAAAGAAGG - Intronic
1195621234 X:106957264-106957286 ATATTATACTCAGTTTATAAAGG + Intronic
1195958120 X:110355952-110355974 ATACTATGCTATGTGAAATAAGG + Intronic
1196247774 X:113420938-113420960 TCATTATGCTAAGTGAAATAAGG + Intergenic
1196637598 X:118021177-118021199 ACATTATGCTAAATGAAATAAGG - Intronic
1196753002 X:119134246-119134268 ATGTTATGTTAAGTGAAATAAGG - Intronic
1198131939 X:133704485-133704507 TTTTTATGCTAAGTTTGTTAAGG + Intronic
1198324717 X:135557625-135557647 ACATTATGCTGAGTGAAATAAGG + Intronic
1198818366 X:140617512-140617534 TTATTTTGATAATTGTATTATGG - Intergenic
1198913058 X:141635420-141635442 ATGTTGTGATAAGTGTATTAAGG - Intronic
1198924439 X:141771932-141771954 ACATTATGTTAAGTGAAATAAGG + Intergenic
1199003213 X:142664671-142664693 ACATTATGCTAAGTGAAATAAGG - Intergenic
1199286578 X:146060995-146061017 ATATTCTGCCAACTGAATTATGG + Intergenic
1199362147 X:146933777-146933799 ATTTTATGTTATGTGTATTTTGG - Intergenic
1199761623 X:150908760-150908782 ATTTTATTCTAAGAGTTTTATGG - Intergenic
1199775456 X:151007042-151007064 ACATTATGCTAAATGAAATAAGG - Intergenic
1199804968 X:151290267-151290289 ACATTATGCTAAGTGCAATAAGG - Intergenic
1199918248 X:152368409-152368431 ACATTATGTTAAGTGAAATAAGG - Intronic
1200007503 X:153097433-153097455 GGAAGATGCTAAGTGTATTAGGG + Intergenic
1200436647 Y:3159690-3159712 ATATTATAATAATTGTATTTAGG + Intergenic
1200645184 Y:5774215-5774237 ATATTATGCTTTATGCATTATGG - Intergenic
1200894615 Y:8361667-8361689 ACATAATGCTGAGTGCATTATGG - Intergenic
1201079136 Y:10218141-10218163 AGATTCTGCAAAGTGTATTTTGG - Intergenic